2020-08-02

Aha BBC save the day again for Boris.

https://www.bbc.co.uk/bitesize/articles/zqx3p4j

BBC Saves. Move over Jesus.

Oh my…
Love, can you flip on the Beeb website and see what they suggest for having fun today?

Hi all

Please let me know what you think of this idea .

The idea is to borrow from the Extinction Rebellion model and allow autonomous groups to come under one banner to help get traction with the public.
Thanks

Just commented on previous thread. Intended to be helpful. Replace allowing with gathering. Allowing doesn’t sound good. Pedantic is sometimes fundamental with comms.
Cheers Lockdown you are making good efforts.

Oops didnt notice the change of thread.
I like the bird in cage logo…that’s very clever.
But why Twitter?? Surely don’t you think that Twitter will rapidly take the account down?
I know it’s got more circulation than Gab, but we all know by now that Twitter is ruthless.

Twitter is just an example. We can be everywhere with multiple accounts like Extinction Rebellion do. There are so many heads on that hydra that it cannot be killed.

What about the Greek (I forget the name) that turns everything to stone? Could we find one of those? Could be very useful. Point it at Twitter HQ. Stoned!

Medusa or Gorgon?

Medusa is the name – gorgon was the kind of creature she was.

Petrifying is already in act. What you need is the call by which to break the spell, AS for XR – I see that as a completely astroturfed to down PR job. They effectively own all the bases and so as with BLM – can organise anything at across a broad base of captured proxies. Hence astro-turfed.
The next thing is that ‘we’ can be totally infiltrated and subverted by the systems we run on so as to run with an illusion and be run by a master of illusion.
Everything runs on consent – and the inducement to fear or reward operates to get you to give your consent. You cannot really change another’s mind – but in holding open a mind that is rooted in the heart’s honesty you can be a light to others without trying – just by being yourself.
If you are fear-framed in problem you wont think this can mean anything. That’s ok. It means you choose to consent to the problem as the priority that your heart must be denied in order to adapt to. And if the self-betrayal is acceptable in exchange for a masked adaptation to a new normal you consent to wear it. I’m not talking about face covering here but the face we put on and over conflicts that we either bring to a reconciliation in our own choices or persist in conflicted choices – that effect a choice to doublethink under fear and threat of room 101.

Say no to the Consensus. Remain skeptical.

I suggest you give Parler a try.

I like it. A national poster campaign like this will help to rally more people to the cause. To gain traction with the public, we need to steer the conversation away from the media’s perception of people who don’t support the lockdown, i.e. conspiracy theorists, on to a more serious discussion involving facts and figures presented in an easy-to-understand manner – much like Project Fear was, I suppose.

Well put. Thanks

Good idea and worth a try. But the trouble is the media have always categorised any one who doesn’t agree with them as a conspiracy theorist or tries to discredit them as far right / far left or as being crazy or past it. Once public opinion changes the media then start to change their tone, but us early sceptics will unfortunately have to take abuse until it gets to that stage. They have ignored and smeared various medical professionals and individuals such as Lord Sumption and Peter Hitchens so us mere mortals don’t stand a chance.

This is true Darryl, which is why we must steer clear of anything that IS conspiracy. Just the numbers.

I personally think the case for lockdown can be discredited on the inflated official numbers. Unfortunately the population seems so dumbed down that they don’t realise around 550,000 would die this year without ‘Covid’ and some people believe you should lockdown to save a single life. It’s hard to counter that level of thinking.

I often said to people (even before covid-19) that if they wanted to be perfectly safe, they could just try staying at home 24/7, but even then there’s a problem with atrophy, vitamin d, etc… and depending on what flies through their windows they might still get anaphylactic shock or get infected… Living—dangerous business

We need to get simple, proven to be true facts out.

If someone sees a sticker and it gets them thinking and then their sister tells them the same fact the next day then a change can occur.

Those who think we should lockdown to save just one life should be asked how many cancer patients should be sacrificed to achieve that.

Then they should stop driving cars to save a single life. God I am getting so fucking angry with that moronic reasoning

Agreed – focus on the facts and statistics and avoid anything that could be labelled as “conspiracy”, even entirely plausible stuff related to WHO corruption and Big Pharma money. Also as much as possible avoid anything politically divisive that isn’t directly related, especially issues like Brexit and BLM.
I’d say it’s important to avoid anything that (a) makes it easy for the media to use labels like “conspiracy theorist” and “contrarian” (although they’ll probably do this anyway) and (b) might alienate or confirm the prejudices of people with different political opinions, especially those on the left who might automatically dismiss sceptics as “Brexiteers” and “libertarians”.
I might be too optimistic here but I think a lot of “lefties” outside the world of media/journalism (which seems, like the government, to have its own agenda regardless of what the actual facts are) might stop and think when confronted with the facts of the virus’s decline vs. the effects of the lockdown on so many people’s livelihoods and health.

By nature a conspiracy theorist and following research I think quite a few are easily verifiable with public domain facts but I agree with this. Steer away from conspiracy theories and stick with the numbers. That’s enough and it keeps the message clear.

Yes, but government numbers result from a government conspiracy.

I think the CEBM handled this element rather well. When they showed how it was technically impossible for anyone diagnosed with Covid to die with anything else they reported it as a statistically anomaly. Obviously, it came about because PHE had chosen to measure deaths in a particular way, but by simply highlighting the insanity of regarding someone dying in a bus crash months after recovering from Covid yet still being regarded as a Covid fatality they gave it more salience.

I personally don’t think the Government is responsible for this particular measurement issue – I think they’re simply too dim to understand this stuff – but people will draw their own conclusions from the basic facts.

The idea is to bypass the MSM and let the sceptical people convert their friends, families, colleagues and neighbours one by one.

The more people speak up, stating facts, then they have to listen. Just look at what happened in Germany yesterday, 1.8. 1.3 Million on the streets. The main stream media reported 20k, and stating they are AfD, conspiracy people, anti Gates, anti 5g. No, they mainly ordinary people afraid for their human rights and for the future of their children.

Lies do not establish the truth no matter how many or how forcefully asserted.
Rest in the truth and learn not to attend the lies.
I have not ignored Hitchens and Sumption and many others and I live the fruits of the choices I live. What others choose is not my business to control – but insofar as I am moved to I engage in communication – principally to wards waking to the fact that we are beings of choice and not set or locked down in anyone else’s meanings. The media are hollow tools of a desperate and deceitful lie. But their function remains a true service waiting to be fulfilled.

I think this is a great idea…. a united alliance against covid tyranny will hopefully gain traction.
It will require a figurehead though….. we got any autistic Swedish teenagers here?

Perhaps the figurehead ought to be named Goldstein?
Edit: I mean that seriously btw. NOT a flippant comment.

Sole guardian of truth in a world of lies.
Yes.

Abduct Greta T and subject her to hypnosis.

Great idea, LT. Thanks very much for doing this.

Thanks

Also engage with PR connected individuals (with connections) to get into the papers, on TV and other social media feeds.

some music to accompany your great idea and gallant efforts:

https://www.youtube.com/watch?v=5hZBEr9FKEo

Duppy Conqueror – Bob Marley and the Wailers

great choice!!

Anything like this is a move in the right direction! Yesterday’s Berlin demonstration was really inspiring, I really hope we can see something like this in the UK before too long.

I’d certainly be interested in joining a group local to me (Thames Valley, east Berkshire)

Set one up. You can be the guinea pig for the first autonomous group. Email me if you want leaflets designed etc

Cracking one.
Yes, count me in.

Where did you get the name “We Will Be Free” from? I ask this because that’s the name of the Twitter campaign page I’ve been running since April:
https://twitter.com/WeWillBeFree82

Can I suggest you give it another name?

You already have a pretty decent name in “Lockdown Truth”. I’d maybe stick with that?

Some others I’ve thought of:
– Lives B4 Lies
– I/We Do Not Consent
– No New Normal
– Our Lives Our Future
– The Great Covid Con

Just sent you a message on Twitter…

“Facts Not Fear” is a good one, not my idea but from this Twitter user: https://twitter.com/dockaurG

The New Abnormal.

The worry is you might get too many 5G and “anti-vaxxers” involved.

There are some legitimate rational concerns about vaccines hence my quotes. And maybe we don’t need 5G but it has absolutely nothing to do with Covid.

This sort of thing is not a problem for Extinction Rebellion as they’re quite happy to be madder than any of the hangers-on they attract.

We would have our official principle aims on the website and people would be bound by that. If anyone strays into dodgy territory we tell them to stop etc.

We need to crowd source this and bypass MSM. So there will be a risk of some people being silly. We just need to have an iron clad constitution (in more ways than one!)

“anti-vaxxers”

That’s what big pharma and the MSM call us, guy. You seem like a rational human being – vaccine opponents ?

Anti-War demonstrators during the Vietnam War.

Vaccine sceptics? Vaccine realists?

Well I did use quotes and qualify the statement

For sure. Just trying to save you some pondering/typing time.

The few people who will listen to me when they have said “anti vaxx” and then I explain how stupid it seems to have a vaccine to an illness in less than a year when we haven’t had a coronavirus vaccine for 70 years and suddenly they are anti this vaccine, so actually it is a good thing for this one time! However of course vaccines which do prevent illnesses measurably without side effects are useful and should be taken. As for 5G, people need to go back to GCSE physics and learn the electromagnetic spectrum and realise that it is literally impossible that they can alter anything. Maybe if they’re worried about it being high frequency they need to stop opening their eyes, because visible light has a frequency orders of magnitude higher….

Crikey, if you’re the best the bad guys can do, this crisis is over.

‘vaccines which prevent illnesses measurably without side effects’ – go for it. There must be some …

5G radiation at around 60GHz is absorbed by oxygen, leading to problems with it (oxygen) being up taken by blood/haemoglobin. ‘Literally impossible they can alter anything’ is just untrue.

How does that lead to problems with it being taken up by haemoglobin?

Ideally, 5G proponents would have to prove there are no problems.

I dunno is the proper answer; the current status of 5G means that getting an accurate answer might be tricky. Vague recollection of an ancient Russian paper suggesting issues in animals ?

Always good to do these things one step at a time though – ‘5G can alter things’ being step one.

Like the idea and have just followed the Twitter page.

Thanks a lot for this.

Thanks

In Germany they have local groups Querdenken. They orginsed the demo in Berlin yesterday, with 1.3 Million people attending, not 20k like the mainstream media claims. I would love to have a local group, mu town is so conservative, and all the people with half their faces covered give me anxiety attacks.

Great idea. Can I make a suggestion that I hope you will take as constructive criticism? Instead of ‘We Will Be Free’ how about ‘We’re Taking Back Our Freedom’? ‘We Will Be Free’ has the unspoken ending of ‘when they let us’ rather than the proactive ‘we’re doing this ourselves’. WE have the power, after all.

ER are irritating, upper middle class, pseuds who were intensely annoying to most ordinary people. I certainly didn’t see them winning anyone over. If you want a model for a distributed network of activists Antifa would be a better example. Or AQ.

Hey that’s a thought. Where are the Extinction Rebellion useful idiots? Don’t they want less humans? Well here’s the perfect chance for all of them to become “cases”. “Cases” does mean carriers of death on their way to the grave doesn’t it? Anyway, it’s what they want. They’re not cowards are they?

great pic of the protests in Berlin Toby

I watched several streams and there were A LOT of people there

some drone footage of the Berlin protests would have been helpful in guaging the number of people there

I don’t think Melbourne is a “minor uptick”. It looks like they’re actually getting their Covid epidemic now.

Postcard to AU from the UK: it’s not that bad, protect the hospitals and care homes, go easy on the ventilators, wash your hands, don’t panic and it will all be over in three months.

It will all be over in terms of the virus, but definitely not in terms of the madness to follow…

I have a horrible feeling that, whether through incompetence or actual malice, they’ll make exactly the same mistakes with care home/hospital infections that the UK and many other European countries (and US states) did.

But maybe, just maybe, the Australian situation will also make more people realise the futility of the “zero Covid” approach.

Personally I don’t think the care home deaths were truly a ‘mistake’ – I think they wanted to reduce the pension ‘burden’…

However, as overall mortality is not out of average range – the population is so far rather resilient despite the degradations.
While not applicable to those in end of life ‘care homes’ – the overall deaths may have dipped as a result of escaping medical treatments. Whie this may sound flippant. IN UK and USA iatrogenic disease is at least third leading cause of death. But as with masks, belief in protection can outweigh any evidences as a result in lack of belief in the body as resilient, regenerative and resourceful in coping under stress.

I live in Melbourne and think “minor uptick” is an appropriate description. There have been a total of 123 deaths in the entire state of Victoria over the last 6 months, and these mostly due to recent outbreaks in care homes. Yet our premier has just declared a state of disaster in Victoria, the media has hypnotised the population into a state of panic and hysteria over daily infection rates, and cowering in fear of the terrorizing police presence . I feel like I must have fallen down a rabbit hole, bewildered by the high strangeness that surrounds me.

A small number of deaths like that does potentially mean you’re close to a tipping point because there will be a great many more infections.

Australia has hardly any herd immunity. They managed to stomp on it before with about 100 deaths so perhaps they can again but I think the following is working against them: it’s winter, and lockdown fatigue.

If they do want to have another go at stamping it out they are going to need very strict restrictions for a short time, and then shift gears rapidly to herd immunity plus mitigation as soon as it’s clear they’ve failed. This is going to be almost impossible politically so I fear we are going to see the worst of both worlds. A few thousand Covid deaths depending on how well they do with treatments and management of care homes plus destructive and futile restrictions causing thousands more.

Is there any case for even trying to halt the inevitable? I know most here will think not and I’m inclined to agree. But a sketchy vaccine or two may not be far away and some people might think having come this far it’s worth a shot. You can make a case for that. It’s not Boris Johnson mad, not yet anyway.

I certainly agree it is futile to try and halt the spread and we should just “take it on the chin”. But I am afraid that would be going against carefully orchestrated public opinion. Almost no one here is able to put the deaths into context and come to terms with the fact that elderly people in care homes do die with predictable frequency .

I am still reading the latest on Melbournes”State of Distaster ” to find out what it actually means.

From our Premier “This means that police and others have additional powers.We can suspend various acts of the Parliament and make sure that we get the job done and there’s no question about the enforceability and the way in which new rules will operate.

Anybody breaking the 8pm curfew, we always reserve the right not just to fine you on the spot but to take you to court – and then it’s not $1,652, it’s actually $10,000,”

So martial law then.

Very nasty stuff. We never had it that bad in the UK. They were fairly small fines and hardly any enforcement.

So their scientists have discovered that the virus is nocturnal and only stalks the streets after 8pm?

It’s either a nocturnal virus or a coup.

The state of play in Australian cities at the mo literally sounds like V For Vendetta

It really is. Part of me wants to pretend it is happening, because it couldn’t possibly happen in Australia.

$1652 is a weird figure. Where did they conjure that from?

I don’t know about you Nat, but I’d think that a state of disaster would mean complete collapse of society and bodies lying dead in the streets. Someone needs to introduce Daniel Andrews’ ugly face to a brick wall. I am entirely against my will stuck in Australia until this nonsense ends, but my mother and aunt are just as furious as me, and my cousins and some of my friends get away with as much as they can. As my grandfather is dying from metastatic pancreatic cancer, we all have no patience for this ridiculous farce. I can only imagine we are far from alone, and this may well be the final straw. I hope to see police snubbed, violently if need be, in the streets soon (for what it would represent – the complacent populace finally pushed past breaking point).
I did see a woman walking her dog without a mask – it appeared to be in her hand, but that is certainly not permitted by their illegal regulations.

It’s going to be painful. At least in the UK infections had already peaked before the lockdown so all they all had to do was sit back and enjoy the tyranny while taking credit for falling cases. But in AU they’re going to be still going up for a while.

Don’t expect herd immunity to be non existent in Australia. The considerable spread of common cold coronaviruses no doubt will have a considerable effect as elsewhere, and Australia has always been very popular among the Chinese so if the suspicions regarding much earlier spread of a milder form from this time last year are correct, Australia will have a lot of immunity already present in the population. This seems so far to be borne out by the figures, but we shall see anyway.

The NSW chief medical officer recently revealed that tests on blood donations and serology surveys had shown that 1-2% of the Australian population has been infected. Upon questioning she later said that she believed that it would be less than 1%. At best, there is a long way to go if these figures are correct.

That’s a similar situation everywhere. I think the pre-existing cross-immunity is important but is likely to be about the same everywhere. At least, there’s no reason to think it would be any different in Australia.

When I say “no herd immunity” I mean nothing to stop the initial spread of SARS2 compared to any other country. I would expect it to follow the same sort of curve and to end up at about 20% serology.

I feel for you Nat. I’d be losing my mind if I was living in your neck of the woods

The hysterical public and mad scientists got what they wanted. Stage 4. I’m miserable about it.

It’s winter in Melbourne. New Zealand likely to get a bit of it too. But neither country is very crowded, people live outside a lot so healthy. They’ll be fine, except for the poor sods with cancer etc who’ll get thrown under a passing bus.

That’s the trouble with the restrictions in Melbourne – basically you’re not allowed outside. And the ‘infections’ are up one day, then massively down the next, there’s no clear trend. They’re also almost certainly from at least a week before the date they’re announced, given the amount of time it is reportedly taking for people to get results from the bogus tests.

You are correct: Australia had no outbreak in March/April/May – it was almost entirely returned travellers.
Unfortunately for your advice, Daniel Andrews has already failed on care homes, despite the warning signs from abroad. Most hospitalisations are care home residents, though at least they’ve evacuated them FROM the care homes and not TO them like the UK.

I absolutely loathe Daniel Andrews but those people weren’t long for the world regardless. The care homes had issues before this and despite the Royal Commission inquiry, not that much improved.

Ported across from the previous thread as just posted before new page.

Sunday View. The Richie Allen show. One hour of excellent comment taking apart the UK msm corona/covid19 propaganda.

https://www.podomatic.com/podcasts/richieallen/episodes/2020-08-02T04_11_34-07_00

Wise thoughts about not becoming depressed by this. Warnings about where this is leading and not to expect others to do what each of us must. A really good hour of a radio show.

Useful to share onwards to any open minds that do watch BBC SKY etc and are starting to question.

I listened to it too. From Montreal, Canada. Am now listening to his Tuesday, July 21, 2020 broadcast.

Not all academics have fallen for the panic narrative. Professor Dingwall, like Professors Heneghan and Gupta have been consistent throughout. Let’s hope, in addition to notable colleagues overseas, somebody – anybody – in government starts to listen before it is too late – that time is sooner than many think:

https://www.dailymail.co.uk/news/article-8585039/Professor-Robert-Dingwall-calls-sense-proportion-brands-Covid-19-nasty-infection.html

Dingwall is great.

Unfortunate typo, though. He is quoted as:
“‘Covid-19 has been linked to about 50,000 deaths in the first 16 weeks of the UK pandemic – but about 1,000 people normally die every week.”

That should be 10,000, not 1,000.

Unfortunate or deliberate by subbie?

I thought that was odd!

Professor Robert Dingwall, whattaguy!!

This is scary. Mainstream media is now running the UK and they love a disaster story. 2nd wave now inevitable whether it happens or not

Whack-a-mole? I’d have more confidence in Guacamole!

I’m hungry

Salsa anyone?

HIGHLY RECOMMENDED : Please listen : Interview with Prof. Harvey Risch, Yale Prof. Epidemiology who is calling for immediate use of HCQ because it works:
https://pandemic.warroom.org/2020/07/31/ep-309-pandemic-emergency-tactic-w-dr-harvey-risch-david-bahnsen-bill-mcginley/

AARGH! They are NOT CASES. A “case” is when an individual has symptoms, a doctor suggests it might be x & sends off tests and the test comes back + ve for x. That is a “case” of x. Perfectly healthy people wbo test +ve are NOT CASES. I know that most here know this, but the constant twisting of language is making me sick! I suggest all mention of “cases” (other than direct quotes) are placed in inverted commas as above. . . . Grrr!

Literally whole areas of science and medicinal practice are being re-written under COVID-19… I hope one day the society looks back on this period and realises just how moronically they’ve behaved.

They’ve changed their language a bit now and are referring to ‘infections’ more (because it sounds scary) and ‘positive tests’. ‘Cases’ is still their favourite.

Exactly. The term ‘case’ has developed this new Humpty-Dumpty meaning of a ‘positive’ result from a highly suspect and inappropriate test for RNA fragments.

It has nothing to do with viral infection or illness, except by coincidence.

Yaas. Just saw ITV news reporting an increase in “cases” on South Africa. On screen was a sign of remembrance for the dead . . .

There are simply different versions of mind capture and those who still value the freedom to question the language and meanings that frame the mind of conditioned reaction or polarised identity, have the conscious recognition of just how unconscious we collectively are – when masking appearances are peeled away.

Almost everyone refers to Orwell but how many have chosen to learn to recognise and unpack doublethink?
So yes ‘cases’ are simply reinforcing a false assertion tha human beings are vectors of infection regardless of actual or clinical disease – as our new ‘conditioning’ or ‘normal. and every time anyone argues within such an idea they reinforce it and give it more power to choke the basis for any individual freedom, right or creative inheritance, outside the permissions of a bio-security state that is anti-biotic at its core.

The figures for Berlin turnout cited above are very low compared to the impression gathered from following live streams. I’m sure the true numbers will be never known but high tens of thousands or more would be more in keeping with what I saw without being there.

German comments on youtube live stream were using the ‘m’ word for numbers. Regardless it was a very impressive demonstration and a high point of the gathering fight back.

Nertherlands and Bulgaria also had protests yesterday. And London.

I would agree, it honestly looked like hundreds of thousands to me

I thought somewhere between 30-50k from the footage I saw

Shame Toby didn’t give a shout out to the London protest we need all the attention we can get to get to the Berlin numbers. This was the biggest anti Lockdown protest in the UK to date by far. https://www.youtube.com/watch?v=ncQRUu56np8

Favoured protests get their numbers inflated / unwanted protests deflated. Bit like with government pet projects they make the numbers fit with their agenda. YouTube apparently downgrade viewing numbers for videos it disapproves off as high viewing numbers equal more clicks – most people act in herds unfortunately.

Indy ref marches are hilarious forvthe war over the numbers. 90k claimed, police say 10k – police are skewing the figures.

All I know is Ihave had an ariel view of marches in edinburgh 12k max was claimed to be 100k.

It’s amazing what a bunch of flags and a telephoto lens can do.

Berlin live streams were in amongst it and walking backwards to the procession. It was big.

I was there, it was at least 250.000 protesters, 10x more than reported in mainstream media, biggest protest since 1989. Here is a good article about it (in german) https://multipolar-magazin.de/artikel/gedanken-zum-august-2020

Bring out your dead!

I was thinking about past major pandemics that have plagued humanity and thought it might be pertinent to briefly compare the worst to the one we are currently faced with. Perhaps it may add some perspective to the situation we now find ourselves in..

*The Plague of Justinian.
Took place in the year 541 AD and was claiming up to 10,0000 lives per day in Constantinople. Bodies were so numerous that they were stacked inside buildings or left in the open. Over a third of Constantinoples’s residents died and the ‘plague’ (probably (bubonic) eventually spread to Europe where, according to the ancient historian Procopius, killed at least 25 million people. The actual death toll may have been much higher.

*The Black Death.
Started in 1347, probably from the east and invaded Europe. It lasted around five years, killed somewhere in the region of 50 million people which was estimated at half the population of Europe. Whole populations of towns were wiped out and it was said that the living spent most of their time burying the dead.

*The great plague of London.

This took place in 1665 and at its peak was claiming the lives of 8,000 people each week.
The wealthy fled to the countryside leaving the poor as the main victims. London’s authorities tried to contain the infected by quarantining them in their homes which were marked with a red cross. Total death rate was estimated at between 75,000–100,000—around 25% of London’s then population—before the outbreak eventually subsided and was finally extinguished by the Great fire .

*The third plague pandemic.
The first two major plague pandemics began with the Plague of Justinian and the Black Death. The most recent, the so-called “Third Pandemic,” erupted in 1855 in the Chinese province of Yunnan. The disease traversed the globe over the next several decades. The worldwide outbreak would eventually claim some 15 million lives before petering out in the 1950s.

*And now we have the 2020 major pandemic that has spread across the world at lightning speed locking us in our homes, shutting down economies and spreading fear and trepidation to billions of people. However, compared to its historical forbears this ‘plague’ really is something of a damp squib. Apparently, we can catch it or pass it on by inhalation, exhalation, touch, coughing, sneezing, and even when standing less than two meters from another person it can ‘leap’ across to contaminate. It can swim, is carried on currency, clothes, books, and, according to some, can even be transmitted by the evil eye.
This plague really is a bugger and judging by governments across the world this is a pandemic like no other and because of it we have to be locked in our homes for our own good.

The only problem of course is that this is a plague in search of a cause and indeed in search of victims. This deadly disease is notorious by its absence of dead and dying. No piles of bodies with this one. No towns or villages wiped out and barrows being pushed about to carry off those who have expired. It is unique in that no one knows anyone who has either had it, or indeed has it , save the so called Covid deaths that affect those in their eighties or over and who’s word on these are only released to us by official decree. It is called a Coronovirus, which to anybody who knows even the minimum about these things indicates that it is a ‘cold’ to varying degrees. So, we have the world locked down because there is the possibility of catching a cold..

What are we to make of it? Historical plagues were real because the dead and dying smacked everyone in the face and survivors had hard experience of the reality of it. This Covid plague does not present us with physical evidence that we can measure by experience. All we have are media assurances, dictated by government decree, that somewhere out there in the great blue yonder lies something that we cannot touch, cannot see, cannot feel, cannot smell, cannot comprehend and cannot see anyone so affected within our society. Never the less, we are constantly harangued that if we let down our guard, it will jump on us and deliver us towards a fate worse than death. In other words: this plague is real all right but it is a plague of fear, and that fear is stoked every day by a corrupt government and a compliant media..

Even with the Black death there were those who were genetically unique and naturally immune. Today, as we face this plague of ‘Fear’ there are those of us who are, in a similar vane, ‘naturally immune’.I would reckon that the naturally immune frequent places like this web site and as others have said, perhaps it is up to us to go out and appeal to those who also possess this immunity—they’re just not aware of it yet.

Plagues of the past were treated by medical ‘experts’ using bloodletting, leeches, lancing and other crude techniques which we now look back on with ridicule. Today, we are urged to wear masks, refrain from visiting our families, ceas

Indeed. But you don’t have to go that far back to show up what an incredibly stupid shit-show is this pantomime. Simple fact :

Anyone my age ( mid-70s) will have lived through more than a dozen epidemic seasons of more mortality than this one!

… and (by definition) – have survived without noticing the fact.

I copped bad bouts of ‘flu in two of the real pandemics (as opposed to this political one) – so I don’t need any f.ing lectures from Cabinet idiots and their satraps, and I’m quite (actually *more*) capable – as someone in the vulnerable category – of assessing my own risks. I’ll take my chances and try to dodge any bullets – of which there are none around at present; it’s a cease-fire.

I certainly am not going to take medical risk advice from a narcissistic liar of no accomplishments other than self-advancement and bull-shit.

Yes, maybe we should (in our leaflet) quote the numbers who died in the UK in recent flu seasons where those number were similar to Covid deaths?

eg ‘In (year) x thousand died of flu in the UK, but we did not lock down, nor did we do social distancing, close schools or wear masks’

I also think we did to make people aware of the numbers who die daily in the UK under ‘normal’ circumstances..seems most people have no clue!

Absolutely. Especially for instance how many people died from pneumonia and bronchial complications last year, and how many this year.

Sorry—glitch in posting!
Last paragraph in full:–

Plagues of the past were treated by medical ‘experts’ using bloodletting, leeches, lancing and other crude techniques which we now look back on with ridicule. Today, we are urged to wear masks, refrain from visiting our families, cease all methods of touching and affection, stand at least two meters apart and perform ridiculous gyratory movements in our efforts to avoid other people. All of this advice is given by today’s medical ‘experts’ complete with their plethoras of diplomas and degrees. I cannot help but think that the doctors of the middle ages might be worthy of more credibility.

This pandemic is one of government stupidity and so-called “scientists” trying to drive their own agendas. (btw, this is not meant to libel or decry those scientists who are still following scientific method using observation, data and only model as an aide, rather than as a theory)

The Immunity Clause.

Fell through the gap so am posting this again.

Is there any mileage in asking shops and supermarkets to post the government’s list of exemptions to mask wearing at their entrances, along with links to where exemption cards can be printed off? After all, they display the mask signs but not every shop announces, like ASDA did on Friday, that some people are exempt and not everyone can hear what is said, or even wants to listen. I am aware that many people haven’t a clue about exemptions.

Some places, like railway stations carry the sunflower symbol for hidden disabilities but we were only made aware of that a few weeks ago when we enquired at our local station about maskless travel. Someone posted on here that Sainsbury’s are also selling the lanyards.

if comments in the Daily Fail are anything to go by, under the link posted here yesterday about loss of footfall, you would think that shops would be glad to do something to help themselves-many people there refusing to go shopping until masks are dropped.

kh in response to my post on the previous page says she thinks shops are too happy to wield their new power, but maybe it’s because they are terrified of breaking the rules and of litigation.

It certainly wouldn’t harm shops to explain alongside their “Must wear mask” posters that it is against the law to discriminate against disabilities and it could engender a £9000 fine.

Not really, they are not “exemptions” they are examples of exemptions, the crucial part is the reasonable excuse (one that can be reasoned about against the use of mask).

Yes, I take your point IMoz. Well then, display a poster saying that some people have a reasonable excuse for not wearing a mask then go on to list all the examples.
Or as an alternative do it by means of a question i.e. Do you have a reasonable excuse for not wearing a mask? See the list below.
As with most things, it’s all in the small print!

That could enable arseholes to start nitpicking “you’re not on the list of reasons”… Just a poster saying that “Remember that others might have a legitimate excuse for not wearing a mask” and that’s it, is the most sensible solution that is difficult to argue with, I think.

Yes. Northern rail is doing just that and it seems the right thing to do in my opinion. Nobody by law can question you and you only need to tell shop staff that you are exempt. No need for any more details.

You are probably right. I like the poster idea. One of the points I was making above though, is that so many people are unaware that they personally could be exempt and would never think of looking on the government website for assistance. It’s those people that I want to help and “educate”. Also if people realised that they could be in breach of the Equality Act of 2010 and liable to be fined up to £9000, they might be less likely to bully a non mask wearer.

making above

Educating people tends to open up a whole can of worms, it’s probably safer to just say something along the lines of “see: [link to exemption examples in the SI itself]”

Hi Margaret, I get the point that they may be “terrified” but they just seem a little too happy to enforce the rules (there’s absolutely no expression of regret – “we’re sorry for the inconvenience” type of thing). You should see the business WhatsApp page here, they’re absolutely bloody loving it.

I saw this earlier

Latest from the not-so-wild High Peak: Yesterday evening, the largest of the local Coops was faceless-zombie-city except for OH, me and a woman we know in the distance. We know she’s one of us but she’d clearly hedged her bets by wearing a loose scarf round her neck but at least she wasn’t using it as a mask. Sadly we didn’t get to speak to her but it was nice to see her face!

We didn’t get 2 yards in before a man (nutter?) shouted ‘masks’ at us. We said, ‘Excuse me?’ and he repeated, ‘Masks!’. His foul jockstrap was only over his mouth (just) and we said, ‘have you seen the guidelines?’ and he ran off. When we got to the till, we were greeted by huge smiles from 2 staff members who didn’t ask us anything (well briefed?)  We told them about the nutter and they were cross about it and apologised (needlessly). We asked why the Coop wasn’t displaying information about exemptions – something I need to get back to Customer Care about – and they said it is being regularly announced over the tannoy. (We didn’t hear it while we were there.)

Anyway, on we went to a birthday party. All rules followed, more-or-less, and we all spontaneously sang Happy Birthday to the 80-year-old birthday boy. (Hello churches!!) We were joined at our table by a friend. He’s a bit ‘out there’ but showed a good grasp of the politics. ‘Not sure how much he’s really resisting though, he wears a muzzle when he feels he has to. Anyway, our party was legal, no masks, no restrictions but if you enter the nearby chippy (1 in, 1 out) you have to wear a mask. Meanwhile, 5 miles away, in Marple, they are in lockdown so my real viola lesson of last Wednesday was the first and last for a while.

Earlier, a friend phoned. She follows the MSM, has a husband and daughter who buy-in to the lot, wears a mask to keep her safe but hates it yet every time I speak to her she’s getting more suspicious. They have been caught in the West Yorkshire new lockdown and, of course, like many good white middle-class people, she’s swallowed the line that it’s the South Asians’ fault because ‘they don’t socially distance.’  I put her as straight as I could,and she ended up agreeing that ‘government by Twatter’ the night before Eid is sadistic. She’s asked me for some links for information about what’s going on. Hooray, happy to oblige.

Anyway, we’ve heard a rumour that Edwina Currie, who lives locally, ‘follows Toby Young’ and ‘thinks it’s all about money and the cashless society’. If true, I wonder how many more retired Tory Grandees are keeping tabs.on us. If only they had any influence on the psychopaths currently waging war on their own people.

Psychopaths indeed. I prefer “war criminals” as that runs nicely parallel to the terms they have used in their propaganda. Hopefully, we will get a chance to have a Nuremberg trials type event in the future where justice is meted out to everybody who gave or was “following” orders…

Hi Edwina if you’re reading!

I’m a great admirer of your….. shenanigans

I still eat my eggs sunny side up and runny :o))

Interesting that I’ve not had a single word said to me (re no mask) by anyone. One might surmise that these individuals choose their targets selectively ie bullies. I’m actually itching to fire off a polite ‘go fuck yourself’ – alas the opportunity hasn’t presented itself as yet.

As I said, we think he was bonkers and I can assure we don’t present as victims . When we challenged him he ran off anyway.

We’ve had no trouble elsewhere and the Coop staff were friendly and didn’t even ask. What was funny was that his mask was round bis chin and he was not the only one not wearing them ‘properly’ in the store!

I’m not large or hairy but no issues either – been into Tesco & Sainsbury’s, large & small stores, then went into town today – The Body Shop – 2 very sensible (maskless) ladies, M&S – just one maskless lady at the self-service till with a small child & Superdrug, no problems. Disappointed, like others here, at the mass compliance of everyone & the amount of people walking just in the street in masks

Nor me.

Maybe because I’m a goon to seed rugby player build, fat, hairy and pissed off biker who likes wearing leather when I can.

No tattoos or beard though – tattoos because I never saw one I liked and beard, don’t have one as wife hate them.

What do you think we look like then?

Miriam – I am sure that you are not fat and hairy. Tom and Awkward are right though. I also am on the larger and hirsute side and no one has said a word to me either .

No idea and I won’t even try and imagine.

Just glad you’ve had no confrontations but willing and able to handle it if someone was stupid enough to start.

Years of working overseas on the drilling rigs in very, very remote places I’ve met lots of very strange people and learnt a long time ago to go by performance, not looks or perceived notions.

Me neither, got glared at by a bloke the other day but I just glared back. They don’t like it back at ’em these bullies.

They don’t.

I always smile sweetly at the glarers. They hate that even more, haha.

Me too. It really throws them.

Can I just, please, stress again, we were not bullied and we are not victims! I only mentioned it because, unlike us hard cases, some people are terrified of being singled out. I meant to demonstrate that, even if someone says something, you do not have to let them scare you.

Actually it was really a non-event. The person in question was actually terrified of us which was why he just said ‘masks’ and, literally, ran off as soon as we challenged him. Like Farinances and Mr Dee, we tend to smile at masked people which may or may not disconcert them, who can tell?

Please tell me this is not a competition for who (M or F) is the most macho?

Apologies- not trying to be macho. I pooed my pants going I to Lidl the first time. Just an observation based on what people post. It seems to me the ladies are getting more hassle than the men. I would advise anyone wanting to make a stand to start with cornershops,post offices and offies.

Of course women get bullied more; it’s what bullies do. Fortunately, if you stand up to them, they run off, because that’s what bullies do, too.

Same here Tom. I do suspect they go for those they see as easy targets. But many of those know how to look after themselves too! (And quite right too)

Me neither I just get stared at and then I smile at them. Which they hate.

I’m from an ethnic minority so I suppose these people would not want to be accused of racism.

Plus I do have a tendency to look like a miserable git so others tend to stay away.

Somewhat similar round here – Tesco Express, local Co-op, local (Cherry Lane) garden centre and no-one says anything. Occasional looks, but can’t tell if it’s wistful or accusatory. Mind you, heaving around with a crutch does seem to help! (Genuine, BTW, recent new knee!).

Just a quick post as I’m on holiday! We’re in Cornwall in our caravan and I’m trying to pretend the world doesn’t exist… Certainly on the campsite everyone seems ‘normal’! No masks evident (though required in the onsite shop). The worst thing was the people working in the onsite cafe – we ordered fish & chips from there and it was served through a hatch, so no mask required when we picked it up. But, the poor people working inside were wearing them, whilst cooking fish & chips! And it was very hot in there. We haven’t ventured into any towns yet so I don’t know if those reports about terrified residents were how it really is.

enjoy your break most importantly. We all deserve to live, despite whats currently being rammed down our throats.

Thank you

I’m at a chalet site and apart from a new social distancing sign at the entrance you wouldn’t think anything was different this year.There is zero mask wearing and social distancing.Even the local shop has no restrictions.Children are playing and everyone has guests.

Oh lord, there’s going to be so much on FB about that! ‘don’t they know there’s a pandemic on’ ‘nobody’s wearing a mask’.
Seriously have a great time, sorry about the weather today.

I swear to god there people sat in their back gardens in Manchester having a house party whilst going on facebook and posting this shit

Like the sodding Karen who won’t send her kids back to school but is perfectly happy to take them to a crowded beach

Also like the douchebags beating up on Cummings who knew very well they’d been breaking the rules themselves.

We’re all hypocrites basically.
Except us :o)

See this is it. NOBODY CARES because we all know it’s bullshit. As long as you signal virtue in the right places (supermarket) you can act as you please. And people know it.

Dave from Essex, one of the people who has submitted a short video to Anna Brees YT channel is aged 70yrs, has various medical conditions including a brain tumour.

He says he feels like The NHS has closed for him, and feels that either authorities want him to die naturally or he has thought about taking his own life.

What a mess we are in, I am sure that if this chap feels this way how many more do?

https://youtu.be/iiwKjU1XU8I

That video was sad when he started saying that killing himself is “an option”.

I’d like to sit Matt Hancock in a room, have him watch that video and film his response. I suspect the result would change a lot of hearts and minds.

That guy is not alone. I read the other day suicides in the US are now higher than covid-19 deaths, will have to re-check to see if I remember correctly.

My wife is getting very despondent and friends of mine are on the verge of losing everything as tenants not paying rent and cannot be evicted, businesses got or cannot pay back the bounce back loan so going bankrupt.

I honestly don’t think many of those in power at the highest level have any empathy. They don’t seem particularly upset over civilian casualties in illegal wars (Tony Blair). Many sadly get to the top by lying and backstabbing.

Matt Hancock is a potential psychopath for sure. I think his response to such a video would show this pretty explicity
(There wouldn’t be one. He would probably roll out that sickening smirk of his)

he sold his soul.

i work with prats like hancock.

nothing behind the eyes.

Are we to give Matt the Death the same option?

His should be much slower and excruciatingly painful!

Death by a thousand cuts?

that’s roughly what is being inflicted upon now it would seem

Indeed!

I see him as hollowed out and possessed – or if you prefer a muppet.

Alex, A Clockwork Orange.

In the dim and distant past, there was a very nasty serial rapist/home invader in our area. I used to pray every night, and mean it, “Dear God, send him to me…”

I am much older now, but I am still available. I also am very cheap; I am happy to work for nothing, for deserving cases. I have a chair ready for a certain Professor in particular.

I think this will be a very common scenario. Doesn’t it feel like the NHS is closed? This is a return to pre NHS availability, quite literally. The NHS has not been saved it has been destroyed. This is why I am so livid everyday. The complete abandonment of our duty to the vulnerable and those in need without justification. Many people are going to die because of this, how can this be happening? A government inflicted assault on the people of this country. What is happening?

This is one thing I think Corbyn may have been better on. His party is so in hock to NHS worship (irony!!) that I can’t see them switching the NHS off for this long. Whereas the Tories don’t seem to give a fuck, but are disguising that by saying they’re ‘protecting’ it. Ironically they probably started off with precisely that thought when they were shitting themselves about capacity but now…. It’s all gone off the boil. And weirdly everyone, includes Corbynistas, seem to be congratulating them for it. They’ve destroyed the NHS whilst ‘protecting’ it and the people who love the NHS seem to love them for it.

The whole situation is well…
EXTREMELY Ironic to say the least.

I remember the NHS – amazing what can be restructured under PPP – while keeping a masking appearance of seeming to exist while being morphed into the CHS. Expect screen doctors to link with apps on your phone or wristband or implant. If you have the credits you get bio-genetic individual attention but if you are insider insider you will have a personal homeopath like old man Rockefeller.

Thinking about it though what Better way to make sure we all get tested/jabbed. No in person service unless you do.

Something for the autumn then.

“In person GP appointments restored!
Safety guaranteed because everyone will get a free test and vaccine whilst they’re there!”

Like… actually. That’s evil genius.

I know I want my tax money back. Every last penny from the day I first paid it.

in addition, I want every single one of my claps back. So angry with myself that I fell for the Vera Lynn old timie propaganda. Took about 5 weeks for the penny to drop. Been angry ever since and annoying all around with my granny-killing ways. It’s exhausting and some mornings I wake up fearing that we will never have the satisfaction (pretty small in the context of the carnage) of saying-told you so!

Sorry. It’s been used to pay backbenchers to stay home and do nothing.

I think the whole thing should be burnt to the ground. Then scatter diesel to prevent regrowth and build a new one somewhere else.

My anger for the vile bastards behind all this, whether government, SAGE, whoever, is starting to burn as hatred.

Join the club.
Or rather, the battalion.
THEY will pay.

‘You had your way, now you must pay’…

Acknowledge THAT you have feelings and own what is your experience rather than give your power and freedom away, but note that hatred is very unlikely to reach its target but will poison you and leak into your relationships. So for what it is worth I feel for your experience as from time to time I also feel very disturbed.

One way of looking at this is as a profound cognitive dissonance – or indeed loss of capacity to recognise or relate to anything real. This is recognised in some who have lived extreme trauma and who literally lose their capacity to recognise anything when triggered.

Fight, flight or freeze. The first two have some movement through which to grow but a frozen or locked down mind is frozen in a torment they cannot move in or under and are simply compelled by fear. Fear may have a different narrative as insiders are privy to some of what is being enacted (ie they don’t fear a virus).

So who or what is behind all the acquired assets, crisis actors or proxies that are played by carrot and stick?

Or to look at it the other way – by what means are human beings corrupted, conflicted, compromised and betrayed even in their attempt to save themselves?

Fear of pain of loss given power by deceit?
If that is so – and we hate it in ourselves, do we not need to free our mind from deceit? Perhaps it is right that it sickens us to the point of refusing to listen and think in its frame as a command within our being rather than further conflict.

This video is really sad especially after he says that taking his own life is something he’s considering.. The government and Sage should be locked in a room and made to watch it 1 million times or unless it enters into their thick skulls how much they have damaged this country.

Ditto the lockdownistas.

https://www.express.co.uk/news/world/1317588/China-coronavirus-cover-up-scientist-military-lab-wet-market-where-did-coronavirus-start

Thoughts?

Apparently it came from a wet market in Wuhan. This wet market is a stone’s throw away from a virus lab:

https://en.wikipedia.org/wiki/Wuhan_Institute_of_Virology

If it had emerged from a fishmonger’s in Porton, Wiltshire, I think the finger would have been pointing at Porton Down almost from the word go. But the Wuhan Lab – nah! couldn’t have been.

Read the above Wikipedia article, and see how this enormous coincidence is described as a “conspiracy theory”. LOL.

There is no way it came from anywhere other than that lab.
It is just too coincidental that the lab is in Wuhan. (And they don’t sell bats in that market )

So do the govt know this? Is that why they panicked so much? Seems like a good explanation to me.

US lab. See my post above.

If this is a bioweapon it is a dud. As a psyop it is ‘working’ – every part of it is crafted including the wet market.
The core objective is to restate the fear of the virus as the basis for leveraging what is left of human consciousness into a new era of biosecurity (sic).

The virus lab was owned by a company that had Gates and Soros as major investors – Wuxi was the company’s name.

Here is a report from April about it:

https://www.3ccorp.net/2020/04/16/george-soros-bill-gates-partner-with-china-on-coronavirus-drug/

Excerpt from here: https://therealslog.com/2020/07/25/the-saturday-essay-the-best-whodunnit-hypothesis/

Time now to go back to the birth of Covid19, and ask the simple question: who was the father?

I spoke to 13 experts in the field at the time. Five thought it was the result of natural evolution, five thought it was produced in a US Lab, and three didn’t know. Interestingly, nobody thought it was a Chinese bio-weapon.
The factor persuading those who thought it was US made were the alleged ‘three AIDS-like spikes’ in its RNA: nobody, they argued, had more expertise than the US in working with AIDS. Indeed, arrests were made last January of Chinese and US citizens supposedly trying to export samples to China. The reaction of those who felt strongly Beijing had not developed Covid19 as a weapon was based on (a) their disbelief in such PRC bioweapon expertise and (b) simple reasoning – why develop a weapon against the West and than dump it onto your own people?
There remains, of course, the possibility that the Chinese released the drug by accident…..C19 did originate in Wuhan market, not far from a PRC bioweaponry lab. However, one argument strongly against that idea is the draconian, mass-panic bewilderment that the Chinese authorities displayed in the early days of the outbreak: this had all the hallmarks of a régime that didn’t know what it might be up against – and indeed, thought it might well be under attack.
In fact – bizarre as this may seem – the evidence favouring a US-run operation is more compelling:

1. Washington had motive – China was playing dirty and talking tough on a trade deal which, if it didn’t materialise, could have serious cost and parts supply ramifications for the US
2. The American led central banking system was already nervous about very high debt levels and a Dow index artificially inflated out of all proportion by years of overt and covert QE. Those running the system were badly in need of a patsy to explain the inevitable collapse
3. Washington had the means. In the months leading up to the outbreak, further ‘SARS-like’ pandemics were a hot-topic at summits, at Davos, and at game-plan meetings organised by the Bill Gates Foundation. This seems odd, given that there hadn’t been an outbreak since 2008. At the State visit of Trump to the UK in June, the CEO of Big Pharma giant GSK is seen preening herself at top table right next to the President
4. Washington had the opportunity. From October 18th-28th, the World Military Games was hosted by China…. in Wuhan. The American team was housed in a hotel just 200 yards from the Market were ‘patient zero’ is thought to have been. Some have rubbished this theory by saying that ‘the dates don’t fit with the Covid outbreak’. But there is plenty of evidence to suggest that the PRC kept the outbreak under wraps for longer than was initially thought….and asymptomatic carriers, we now know, can be incubating the virus for up to 23 days. More than a dozen athletes came forward at the time to report Covid-like symptoms.
5. When Beijing laid out the likelihood that US athletes “brought the virus with them”, Secretary of State Mike Pompeo begged the Chinese not to go to the media with this theory. When it did become known, the Pentagon criticised the allegations, calling them “false and absurd.”
6. But they are far from absurd. The US Games team was housed at Fort Kedrick where there is also one of America’s leading bio-weaponry labs. On August 5th 2019 the New York Times reported that ‘safety concerns at the prominent military germ lab have led the government to shut down research….In a statement, the C.D.C. cited “national security reasons” as the rationale for not releasing information about its decision’. Here we have a secret bioweapons lab being hastily shut down….and yet the statement about it comes from Dr Fauci’s very own Centers for Disease Control.

I didn’t know about the US theory, thanks.

It’s been around for several weeks.

So WHO are now begging us not to go back into lockdown. Perhaps they should have thought a bit harder back in March when they were threatening countries that didn’t go into lockdown…

I’m starting to think Trump was right: get rid of the lot of them—they carry absolutely no liability for their words, yet they expect others to blindly obey

This is one thing that he is 100% correct on.

I can’t think of a single positive or useful thing they have said or done since this first began back in January.

Clearly the Chinese are now worrying that the Western economies are so knackered that no one will buy their tat anymore so WHO have now been instructed by their masters

If you go to WHO’s contributors page and compare the entirety of China with Bill & Melinda Gates Foundation you might be surprised — https://open.who.int/2018-19/contributors

It’s not the money. Gates might be large financial contributors (as were the US government) but the political clout is via the third world states who are now in hock to the chinese via the Belt and Road initiative

You think so? I’d do some background reading on the guy who’s leading WHO now

Isn’t he a raving communist agitator?

Old Tedros… from Ethiopia.. A third world state in hock to the Chinese.
“ Ethiopia has taken massive loans from China, estimated to be more than $12.1 billion since 2000. ”
“ According to the China-Africa Research Initiative African countries owe China about $130 billion .”
source
But yes – i think we can agree that WHO are being massively influenced

Read his history in Ethiopia

Lol you have a point

I’m more than happy to comply with that bit of begging.

I was discussing the lockdown with my teenage daughter yesterday and she naively said “But why would the government ruin the economy?” I said that they didn’t care about ordinary people, none of them are going to lose jobs and they probably benefit in some way we don’t know about. What is the better way to explain the government’s actions?
She is on social media and believes lots of misinformation.

Firstly, it is already ruined – but kept on life-support.
Insiders anticipate and even orchestrate big Crashes. The ability to hold back a Financial System Crash so as to mask it in a pandemic is to make even more of a control grab than simply buying up assets for peanuts. Insiders anticipate and even orchestrate wars. The ability to mask major shifts of geopolitical restructuring in a ‘moral obligation’ to sacrificial slaughter and destruction is also to draw a line under a past that is no longer returnable to as ‘a forgotten and lost ‘normal’.
This is a so called ‘soft war’ but pain and loss will not be soft so much as masked in narratives of masking denial.
It may not be yours to change her mind or anyone else.
And if she is not ready, this view of the world is more disturbing than a war on a virus (sic).
The gov is Gated – its a PPP.
Only in fairy tales do politicians do more than rubber stamp any important regulatory dictates.
So as it is going down anyway, its is being used to make covid as a ‘must be real’or they wouldn’t do such a drastic thing’, but this is exactly backwards.
The corporate realm is being restructured and the micro-economy shut down such as to only be opened again as part of the bio-metric Internment of Things.

In their table-top wargame, was Boris playing the side commanded by Lord Skrolk, Plaguelord of Clan Pestilens? Or was that Rishi?

Skaven are positively sane and rational compared to our government.

Am curious about HCID on gov.uk website.

Status was taken off Covid from mid March and has NEVER been changed, despite additional comment on the page regarding “government’s response”

https://www.gov.uk/guidance/high-consequence-infectious-diseases-hcid

The reason I ask is surely this is a very good base to start off with talking to “others” about this shitshow, along with the actual mortality rate (and its obvious overestimations)?
Ive tried to start a couple of conversations with long standing friends and am just getting stonewalled with “harder lockdowns” or “idiots at the beach”.
Its really hard to enter discourse lately and really need to find those “light-switch” bits of data that get people thinking for themselves.

I read somewhere at the beginning of all this that it was lowered so people could be treated in standard hospitals. HCIDs have to be treated in specialist isolation units of which there are very few.

Sadly, I do not think it is the ‘golden bullet’ we hope for.

Yes, I remember reading the same thing, although I think it was also considered not deadly enough to be on the list anyway.

Yes, it said it was because mortality was low.

The HCID list has some scary shit on it, poor little COVID would never make the grade,

Offlands, does Mason Mills have anything to say on all this, that you feel able to reveal?

Thanks for clarifying Offlands

I read it as a legal defence. Once the shock effects the leverage the headline is retracted or modified to leave the reactor holding the baby.
The fact that it restated complying with all gov covid regs on the same page has nothing to do with the fact that the basis for the regs has just been removed. Conforming to gov regs is in some cases not law but guidelines that were taken further by certain lockstepped actors that then set the public expectations that the gov could plausibly deny responsibility for.

“ those “light-switch” bits of data that get people thinking for themselves”

… but … but … but … ‘thinking’ is precisely what brainwashing eliminates. That is it’s purpose.

And yes – you are right. Quote :

“A s of 19 March 2020, COVID-19 is no longer considered to be a high consequence infectious disease ( HCID ) in the UK.”

Note the date!!!!!

That’s going to be their defence, when there (inevitably) is an enquiry…

Malcolm Kendrick suggested it was removed to avoid later legal implications – ie they were covering their backs.

Here is an e-mail from May that I sent to my MP:

From what I can tell it is all very strange or I have all my dates wrong.

What it says in the coronavirus Statutory Instrument which came into force on or about the 26th March 2020 is:

Serious and imminent threat declaration

3. —(1) These Regulations apply where the Secretary of State declares, by notice published on http://www.gov.uk , that the incidence or transmission of Coronavirus constitutes a serious and imminent threat to public health, and that the incidence or transmission of Coronavirus is at such a point that the measures outlined in these Regulations may reasonably be considered as an effective means of preventing the further, significant transmission of Coronavirus (“serious and imminent threat declaration”).

(2) The Secretary of State may revoke a serious and imminent threat declaration by way of a subsequent notice published on http://www.gov.uk .

(3) Before making a declaration under paragraph (1), or revoking a declaration under paragraph (2), the Secretary of State must have due regard to any advice from the Chief Medical Officer or one of the Deputy Chief Medical Officers of the Department of Health and Social Care.

The statement relating to the above was issued and posted on the gov.uk website but without fanfare or any notification given on 10th Feb 2020 and amended 25th Feb 2020 which is about 6 weeks prior to the quick draft emergency legislation being read in Parliament .:

https://www.gov.uk/government/news/secretary-of-state-makes-new-regulations-on-coronavirus

Then surely the announcement about downgrading of Covid-19 on March 19th 2020 which says it is no longer a high consequence infectious disease which makes the Coronavirus Statutory Instrument unnecessary and therefore null and void illegal as it is no longer “serious and imminent threat” :

https://www.gov.uk/guidance/high-consequence-infectious-diseases-hcid#status-of-covid-19

The forced imprisionment of the nation started on the 23rd March 2020 – prior to the commencement of the Statutory Instrument supposedly giving the Government the powers to lock us all up.

Why this order of things?

Why put the announcement on an obscure page of gov.uk without any fanfare etc and with nothing on the MSM sites?

Where is the guidance from Whitty, Vallance et al as reffered to in teh S.I.? At this time everyone in Government was saying it was all OK, no problems.

The only thing that amkes sense is it was all written planned and prepared in advance, scientists/medics who make the HCID decision (politicians were not involved in this decision making apparently) were telling us something that they will not say out loud but due to the lowering of education standards to the lowest common denominator no-one inoticed that it was all done in the incorrect order.

To me it should have been:

– declare the disease high consequence

– introduce legislation

– issue the imminent threat notice

– introduce the population imprisionment

– downgrade the disease

– lift any restrictions

What we have here is:

– issue declaration of imminent threat

– downgrade the disease

– introduce the population imprisionment

– introduce legislation

Is it me or something stinking to high heaven?

• Re:-
• ‘ Customer numbers fall after compulsory face masks were introduced in shops, figures reveal ‘ – Mail reports that the introduction of mandatory face nappies has meant less people going shopping, not more

Only slightly- not 2%. And the article explains it’s slightly up in Scotland.

But the article also says:-

“Compared with last year, footfall in England across all retail destinations remains 37.8 per cent lower”.

The whole masking policy I’m sure was principally intended to get footfalls back to the level they were. And early indications are it isn’t working. I’m certainly foot-falling less because the nearest shop to me has banned me for not wearing a mask.

I think the masking policy is doing exactly what they wanted.

My head is struggling to cope with all this (probably overdosed on inhaling the bloody gloop). Are you saying that the gov’t want the High Street to collapse, while pretending the exact opposite?

I don’t think they care at all about the high street.

If they cared about reducing people’s fear they would remove the hazard signage from press conferences and start a clever campaign to reduce fear. They have done nothing remotely like that.

They still want people to be scared. I don’t know why. But they do. They do not care about the economy.

They care about money being spent (flow of cash- which will eventually, they hope, make them look good)
They don’t care about the real economy (jobs and businesses- GDP will still be through the floor)

Yes. That’s why the first thing they have done in the new local lockdowns is to ban households from meeting – because that doesn’t make money. You can still however go to the pub or to a restaurant and spend your money there. Money first, people’s mental health and happiness later.

Exactemundo.

My theory that they don’t want people talking in private is a bonus but now I feel their primary motive is money (the spending of). Of course it is. It always is.

Yes, they want you to buy online, so all your purchases are done by card, and therefore cash becomes unnecessary. Also means they can track people’s purchases and only the big players like Amazon will survive..
But for the moment they are pretending otherwise..

90% of my spending is now cash at our local outdoor market and soon to be car boot sales. I need some gardening tools so rather than B&Q (cards only) it will be cash at the car boot; and no muzzles.

First its a Gated Gov – a PPP. So it is acting in wider Corporate interests under various narrative ‘targets’ See World Economic Forum and Agenda 21.
And yes the Orwellian does the thing it says it is saving from. This happens over and over and over but few see it.
The replacement with Internet is bringing into a realm of systemic control.
NONE of this lockdown thing would have been feasible prior to the Internet being ready. the rehabilitation to the Internet is a further step of displacement and alienation from the land which once we knew our belonging to.
Don’t forget your heart! Discerning and navigating madness is calling for an honesty of being.This is what fear rules out – unless we face fears, keep breathing and learn to feel our way while also recognising logical inconsistencies. yes its insane. Tha fact you can recognise it is some part of you that isn’t insane. grow what you have – or what you appreciate, appreciates.

Showing people to be generally compliant, even if they should not be wearing masks due to pre existing breathing difficulties?

I have seen people who clearly should not be masked, wearing masks and possibly they are going to feel the results later.

What would you say was that intention? I think it is also intended to limit the spread of the virus – that’s also clearly the government’s line. I believe it possibly will but at the cost of generating such a climate of fear any gain will be more than cancelled by the negative effect the fear produces.

“ I believe it possibly will “

.. at about the same level of probability that is, in practice, indistinguishable from wearing a rabbit’s foot – which is far better for you in terms of harm and discomfort caused.

The government know there’s no virus left to be spreading. Climate of fear is exactly what they want.

Yes. More online shopping – cashless transactions. Can’t blame lockdown you were free to use the real shops ……

I’ve done all my non-food shopping online since the mask rule, and keep even my food shopping to the minimum of trips – I’m far more wary of going out now than I ever was in March (not that I was ever particularly worried about infection, more about being shouted at by some busybody for not social distancing enough)

Ironic isn’t it. Masks are supposed to make people feel more comfortable but the likes of Cressida Dick have ensured they won’t. Even if they wear them.

Brick falling maybe?

Hard to say if this is having an effect on footfall or not. Tuesday and Friday seemed to be roughly as normal deliveries wise in our store. Wednesday and thursday were very quiet, although that could just have been because it was the last week of the month before people got paid on the friday. Saturday was completely dead though.

Over 50s to stay home the latest scare story. Well I like millions of others I imagine will be ignoring that completely. Does this maniac wish to destroy the country?
Where are the politicians with enough brain to question the stats? Surely they can not all be so scared of Boris to point out the errors and stupidity?
Where are the big business owners who are having their businesses destroyed?
Why are they not leading the fight against this maniac and his cock of a sidekick?

Agree. Where is big business?

(psssst… I think they might be in on it)

Yes; this lockdown is designed to remove all the entrepreneurial small businesses, leaving only the conformist monopolies.

Absolutely. You can’t lockdown the crony capitalist system without the help of the cronies.

Maybe. Sounds reasonable.

Not altogether – but when you are more insider to the way it works you are also more aware of who and what you are up against if you step out of line.
Boris is a crisis actor.

Like you, I have a two-word answer.

But many, I fear, haven’t developed the brain and language skills required to utter two word phrases.

Of course all the head teachers and senior Consultants will need to keep going to work?

They will have exemptions as key workers, I would imagine.

Of course, those of us on minimum wage or just above will be working. No sick pay and the £90 per week SSP is meant to keep us alive so we can just go back to the front line ASAP.

It doesn’t help if you over dramatise this. The people who may be advised to shelter will be over 50s with serious illness or who are obese. I don’t think anyone is suggesting all over 50 get put under house arrest. This is just conspiracy madness. No organisation with more than 50 people can ever manage a conspiracy, it’s always cockup.

America’s Frontline Doctors shred government coronavirus narrative, exposing it as “massive disinformation campaign”
“The medical deep state is hellbent on withholding the hydroxychloroquine-plus-zinc treatment option from the general public for as long as possible, all to ensure that remdesivir, in which Fauci has a direct financial stake, as well as the slew of vaccines currently in development by Bill Gates and others, are what get presented as the “cures” once they are ready for release.”

https://www.naturalnews.com/2020-07-31-americas-frontline-doctors-shred-government-coronavirus-narrative-disinformation.html

Perspectives on the Pandemic: America’s Frontline Doctors
https://www.brighteon.com/afc9a48a-a551-4b24-8dc5-82a4ecf10a3f

https://omnij.org/Gilead:_Twenty-one_billion_reasons_to_discredit_hydroxychloroquine_(ORIGINAL_ARTICLE)#Conclusion

I wonder if anyone in Whitehall has noticed that the Imperial College London model has been discredited and the mortality rate is much lower than first thought. They still seem to be making decisions based on the flawed information from March.

I can only assume they have so brought into the Global Reset and Vaccination agenda their is no way they will reverse now.

Well – you could hardly not have ‘noticed’ it – along with the massive, egregious errors committed by the same team in the past.

But, having been ‘noticed’, the evidence has been totally ignored.

I find it hard to fathom why the government would actually admit the death rate is overstated but make so little effort to correct the figures.

It is like they actively want to promote a constant state of elevated irrational fear – a bit like after 9/11.

No?!!! I’d never have guessed!!!

You mean an insider orchestrated controlled demolition of the global economy and social organisation of humankind on the Earth?

They are playing the belief that any of it makes sense or that those inside the narrative have any intention of engaging in dialogue. And so trying to make sense of it and thinking some sort of governance for the nation or the people is still operating delays the simple recognition of abandonment from above and being ‘sold to the Corporate sector or to locked out of social inclusion (life support).

However another way or recognising our lives is to not give power to narrative definitions – but to listen in the heart of honesty and find who you are from the life itself – rather than the conflicted futility of a world of lies seeking to become true by coercion and deceit.
Lies run in darkness and in terms of free awareness being light, conflict binds or locks up attention to effectively mask out a primary curiosity. Though you are never truly absent and could wonder instead of being driven by constantly shifting narratives that as you discern, elevate undertainty, confusion and fear at expense of clear appreciation of the nature and fact of what is happenning – on many levels – not just where the public attention is managed or a captured opposition is contained.

Perhaps ‘they’ is no more that the vector of private self-interest set in a lock-step against deep fear and pain of loss? Some are broken by fear and others are deeply defiant and enraged – but as cold calculated determination that uses the greedy and the broken as tools.

It’s not just discredited. In any engineering profession if you let this model get out in the real world you’d end up in jail. But it seems that when applied to people’s health you can get away with blue murder

Two-tiered medicine: Why is hydroxychloroquine being censored and politicized?
https://www.naturalnews.com/2020-07-31-why-is-hydroxychloroquine-being-censored.html

HCQ is on the approved treatment protocol for all but ventilated patients in Russia (pp 10–11 cross ref. 149–150) perhaps why the CRF is a factor of 10 or there abouts smaller? :- https://static-0.rosminzdrav.ru/system/attachments/attaches/000/050/584/original/03062020_%D0%9CR_COVID-19_v7.pdf

The way UK is going Johnson will be a bigger tyrant than Putin soon.

One of them is actually capable of coherent thought. regardless what you think of him. Putin is not merely a puppet. But he is in with the medical mafia or unwilling to openly defy them. I know nothing of belarus – but that its leader proclaimed covid19 a western psychosis. I find it interesting that amidst all the drama -there is always someone given the part of disclosure – but generally one that is not accorded any validity whatsoever. For we think if we align with truth we hear from another that we endorse and support whatever else they are and say – no?

Because if a treatment exists then in the USA it means you cannot ‘rush out’ and mandate a emergency vaccine…

“ The ONS infection survey data released on July 31st showed an increase in the number of people testing positive over the past two weeks of just five.”

This is the level of scientific/statistical intelligence on display not only from government but also scientifically illiterate ‘scientists’.

Scottie!!!!!

What a joke !

So a resident of Cornwall finds living there ‘horrifying’ now ?,perhaps they should go and live in Yemen or Syria for a few months and maybe Wadebridge won’t seem quite so bad.
I didn’t think I could think much less of most of the population of this country but nearly everyday one them proves me wrong.

Trust me, they don’t, it’s MSM spin. Most tourism businesses here are small and haven’t qualified for c19 support – the visitors are extremely welcome.

You’re correct – those were just comments picked up from FB by a lazy reporter.
Most of the small shops in my little town qualified for the £10k council grant for which they were very grateful I’m sure because some of them are open only part time even now. But it seems that latent xenophobia in Cornwall has surfaced.

I live in Cornwall and it’s great when not having to follow the government stupidity. Beaches are busy but no busier than Bournemouth and that had no impact.
Cornish people are as brain washed as the rest of the country no worse just today’s news….blame Boris and the useless politicians not the county.

I live in Bournemouth. By the beach. Apart from the extra cars I don’t mind people coming down. Feels normal.

Good for you – after all, you’re not forced to live by the sea.

I would have expected any beaches to be busy on a hot weekend. Will probably be much quieter tomorrow.

The silly sod doesn’t seem to have grasped that the local economy is largely dependent on people doing exactly what he/she dislikes.

Assuming this resident isn’t a plant, I do hope they don’t need to find work outside Cornwall. “Sorry, all our jobs are for locals. Perhaps you’d best return home to Cornwall.” Where does the nonsense end???

Who is this resident?

It’s Tubbs. She’s relocated to Cornwall from Royston Vasey.

It’s a local shop for local local erm people

Well I live just inside the boarder in Devon and pop into south-eastern Cornwall to the beach regularly. It’s been pretty normal for at least two months now, except perhaps a bit busier than usual for the time of year.

Usual MSM garbage – easy to spot: just look out for the emotive adjectives, along with a lack of any data or actual evidence.

swprs.org
August update now out.For those that haven’t seen this site, it provides a range of facts,graphs and information on corona related issues at a national and international level. Updated monthly

My answer to Boris for an over 50s lockdown – fuck you and the horse you rode in on.

I am now in open rebellion.

No apologies for the profanity.

Yup – the only positive would be that that includes Bozo!

He and all the others have special immunity, didn’t you know?

Not from a piece of hemp they don’t.

Fair play.

Polyester just does not have the same friction.

Highly likely to be on hydroxychloroquine, as it works accordimng to well over 200 US doctors and doctors around the world. Just don’t tell the plebs or they’ll all want it

Plus he’s already had Covid anyway. As have enough other people to stop it spreading.

Or he went on holiday to Barbados…When a prime minister is taken gravely ill there is a protocol whereby they end up in a totally secured floor of St Thomas’s Hospital and no member of the public or any tv crews have sight of them. Can anybody prove he had it? A nice convenient publicity stunt for his new world order masters…

I think we should make and publicise a list of all MPs over 50, so that if they lock us down, we can point out how many are not isolating. We can point out to doubters than the chances of politicians having some kind of super-immunity to the virus is impossible – it will be another ‘Cummings – Barnard Castle’ moment…

He would exempt himself as a key worker.

Like Jezza did when they wanted the over 70s to stay at home. Politicians exempt.

Worker????

Lol

Agree Awkward.

Even my mum just said “Well screw that for a game of soldiers”

It’s the rule that could turn the Karens!!

I think this is just another way of putting us off the scent. Whilst we are getting outraged that us over 50s are to be locked up other things are happening and we are ignoring or missing it.

You are probably right, but the question is what are they trying to distract us from seeing?

That is a very pertinent question and deserves more than a cursory consideration. You could also include your own thought habits. What is going on here that I am not seeing? And allowing a space of attentiveness and receptivity to notice what a distracted attention discards or doesnt even see.

It’s divide and conquer. In the DM, the comments section is full of young people saying the old should be locked away, and older people saying the young should be locked away since they’re troublemakers not keeping to the rules.

Seemed like the obvious tactic considering the Manchester lockdown right before Eid. Everyone went mad with some making nasty comments about “dirty Muslims” and others calling them racist. Divide and conquer, tried and tested.

First post, long-time lurker. Also left-wing refugee from the Guardian where I kept getting jumped on for expressing disbelief about the benefits of lockdown. Now very few Guardian articles allow comments, so I guess I did my job.

Welcome, and a very good point!

Just try it. Just.

Agreed; I dare you. I DOUBLE-DARE you!

I have no intention of obeying it even if they bring it in.

I second this. I’m 60 but fitter than many people half my age, have no existing health conditions and don’t take any medication. I’ve worked in a front line service since lockdown and have no intention of being forced to stay at home by Bojo and his team of health dictators.. I don’t think I’d seek treatment if I did develop any health condition that put me at risk. I’d rather die in a ditch.

My husband (71) got the Extremely Vulnerable letter because he has chronic leukemia. He took no notice as he is otherwise fit and well (as am I) and we’ve carried on as normally as possible throughout the lockdown and the ‘Lockdown Lite’. We travelled on buses before the muzzle rule came in and we shop twice a week. Now we avoid public transport and yomp round the place with rucksacks or on our bikes to do our shopping and we regularly go hill-walking. From this you can deduce we are hardly delicate old plants!

If they bring this crap in we’ll carry on the same. What are they going to do, lock us all up? Despite killing so many oldies off, I think we’re still in the majority (somebody please correct me if this is wrong!)

We have a friend who we visit regularly. He’s 92 yrs old. He does his shopping every morning at 07.30 hrs, as he has done for the last 20 years, and doesn’t give a s***. He invites us in (and has done so for the entire lockdown period).

Why would he care? He hasn’t caught anything, he says he’s had a great life and would rather go down than live under the successors to the Gestapo. Good for him.

Record his thoughts and send it to PM Johnson.

You sound like fantastic role models. Good on you both and may you have many more wonderful years.

Thank you – we’ll try!

It wasn’t a horse, it was a donkey.

Toby’s analyses of the figures is, as ever, excellent and, of course, he’s working to debunk what’s being put out there by the MSM.

However, it looks like the ‘war-games’ story was fed to the Sunday Times as an exclusive (?) and cascaded out through all the MSM. I don’t buy any of it. It’s designed so we’re all supposed to talk about this ‘war-game’ scenario and buy-in to the war-like metaphors. We are presumably meant to imagine nice girlies in uniform pushing little models of the coronavirus around a map of the country, showing where the next ‘attack’ will be coming from. Oh please!

For the Minister of ‘Health’ to tweet (tweet?) late on Thursday the news that an immediate lockdown was going to be imposed hours before Eid-al-Adha in large areas of the north with a high proportion of Muslims is cynicism beyond belief. ‘Especially when the figures don’t make any sense and do not support any such thing.

I don’t think we should believe a word of it, even at the level of believing this is how Government decisions are currently being made. If we continue believing the ‘Boris the Clown playing Whack-a-Mole’ scenario, it just makes it easier for them to keep us down. It is another massive psy-op, almost certainly straight from the SPI-B playbook, and our task is to try our best to debunk it as much as we possibly can with as many people as possible. I think Toby’s analysis will prove useful here as I am quite sure that the other scenarios may well come to pass soon.

By any means possible, we should demolish the outrageous propaganda put out by the MSM but I’m not sure about taking our cue from it. They are serving as stenographers for the spooks and must not be trusted at all, even in the way they present the propaganda.  We need to keep telling people about what’s really going on, including the real figures and what they represent in terms of danger i.e. next-to-none, to anyone, anywhere.

And I agree, never use the word ‘case’ unless somebody is actually ill!

I find the idea of “guillotine” decisions terrifying. I prefer the idea of contingency planning and risk analysis, based sound evidence and judgement.
Great point about the war gaming.
Treating a public health crisis as if it we were at war and under aerial attack has been disastrous.

I can see the idea, we are all supposed to ralley round the government, as if we are all facing a common enemy.

A lot of wars are actually basically the same deal (only worse): the government sends a lot of people off somewhere to kill people they have nothing against in order to defend their image and whatever lies they’ve been telling. BecJT made a good post about the Vietnam War the other day.

There’s a long dark corridor in Whitehall for 2 departments, fully staffed with every kind of expert. One is called ‘Let’s all have a laugh up our sleeve’ and the one next door is called ‘Let’s see if they’ll buy this’.

When I read about the war games in the article I thought mainly of General Melchett with Captain Darling in Blackadder.

“Our strategy of lock downs and evicting infected people into care homes has worked so well that we need to carry on with it. The virus will never expect that.”

General Melchett was smarter than this government though.

Use “false” positive instead.

I do. You would(n’t) be amazed how many people have no idea just how the figures are being manipulated. My neighbour, who half-believes the crap, told me that she’s heard young people are using testing like the ‘morning-after pill’ i.e. go for a night out and then get tested just in case (?!!*) How thick is it possible to get? Oh. . . . .

And of course the government are happy about that – another load of DNA collected…

Quite so, they’re playing into their hands, the fools.

The problem with what passes for ‘education’ these days…

Well its pretty much social engineering by design.

Sorry guys, it’s a rant:

I’m in my shop. I shouldn’t be in my shop but this f%^kwit government’s mishandling of this shit-show means that through no fault of my own I have to be here. I would far rather be at home, gardening or doing the ironing. But no, I am here. I am here having to endure the toss-pot hissy-fitters who have an arse-ache because we only have five flavours of ice cream and just now, the most serious/heinous error on my part is that (and string me up for this) I did not make sufficient scones today. So, a middle aged woman has just had a strop because she can’t have WHAT SHE WANTS! Well. love, neither can I!

I mean, it’s not as if the economy has just been completely trashed, probably not to recover for several generations or that our liberty has been pissed up the wall, oh no, don’t get mad about that will you.

And ,.. breathe – sorry

I sense that sooner or later one of your lovely customers is going to be wearing the food instead of eating it !.

Oh, if only I could afford to do that!

I know what you mean,you could imagine it I suppose !.I frog-marched someone out of our business once for his rudeness and constant moaning about how he could get the stuff cheaper somewhere else,I took the item off him and said he should go there and get it,I was a bit less polite than that though !,he was then quickly shown the exit.The amazing thing was an hour later he came back and said would I sell him the stuff because the ‘cheaper’ place hadn’t got any !,I just slammed the door in his face.

No need for apologies, we understand.

Thanks. I’ll save you a scone!

And ditto to DRW – sorry reply to wrong post – knackered and angry!

I’m sorry KH, having taken similar crap in a customer service job, I feel your pain. I’ll pay you a visit if I’m ever up your way.

Put up a sign – “Unfortunately choices are limited because of Lockdown “

Or “If you voted for this bunch of ****s – just **** off”

I do understand, but as my wife just said to me, look at what the other side was pushing for! Like Mr Trump on the other side of the pond, he might be rubbish but Killary would have been a nightmare by comparison. Devil and deep blue sea, I’m afraid.

Have you had any more shite for running your shop in a normal non-paranoid way?

Touch wood, no. Though the BID chairwoman has a good stare when she walks past! Am I bothered? No, couldn’t give a toss

Not allowed to touch wood here. That’s why the NT children’s play areas are still cordoned off
Well done for standing up for sanity

At age 18, I worked in a pub, for a proper hard drinking, smoking, hard working bloke called Alan and his lovely but fearsome wife. Great people, great job, taught me a lot about hard graft, and getting along with people. The pub, in summer, was in walking distance of 900 static caravans. You can imagine bar service on a summer’s evening.

One day some interminable toss pot and his family came in and made a right hulaballoo about the service. They weren’t polite. My colleague and I tried to placate them, no dice. The usual, you can see how busy we are, we’d be grateful if you could be patient in the circumstances etc etc. It was hardly our fault two coach loads of OAPs and a load of caravaners had all arrived at the same time.

Called the boss, and we expected a right telling off for presenting him with an unhappy customer, it’s not like he didn’t have other things to be doing. The boss listened patiently to this man’s rant, which was incredibly rude, signalled to him that he wanted to whisper in his ear. Man leaned in, boss cupped his ear, and in stage whisper said, loud enough for everyone to hear, ‘Do I look like I need your money or something? Now fuck off out of my pub’.

Bar went quiet, man left. What angered my boss was this idiot had done it to us as we were lowly bar staff, and he knew we had no power to fight back. I really admired him for that. I think people that are rude to people they know can’t argue back, are just bullies. Nobody’s that stupid, she knew exactly what she was doing to you. Sorry that happened. Some people are just arseholes. They’re still arseholes as we go over the edge of a cliff.

What a load of toads.
Stamp on them.

Aren’t toads an endangered species? Hmm I’m sure KH wishes some of her customers were……..

Don’t be sorry! What a bunch of spoiled brats you have to put up with. Rant away.

It’s understandable. I feel like I’m losing the will to live most days.

Lynyrd Skynyrd and a song from a few years ago called That Ain’t My America.

I think I’ll ask them them to do a version with UK/England instead:

https://www.youtube.com/watch?v=TSxeyG9bi4I

This is what I am feeling like at this moment in time:

https://www.youtube.com/watch?v=V9AbeALNVkk

https://www.youtube.com/watch?v=IYnuSsM7tRw

10 seconds on the Daily Fail comments – 23+, 2-.

Boris – as an over 50 my only answer to you is get stuffed – or words to that effect, the real answer’s 2nd word is off, first word 4 letters, begins in F. You have lost the plot and finally showed you are 100% well and truly following orders from an unelected government of occupation. None of the statistics make sense – only an increase in 5 meaningless positive tests means incarceration of large swathes of the north west. You are truly demented and no longer fit to lead this country, not you, your cabinet nor any MP or member of the house of lords.

Yay!!!

Bedlam in the early 21st Century.

Just seen the nauseating T&T ad on UKC. I soon expect similar propaganda for the vaccine. Similar video, maybe some ‘hospital chaos’ footage added for a good old guilt trip.
Ending pitch: “Noone’s safe until we’re all safe. Just a jab, so we’re all safe together.” Massive NHS logo, #JustAJab, #AllSafeTogether captions. Repeated every break on every terrestrial channel and insufferably ubiquitous on the internet.

That video is the cringiest thing I’ve seen in a long while. And I spent a whole afternoon watching celebrity BLM videos.

Wow – this covidiocy is taking its toll!

Are you a masochist?

I was making a list of who to boycott in future

So yes, but it was worth the pain.

share the list!

Basically, everyone

Because we all need a vaccine for a disease where 80% remain symptom free (i. e. own immunity works well against the infection) [1], and of those who are symptomatic, 95% get moderate symptoms [2]… leaveing just 1% (100-80-20*.95) of all cases as “difficult to critical”… But as today’s blog post concludes: “CAUTION! Statistics Ahead”

1. https://www.bmj.com/content/369/bmj.m1375
2. https://swprs.org/studies-on-covid-19-lethality/#hospitalizations

We all know that here but The Science (TM) will say otherwise!

All that needs to be said is that Big Pharma has been given indemnity against legal action over side effects of any rushed vaccine.

Work the rest out for yourself before you let your brain go walkabout and become just another prick.

Oh yes, I know what that game is alright. It’s just how I imagine it’ll be sold to the sheeple- who will probably fall for it hook, line and sinker.

Plus this: https://clinicaltrials.gov/ct2/show/record/NCT04460703?term=Vaccine&cond=Covid19&cntry=US&draw=2&view=record showing how you will be ‘persuaded’/nudged into accepting it…

Chilling reading.

“We had the jab, because we care”. Accompanied by a picture of a lonely old granny finally being able to hug her granchildren, who have been safely inoculated. Just as with masks, non-jabbers being accused of killing people and lynched in the street. I can’t wait.

Who knows, with potential side-effects and exclusions of liability for the pharma there might not be that many out in the street after all…

Don’t be conflicted :

1. When was a vaccine necessary for a generally mild illness like this?
2. Just ask whether a safe, effective vaccine – proved through a range of RCTs – could be developed in any quick timescale.
3. Do you buy snake oil?:-)

Why, according to Gates, will we need two jabs (a month apart) and a booster in a few years time? Why are people willing to accept it?

Because generally people are dumb, and believe anything anyone in a position of authority tells them. It’s ingrained since school where pupils are taught how to answer questions based on what the teacher tells them (a person in a position of authority) versus thinking for themselves—nobody teaches people how to think anymore, just what to think!

You’re right! We were saying the other day about how the style of education we experienced in the 1950s and early 60s was trashed from the 70s onwards because it was rigid and dogmatic etc. But we were taught to think and reason, many young folk can’t seem to do that nowadays.
Yes I know I’m an old fart…….

I agree!

That makes 2 old farts then.

I’m ‘only’ 56

Sorry! Just a mere child then.

Tha’s nobbut a sprog!

Three!

If the first jab doesn’t kill you, he wants two more goes..

Yeah there’s no way I’m getting three injections for a common cold. F off.

Because he’s used to built in glitches in his operating systems.

My worry is that the govt will try to turn the pliant majority on the “nuts” (Bozo the Clown’s words) to ensure maximum compliance. Never mind the lack of testing or legal accountability, the selfish anti-vaxxers are holding back normality for everyone dammit.

You are absolutely right.

Britain has always had this smug self-regard ever since, protected by the Channel, it joined with the US and Russia to resist the Third Reich.

But these last few months have demonstrated that, indeed, it ‘could happen here’ – as fundamental rights have been ditched for an illusory ‘safety’ from an illusory ‘enemy’.

Absolutely my worry too. Just like Cressida Dickhead telling us to shame people not wearing masks. Perhaps they will come up with some visible sign of vaccination so that we know who to bully out of the supermarket.

Oh I so hope someone takes down Dick

When Michael Bloomberg was Mayor of New York City he told New Yorkers to shame people smoking on the streets of New York city. Bullies, Inc. He is also part of the Gates cartel, a fervent supporter (contributor to?) of the World Health Organization and subsidizes Public Health Schools throughout the United States.

Just tell people you’ve had the jab. It’s pointless arguing with them once they’ve convinced themselves that anyone who won’t have it is a murderer.

Just tell people you’ve had the jab. It’s pointless arguing with them once they’ve convinced themselves that anyone who won’t have it is a murderer.

#piss off

That’s the spirit!

We’ve already seen the study currently being done on how to get people to agree to the vaccine – think we should show that to people, before they actually start to use the strategies, then they will (hopefully) spot them as soon as they start being used!
https://clinicaltrials.gov/ct2/show/record/NCT04460703?term=Vaccine&cond=Covid19&cntry=US&draw=2&view=record

Good strategy, raise things into conscious awareness.

I had read about india giving it’s population HCQ recently but this is an interesting quote form a website I read:

“Bill Gates — is determined to bring a COVID-19 vaccine to market. Word on the street (K Street) is that Gates is also taking HCQ as a preventive. In fact, he has taken HCQ as a precautionary measure to avoid malaria for many years during his travels to the Third World nations that were subjected to his endless vaccine pitches and vaccination programs.
If Americans knew that India was successfully using HCQ nationwide, how would they react? New Delhi has even made the decision to make HCQ available as a prophylactic, so inexpensive is it.”

K Street is in Washington DC, known for where lobbyists “inhabit”.

I’m assuming the rumours that Bill doesn’t vaccinate his own children are probably true.

Kinda like the people in silicon valley who don’t let their kids use social media.

Him and Steve Jobs also did not let their children go to school where wifi, computers and tablets were used from what I’ve read in alternative news sites.

Says it all really – no vaccines and no computers for their own families.

There’s a Daily Mail article on that: https://www.dailymail.co.uk/sciencetech/article-8439159/Artificial-breast-milk-start-gets-3-5-million-Bill-Gates-founded-investment-fund.html

But…. How is breastfeeding unenvironmentally friendly??

Exactly!

Unless they want an alternative to formula milk for women who don’t breastfeed? But…. is there anything especially planet-wrecking about formula milk?

Only if you’re trying to get rid of cows, sheep and goats.
Oh ……

No parent in their right mind should let their kids use social media.

I’m beginning to warm to the mask wearers. You don’t have to gaze upon the ugly coupons of some punter with a face that could turn Medusa to stone.

The First Minister’s face is vastly improved.

Copying yesterday’s comment to today (have also put in the Forum):

Does anyone know, or can they point me at, the specific up to date legislation for GP practices and the NHS, as per the Corona Virus Act? I want to know what’s recommendation and what’s law?

I’ve also read this, but am unsure how it applies to GP practices? http://www.laworfiction.com/2020/07/risk-assessments-an-important-chink-in-the-lockdown-armour/

Given our overlords are talking about locking up the elderly again

My dad’s dementia has gone off a ski jump under lockdown, he’s gone from a fit, active, social 85 year old, to incredibly forgetful, anxious and lacking in confidence. His Gp was already disinterested, and so I got him an apt with a Harley St specialist who did a phone conference with me and my dad, he was fantastic and wrote to his GP to ask with help getting some tests and drugs organised. The GP won’t see him, only talk to him by phone.

I want to know what risk assessments, equality impact assessments and what bits of PSED GPs are still obliged to adhere to, as I’m going to send a letter asking them to tell me precisely on what basis they have withdrawn care from all their patients. I’m in a rural market town, where cases are incredibly low, as are deaths, it seems a bit heavy handed that they’ve mothballed an entire 20 GP practice, and nobody can see a doctor?

The original corona virus act: was revoked in almost its entirety, with no fanfare, announcement or anything on 4th July http://www.laworfiction.com/2020/07/lockdown-laws-in-england-have-been-revoked/

This is the new act https://www.legislation.gov.uk/uksi/2020/684/contents/made

That looks to me that they revoked almost everything relating to healthcare provision? My suspicion is this pronouncement by Hancock that care must be remote, isn’t in fact law?

Regarding the composition of LS leaflets etc:

Any big numbers will probably make ther eyes (and brains) go blurry.

Yesterday, it was pointed out that people don’t get percentages and after Wankock’s recent magic with the stats for shopworkers, I suggest it’s an area to steer clear of.

I’m afraid to say that, despite 10 years of compulsory education, most people are pretty thick and only semi-literate. They read headlines and facts need to be very short and sweet.

Any numbers need to be positive – so not negative death counts but stats of the survivors.

Brief info why the tests are unreliable might be useful.

I agree. People are responding emotionally to what they perceive as a deadly threat, only simple but powerful messages can work. Such as comparing deaths this year to last or number of avoidable cancer deaths, etc.

How about crowdfunding to get some top rate PR/Comms? Fear is very powerful and this is what has to be overcome.

This is probably going to be the solution if we want to make an impact with a campaign like this. We need to fight fire with fire. I’d be happy to put some in.

Can we do it all under the “We Will Be Free” banner? I can supply all the graphics you’d need to add.

Martin Luther King had a good banner: “We Shall Overcome”.

Visuals necessary. How about either a pint glass, or a gin glass with divisions to reflect ‘quantities’ who have succumbed to various illnesses, or survive various illnesses. Many people – and I include many of our so-called leaders and those in the media – do not understand percentages, let alone rates of change. It is much easier, in my experience, to communicate complex issues (taxation, scale of the national debt) if it is visual.

Like that idea! Eye-catching too..

I remember quite early on in the lockdown, the Times newspaper (which has had a slightly more sceptical streak than many other papers) had a divided bar showing the number of people killed by the virus (less than 100,000 at that date I think) vs. the number of people directly affected by lockdowns (a couple of billion I think).

Something similar with (a) Covid deaths in proportion with yearly deaths from all causes in the UK and (b) in proportion with all the projected deaths as a result of lockdown (cancer, suicide etc.) might work.

Another number comparison, not death-related but it shocked me when I first heard about it, is the goverment’s spending £15 billion on PPE, and even worse £10 billion on the track-and-tracing farce – in comparison to the £100 million Captain Tom raised for the NHS earlier in the year (and perhaps also how many new hospitals those billions could build, or NHS staff wages it could pay).
This might make people think twice about the government’s “protect the NHS” sloganeering!

https://www.lockdowntruth.org/post/covid-19-death-rates-in-perspective

In Quebec the percent of death of supposed deaths is around 6000. The population is 8, 500, 000. So, around 0.0007 percent of the total population have supposedly succumbed to Covid-19. How about two hourglasses side by side, one full to the top, the other with a few grains at its bottom? Something like that.

IRR – infection recovery rate of 995 out 1000.

Recovery rate of people under 65 who have no serious illnesses 999994 put of 1000000
Or 999.99 out of 1000

No of children and teachers who died after Sweden’s schools stayed open; zero

resurch is showing that over 50 million of the British already have natural imunity to covid and many scientist believe we already have population immunity which is possibly why the hospitals are nearly empty

Sweden believe they have population Immunity with no lockdown and less deaths than the British, their scientists also believe masks are pointless

Government research suggests that up to 200000 people may die as a direct consequence of the lockdown experiment
(I think I saw that somewhere in here)

Yes, this (Government research… post)

More than 43700 of the 46000 people who have died with covid already had life threatening health conditions

The average age of people who die with covid is older than the average age we live to

The Swedish now think that the Brits are fucking wimps

Regulators are stopping the media from criticising the government covid failures

They’re not wrong!

Many of the world’s leading scientists say that the lockdown experiment caused enormous harm and will not have saved lives in the long term

‘Only (insert figure) of those who have died from Covid-19 in the UK had no underlying medical conditions that they were aware of…’

Or, ‘x % of those who have died of Covid-19 in the Uk had underlying health conditions..’

The gov. Failed to protect the vulnerable and locked up the healthy instead

I definitely think the care home situation (sending back infectious patients, refusing hospital care etc.) is an important angle to focus on.
Given that “protecting the elderly” has always been a big justification for lockdown measures, it’s worth pointing out that the goverment has been the biggest “granny-killer” of them all.

Personally this was one of the things that really made me wake up to the fact that those in charge either do NOT know what they’re doing, or do not have our best interests at heart (or a mixture of both).

The vast majority of people who died with covid caught the virus in nursing homes and hospitals

Would that be another Imperial College ‘model’?!

DavidC

Link please? The UK population is (officially) around 67 million so that’s great if it is that high!

DavidC

Link please to which one?

If its the 50 mil immune, many scientist have said up to 80% t cell etc. Dr Lee said upto 90%

Some simple pie charts with no numbers or %’s or link it to something tangible.

i.e. ‘ask yourself if I bet you £100 that you would beat me at heads or tails 99.95 times out of 100 you would bite my hand off. That’s how much chance you have of surviving cv19’ or the sweets in a jar, x infected sweets out of y.

Or correctly call a toin coss 26 times running.

Or roll 8 dice and get all 6s.

Would people understand if we wrote something like ‘today in (town) you have a 1 in x thousand chance of catching the virus’ ???

What is the problem with catching the virus?

Because a lot of people are stupid enough to think that getting it means certain death!

Because somebody might die as long as it exists.

Viruses are entirely new to the human species, apparently. It’s a bit like an alien invasion or zombie apocolypse.

But then they go “BUT THERE’S STILL A CHANCE!!”

I feel like there’s no winning with risk statistics unf at this point. Far better to go with facts about consequences of lockdowns, like the cancer deaths, child suicides etc. And def more concentrated on death and health rather than the economy because we all know they think that’s an abstraction that doesn’t impact lives

Ok, how about: ‘Are you happy for your child’s school to stay closed for another academic year?’
(because that is how long it might be before there is a vaccine..)

Yes, more practical negative outcomes and negative consequences that we can prove have already happened (21,000 excess non corona deaths ?)

Anyone heard the phrase “Change happens when the pain of staying the same is greater than the pain of change.” ?

It may be advantageous on the leaflet to also highlight real pain being caused by the lockdown, both now and projected for the future, that people can relate to.

Many on here have reported that bringing people round with logic doesn’t really work because the beliefs have an emotional basis (fear for example) so maybe the same approach can be used on an LS leaflet to break the spell for some.

Yup, I’ve been one of those people. The madness might end when people are more afraid of something other than Covid — like not having a job, starving, losing their home, more lockdowns, etc. It shouldn’t have to get that bad, but I’m afraid we’ve gone so far down the rabbit hole that life for most people will have to get a lot worse before they come to their senses.

Agree. Recovery stats very important.

Keep stuff simple, not too wordy. People loose interest very quickly. keep stuff visual, maybe simple pie charts?

An observation: figures are infinitely zoom-in-able. Toby observed that the Northern lockdown was triggered by a change from 0.05% to 0.07%. If you draw a graph of it at full scale, it’s invisible (unless the scale is logarithmic – and this is meaningless to people), and if you zoom in on the ‘surge’ it looks identical whether the figures are 0.07%, 0.007% or 0.00000007%. If it goes from 1 person in 100 million to 2 people, that’s a 100% rise!!!!

Really, statistics are a losing game to base an argument on. But I don’t know what the alternative is, because most people don’t get ideas. For example, the difference in ‘level of tragedy’ between the death of a 30 year-old and that of a 96 year-old is huge, but as a headline statistic it’s identical. An epidemic that has merely brought forward by a few months the demise of 50,000 people (and I’m not saying I believe that figure is anywhere near correct) who were at death’s door already is not very serious at all, but the figures just don’t convey that.

Simple ‘headline’ bullet points – references can be on a web page and references on leaflet

War and peace us a waist if time

About 600000 people die naturally if old age every year in the UK, most of the 46000 who have died with covid were very old and frail and would probably have died in 2020 without covid

I have a rule of thumb about “experts” and their numbers that has served me well for my 63 years on this mortal coil and 35 years on Wall Street … anyone who spouts percentages and doesn’t also give the raw numbers is deceiving you … without the raw numbers they remove context and percentages without context is almost always a deception …

Good advice

I’ve been to a Tesco Express several times with no mask, but decided to try some larger supermarkets. It was an interesting psychological experiment for me.

On my first Tesco Express visit I had some marginal anxiety. Not enough to make me not go, but enough to make me think about it. I powered through and everything was fine. The second time there was a tiny bit of anxiety, but that dissipated almost immediately. The 3rd time was just like before all this nonsense started.

But I went to a large Morrisons on Friday for a few things, and today went to a large Sainsburys for a big shop. Like my first Tesco trip, Morrisons made me think I was taking on a new challenge, but I got through it. Sainsburys today was like the 2nd Tesco trip; any anxiety immediately dissipated and took my sweet-ass time too . No one said anything. I had a few conversations with staff. I didn’t notice anyone staring or tutting. But generally people didn’t care and had a couple of pleasant exchanges with customers.

The disappointing thing is that I have seen approx 50% of people not wearing a mask in the small Tesco, but in Morrisons, everyone was wearing a mask. In Sainsburys I only saw one man and one woman without one. I only hope that most sceptics are just staying away and ordering online.

I can understand why some sceptics don’t want to go for it. It can be daunting. But it can be done and it gets easier, very quickly. I felt liberated and hope I was helping some muzzled sceptics see that it can be done.

Next challenge is Meadowhall Shopping centre

Thanks for this. I think this is a new career for you! Trundling around the country checking out attitudes. Until we go into full scale lockdown anyway!

Keep doing it. Eventually you forget until you get inside and are confronted with all the floating pairs of eyes.

Meadowhell never a nice experience at the best of times.

Agree about more venturing out face free.

Indeed. I hate it. I am just going to pick up something for someone. Looking forward to it

I think it’s quite important not to wear a mask in order to encourage others. I was worried people might disapprove, and I don’t really want to offend anyone, but I think quite a lot of them were thinking note to self if that guy is getting away with not wearing it maybe I can too.

If hardly any of the staff are masked that’s a good sign the shop is cool.

“I only hope that most sceptics are just staying away and ordering online”.

Why? Wear your face with pride!

DavidC

My hope was that there are lots of sceptics but I am just not seeing them in the shops. If the supermarket is representative of the public mindset then it’s pretty disheartening. I would prefer it if they were showing their faces, but I understand the trepidation of doing so. However it is temporary. Nothing bad has happened to me 5 times in a row. I will keep doing it

I posted this yesterday but repost this again together with today’s world ometer of Luxembourg
https://t.co/nL6XKi9CBv?amp=1A
https://www.worldometers.info/coronavirus/country/luxembourg/
The reason is that this document from 19th July from the Health Authorities is an alarming document predicting a soon coming second wave in Luxembourg with predicted 9000 cases in that country soon. This document might have influenced UK (but not quarantining Luxembourg as far as I am aware of) so it could be interesting to analyse the document and compare to reality 11 days later.
They said 8000 cases 29th July but 6793 2nd Aug
They state “These increases will lead to more hospital stays due to COVID-19 which have themselves also been steadily increasing since the beginning of July. Although the large-scale testing(LST)is contributing towards the detection of new positive cases, there has been a general trend for more positive tests in relation to the overall number of tests performed”
But they don’t give any clear figures of newly hospitalized cases nor any percentage of PCR pos detected of tests done.
“ If the current dynamics persist, a shortfall in available intensive care unit (ICU)beds may be expected already by the end of August. Given the range of doubling times of 8to 13.2daysfrom the presented analyses, it remains unclear whether the recent rise in cases is restricted to clusters(which evidence indicates)or whether broader community transmission of SARS-CoV-2 is occurring.”Rather gloomy prediction but startling there is no indication where these positive tests come from. Screening, hospitalizations, are they all PCR or srology included ,are they from selected community screening? Amazing that a central body seem to have no information where the tests come from. They calculate 600 cases 30th July(Reality 83).There are more confusing graphs but the ICUs would be overwhelmed early.Now have a look at the actual cases and deaths. Cases have increased after this document max 150 but long from 600 cases 30th July as predicted. Five scattered deaths since the document but most likely elderly cases from the earlier pandemic. The recent spike can’t have produced those deaths.If a prediction what is going to happen in two weeks  is so bad wouldn’t it be better to start collecting real data incl. URI surveillance, divide testing results from asymptomatic and symptomatic, hospitalization data, which are contact tracing, which are clusters ,which are occupational screening and what are the false positive ratio?But tiny Luxembourg is perhaps not much worse in their predictions than the UK.

With no actual numbers of hospitalisations, deaths, tests carried out (and how many positive) this is all just scaremongering…
Need to get the swprs onto it!

Yesterday my partners 79 year old mother broke the law 7 times with 7 separate people. She did this because it is illegal in the north west to enter someone else’s home or private garden or to invite anyone into your own home or garden. I have to say I am struggling to accept that the government can make a private persons home or garden an illegal space for others to enter. If it is owned and freehold how can a property and land be subject to such a law?

Now we don’t have control over our own homes and gardens.

Of course thousands of people are ignoring this law and some don’t even know about it. I wonder what comes next if 79 year old people won’t obey the law?

If they can dictate what you wear, why not dictate what happens in your own home? This is not a problem for most people, it seems.

I’m not surprised people don’t know what you can and can’t do. I know I don’t!

It’s not the law though to be fair. It is merely “guidance”. I had to explain this to my mum last night when she was having a thromby about me being here (despite the fact we’re not in the lockdown zone yet).

As per

http://www.laworfiction.com/2020/07/lockdown-law-in-nw-england-is-a-fiction/

This is what we’re up against!

The 43-year-old, [Dr Van Kerkhove – why do we need ot know her age??] who has become a familiar face having appeared alongside WHO chief Dr Tedros Adhanom Ghebreyesus at press briefings for months, added that countries should not rely on a jab as a silver bullet to bring the raging pandemic to a close.

In other words they want everyone to be living in a constant state of uncertainty/panic/stress from now on until the end of time, whilst at the same time being constantly tracked and monitored. No more freedom, ever…

Raging pandemic??? WTF?

What is more moronic? Wearing a mask in the open air or wearing a mask in the car on your own!
I am sure mask fiddling must be leading yo car accidents.

Wait until they are driving trying to apply makeup & or eat breakfast whilst wearing a mask.

The fun has only just started.

I’ve already seen people on instagram doing makeup tutorials where they apply nothing to the lower half of the face (to ‘let the slin breathe’ – lol!!) and really elaborate eye makeup.

And this is why social media is cancer.

We were having a laugh in the bar about people wearing masks alone in a car. Someone said, yes its like wearing a condom in bed when you are home, alone.

Self love in both cases.

I thought wearing a condom in bed was classy or maybe I’m thinking of something else.

Maybe fiddling is less dangerous than nodding off through lack of oxygen / excess CO2?

https://www.dailymail.co.uk/news/article-8585307/Eight-coronavirus-deaths-recorded-England-Wales.html . I thought that the figures would be around 150 when they tried to find those who tested positive in March and died of a cobra bite today. All had underlying health conditions and none under 52. 774 more positive cases . I’m fearing an Australain lcokdown with horrifying figures like these.

Copying yesterday’s comment to today (have also put in the Forum):

Does anyone know, or can they point me at, the specific up to date legislation for GP practices and the NHS, as per the Corona Virus Act? I want to know what’s recommendation and what’s law?

I’ve also read this, but am unsure how it applies to GP practices? http://www.laworfiction.com/2020/07/risk-assessments-an-important-chink-in-the-lockdown-armour/

Given our overlords are talking about locking up the elderly again

My dad’s dementia has gone off a ski jump under lockdown, he’s gone from a fit, active, social 85 year old, to incredibly forgetful, anxious and lacking in confidence. His Gp was already disinterested, and so I got him an apt with a Harley St specialist who did a phone conference with me and my dad, he was fantastic and wrote to his GP to ask with help getting some tests and drugs organised. The GP won’t see him, only talk to him by phone.

I want to know what risk assessments, equality impact assessments and what bits of PSED GPs are still obliged to adhere to, as I’m going to send a letter asking them to tell me precisely on what basis they have withdrawn care from all their patients. I’m in a rural market town, where cases are incredibly low, as are deaths, it seems a bit heavy handed that they’ve mothballed an entire 20 GP practice, and nobody can see a doctor?
The original corona virus act: was revoked in almost its entirety, with no fanfare, announcement or anything on 4th July http://www.laworfiction.com/2020/07/lockdown-laws-in-england-have-been-revoked/

This is the new act https://www.legislation.gov.uk/uksi/2020/684/contents/made

That looks to me that they revoked almost everything relating to healthcare provision? My suspicion is this pronouncement by Hancock that care must be remote, isn’t in fact law?

Don’t think so. They’re just trying to ‘reform’ the NHS with the ‘crisis’ as cover.

Pretty vile actually.

Really vile, GPs must be coining it in on their little internal market. So you reckon it’s just a recommendation? Don’t suppose you happen to know whether PSED and risk assessments still apply? If I look on the Gov website for the Act, they risk and equality impact assessed the legislation (although a good lawyer could drive a coach and horses through it). i want to write a terrifying letter to our GP and find out on precisely what basis they’ve done this, and whether I can see their risk and impact assessments (covid, in rural Shropshire, not being the only risk to life and limb).

The worst I heard, a new mother who had a tear during childbirth got infected stitches, the doc receptionist asked her to photograph the affect body part (!!) and text it! How the F is that risk assessed? Would only take one perv in the office to whack it on pornhub and that would be a) life wrecking and b) a whopping invasion of privacy, dignity, and confidentiality!

Maybe get in touch with Law or Fiction about this?
It would make an interesting blog post for them.
I for one want to know whether a GP surgery can enforce masks BY LAW (don’t think so now, but maybe from August 8th) and therefore if they refused treatment to someone without one whether that would constitute an offence under discrimination and human rights law.

Sorry to be out of the loop but what changes on August 8th?

More mask rules come into force I think. Extension into more ‘public places’.

I hadn’t heard that but checked and you’re right: cinemas, museums and churches etc. Doctors not mentioned but only checked BBC, if they can be believed!

Apparently Jenrick on the radio was saying earlier that there are no plans for a new shielding regime, so I would expect it to be rolled out sometime this week, if they are still following the usual modus operandi.. Maybe by 8th???

Tomorrow more like.

Ironically, a properly managed and supported shielding regime is exactly what we needed back in March. Let the healthy carry on as normal, herd immunity reached, we’d all be out of it by now, vulnerable and elderly included. Instead they made them shield for months on end for precisely nothing, and are now letting them out for a month or two only to have to go back into it for the winter with nothing gained. It’s utterly sh*t.

Yep I’ve dropped them a line, waiting to hear. It’d be a really good blog post. I also want to know about visits, it turns I’m fairly sure, being denied visits by relatives if you were sick was never law, all those awful stories we heard of people dying without their loved ones wasn’t on a solid footing. My mum’s just got back from visiting a family friend in hospital, you book a slot, 30 mins allowed, they kept her waiting in the corridor for 15 mins, and then 15 mins later told her her half hour was up. Our friend was in tears, he’s been in there two weeks, feels awful, the food is crap, he’s scared and poorly and this was the first friendly face he’d clapped eyes on in all that time. My mum objected, they got the sister, gave her a dressing down, and booted her out. Who the bloody hell do they think they are?

Yes it’s one thing taking a pic of a facial mole, quite another taking one of your hoohaa! !

Exactly! I mean what planet are these people on? What woman in her right mind, never mind a sick one, would photograph her foufou and send the photo to some gimp at the GP surgery????

The only reason I’m sniffing around this is I’ve been here before on another issue, and it was shocking just how much local authorities and the NHS were getting wrong. It’s amazing what one well aimed, terrifying letter can do.

I think it must be the same with this, in fact not just with the NHS, but with HSE, Environmental Health, schools, shopping centres etc. If we had a library of templates, we could be firing them off and getting this sorted out. That way it wouldn’t matter that we were the minority, it’d just matter that we were right. And we are right.

Exactly , we need to be able to challenge so much .
Another is schools and mask wearing
My neighbours school is enforcing mask wearing for 11 + years

I would be asking …Has the school risk assessed my child individually for wearing an item of PPE all day ?

It’s ludicrous , in the workplace PPE is monitored , even a dust mask , the individual wearers health , the temp, humidity, ventilation, hours worn , level of activity etc
And yet you want to stick any old mask on a child all day !!!

Yes, parents should demand INDIVIDUAL risk assessments for their child wearing PPE all day – think the requirement might soon be dropped, especially if you threatened legal action if the child suffered ill-effects..or alternatively get the school to sign a form saying they accept responsibility and will pay damages if the child suffers any illness as a result of mask-wearing…

Folk just seem to accept it …slap a mask on their child and off you go . Bonkers

Thank you for this.

If my daughter’s school will demand masks this is what I will do.

Equality Impact Assessments also, plus safeguarding. We could do with some experts, all coming together and getting us some factsheets, then we could write letters. Masks on kids is just dangerous and inhumane, makes me so sad.

Don’t get sad, get even.

Same here , my Dad is 93 with diabetes, heart failure …can’t see a Dr , can only have telephone appoint. He is deaf so no can do . Resulted in changing tablets on my say so …pure guesswork as i am not a Dr . Disgusted how they can get away with this

I feel so sorry for you and your Dad trying to battle your way to simply getting care

It’s crap isn’t it? Your poor dad. I don’t think they can do this, I’ll report back when I find out, but I’m not letting it drop, my dad’s paid his stamp, he’s entitled to the care, and they can’t just make the rules up to suit themselves.

Boris weighs the nuclear options:

1. Destroy the UK economy.

2. Kill the Conservative Party.

3. Plead guilty to criminal negligence.

4. Resign.

OKUK you forgot 5. Take up extremely well paid pretend position with big pharma company.

At that speed and extent of economic destruction, there won’t even be money for big pharma anymore.

Join the Bill & Melinda Gates Foundation.

Boris has already deployed the nuclear option; we’ve been sussed – double down on the nonsense.

I think that the Tory Party committed hari-kiri. Nobody else chose the bloated lying pillock!

Even the Bruges group seem to have had enough! https://twitter.com/BrugesGroup/status/1289897027392872450?cxt=HHwWhICtqeSg0eYjAAAA
‘ Shielding for over 50s was not part of the Government’s initial Covid response.
The very suggestion appears to be not only an overreaction, but a surefire vote loser.
Allowing people to enjoy some semblance of normality only to revoke it soon afterwards would border on cruel.’

“Aussies love to make out they are this rough, tough, she’ll be right, bunch of rebels when in reality they are a nation of supine, compliant rule followers who love nothing more than ‘dobbing in’ someone else for not following the most petty of rules and regulations.”

After 10 years living there, I’d say that’s true. Unfortunately, the last few months have demonstrated that the UK is exactly the same. Officially the most scared nation in Europe. It’s embarrassing.

As an Australian living in Melbourne, can 100% confirm that’s true. Nation of bedwetters, grassing up their neighbors. Embarassing

The English speaking world has committed cultural and economic suicide and handed the world to the Communist Chinese on a platter.

Just posted on The Telegraph, quoting Carl Heneghan:

‘Where’s the rise? By date of test through July there’s no change if you factor in all the increased testing that’s going on’

Between July 22 and July 29 the seven day rolling average of reported cases jumped between those two dates from 659 to 753 – 16.7 per cent. However when judged by specimen date the seven day rolling average actually dropped from 641 to 442, a 31 per cent decrease.

Why is no one checking this out at government level?,” added Prof Heneghan.

Why indeed!

https://www.telegraph.co.uk/news/2020/08/02/lockdown-north-england-rash-decision-not-backed-data-oxford/

This is what we’re up against.

The government has totally lost it. This is appalling. They cannot even read data properly.

You sound surprised. They never have in the period of this whole sad carnival.

The only question is whether it’s deliberate.

Oh they’re checking it out. They know full well what they’re doing.

I think most people up here know this. Well not THIS (they don’t know about the figures, neither do they care) but they DO know that there is no ‘spike’ and they are well aware that corona is now basically a non-entity. So when you speak to them about a possible local lockdown hitting them they roll their eyes and say something like “Yeah yah whatever” and intimate that will ignore the rules. Most of them still wear their mask in the supermarket though.

“ Most of them still wear their mask in the supermarket though.”

That’s the problem.

A lot of people in 1933 Germany probably didn’t invest in the hatred of Jews. But they didn’t make waves, either.

‘they DO know there is no ‘spike’.

… I’m not so sure …. the general level of ignorance is pretty high, with vast over-estimates of the mortality caused by Covid shown by surveys.

You really can fool most of the people most of the time, and there is indeed what we might call ‘evil’ stalking the land – as usual, banal and unthinking rather than spectacularly surmounted by horns.

I don’t believe the surveys.
I believe talking to people in the street.

Heneghan needs to break down the door of No.10 and give BoJo a good talking to.

I wish he could gain more traction and influence on the media and government alike.

Note the word “claimed”. Of course he can’t possibly be right can he. Disgraceful attempt to discredit.

Carl needs to march to Number 10 and present these facts on Live TV.

Carl Henegan to the rescue again!

The UK war-gaming and Victoria curfew stories clearly indicate that they have lost their mind but won’t retract an inch, ever.
There, as well as in Germany, the general public has now been so brainwashed, was financially soothed temporarily and is economically completely illiterate, that they won’t face any meaningful, let alone successful, resistance anytime soon, if ever.

The German demo was peaceful, overwhelmingly attended by normal people able to think critically and for themselves, with the usual and very justifiable concerns voiced.
The media has focussed on actively LOOKING FOR right-wing banners and people, and would only start its cameras once it saw one, and broadcast only those, of course.
It also states that the main speaker was a far right Pegida one, omitting the others and that most of the others couldn’t speak, just because the demo was aborted by the police.
Aborted because most people didn’t wear masks, of course, as this was the point, and as it didn’t matter at the BLM demos.

It also seems to have underreported massively the attendance figure, as participants claim that there were close to a million people attending, instead of the 10k, 17 or 20k reported by the MSM.
See the link, although I don’t understand why organizers don’t have better pics/drone coverage of that if this was true.
https://www.rubikon.news/artikel/lugen-die-medien-2
Also, the million+ figure is allegedly one obtained from the police directly.

Which gives the lie-op an additional dimension and another active and as such corrupted participant, if true.

The MSM neglects to report completely that violence occurred at the Antifa counterdemos, claims that policemen were hurt by demonstrators at the Freedom demo
instead, and zooms in on a famous bedwetter journo’s claim that she felt
threatened and had to abort her
‘reporting’.

In short, such efforts and demos will currently be actively sabotaged by the authorities (I wouldn’t be surprised if the BVS actually TOLD its right-wing informers &co to attend and be visible) and the MSM, and the public will fall for it.

The people do not want freedom anymore, and as such, they don’t deserve it, least of all the either lethargic or fanatically woke young.
Let’s hope and try to ensure that those of us who do can obtain some niches for a few more years, but with regard to society/pre-Corona freedom status, I am afraid that the ship has sailed for good.

TOBY YOUNG SAID:
Can’t the over-65s just carry crucifixes and cloves of garlic to ward off the vampiric virus? I’m sure that would result in a far lower loss of life than imprisoning them in their homes.

It would also result in less taxpayers monies going down the drain.

Lock up the boomers. I think that’s what they actually want (apart from my folks). Send them Aldi beans and tinned macaroni – how do you like those apples? No need for a masks when you are at home chowing on Smart Price corned beef

I am a locked up boomer, living in an HLM social housing unit with 120 other locked up boomers over age 60. Nearly every inch of wall space in our lobby is covered by posters telling us not to do this, that and the other. All for our own good, of course. Because they are so concerned. Example: you can smoke cannabis in your apartment but not at your neighbor.
Just a few weeks from the lockdown the HLM administration put up a poster pleading with us to be nice to our neighbors, not say bad things about them, not give them the cold shoulder or socially distance yourself from them. Funny! One month after the lockdown began, in the last week of April, I received an official letter from them accusing me of being a menace to the health of my neighbors and myself. It stated unequivocably that, according to a complaint from another resident in my building, I, resident of Apartment 214, ‘let anybody get in the building’. ‘So it meen that you put your healt in danger for you and others’. The following morning the HLM agent who wrote the letter and a policewoman knocked on my door and made the same accusation to my face. The neighbor that made this claim about me must have been invisible because there is only one way to let people into the building from inside the apartment and that is with the intercom box on the wall next to the bathroom. Mine stopped working eight years ago. I told the HLM agent that it didn’t work, so he went downstairs to ring my bell while the Policewoman stood outside in the hallway, hoping to hear it ring. It didn’t. What a shame. I further stood my ground and demanded that they show me concrete proof of my criminal activity: date, time, how was I dressed, who I let in, etc. They didn’t have one shred of evidence to shove in my face, so they left. Unfortunately, unsavoury types like my not very nice neighbor have been granted complete, legal, anonymity/immunity, so any official inquiries that I make will be met by silence. Kafkaesque, no?

The Irish edition of the Sunday Times commissioned a survey about schools reopening at the end of this month. 60% in favour and 14% no opinion with 26% against.

It will be hard for the teachers unions (as big a pack of bed wetting welfare queens as they are in the UK) to ignore this.

However the government don’t really want schools to open again, according to UK column way back in May. I think they want unions to insist on ‘safety’ measures that parents will not go along with, thus the parents will homeschool and the government will get their wish, without appearing to have actively ‘chosen’ this course of action…

Why don’t they want schools to open?

Because they don’t want a fight with the teachers unions.

They want everything to be online.

I think the govt do want schools to open, as if they don’t lots of parents can’t go to work & so the economy collapses even further. The govt seems to want a booming economy while terrifying the life out of everyone!

It’s fucking scandalous that kids’ lives are being treated in such throwaway fashion

Surely those sending kids to private or boarding schools must be livid. Paying significant costs for no returns. Surely they would be demanding return in September no matter what?

If the anger of those parents and the owners of private school rebel, surely state schools cannot be left behind. It would be beyond scandalous. What do you think?

It hasn’t been widely reported but suspect you will find a lot private schools opened up for many more years / pupils last term than the government suggested ones. My daughters prep school for example got all years and all pupils back for over a month. There had been reported challenges with insurance etc but that was obviously solved (assume once the government conceded in the Dolan case that the closures were not law). Would expect therefore that they will open fully in September and as you suggest the state schools pupils could be left behind again.

Out of interest, did they do social distancing, bubbles etc?

In some ways – class sizes were reduced to 15 and then the teacher stayed with them all day so the specialist subject teachers didn’t come into to teach (I think they were allocated to the newly created overspill classes) Staggered drop off and pick up – and now hanging around in the playground after school. Uniform ditched so it was clear everyone had clean clothes on every day. Temperature taken at gate on way in. Lunch was given to them in classroom as well. Didn’t see inside the classrooms but they were still given lego etc which was cleaned every week.

Our daughter is only just five so we were worried about how many changes there would be but overall they seemed to handle it well with minimal disruption – none of the teachers or assistants were wearing masks. They basically accepted social distancing within the class was impossible.

For next term uniforms are back and other elements like after school clubs were on the agenda to be returned. I was doing the school run the afternoon they heard they could get everyone back and the staff were genuinely elated.

Pretty much all parents sent their kids in – on the first day back there were 12 out of 15 which very quickly became 14 consistently.

Thanks; interesting. Here in Sweden there are no school uniforms. I have a friend who works in school admin and she said that in her school they spaced the kids out a bit more at lunchtimes, and they were not allowed to serve themselves the food like they usually do (staff served them) but they did not do much else in the way of precautions, apart from encouraging hand washing.

Up to about age 13 kids here sit at individual desks, spaced out and facing the teacher anyway – above that age that they usually sit in pairs, again facing the teacher. She said that whatever they said, the kids were not going to stay away from each other in the corridors and playground, so it was pointless running around trying to enforce distancing!

All sounds very sensible ! Think the lunch in the classroom was the same idea – they used to have in a dining hall and serve themselves. Their classroom sitting was around square tables that took eight – not sure what happened to those. They definitely encouraged hand washing. My sister works as a teaching assistant in a state school that was open throughout for key workers in London – any illness in the teaching staff there was over the by the end of the Easter holiday and they haven’t had any issues since then (which corolates to the estimated peak in London overall pretty tightly). For us it was a big step back to normality and losing fears about what was happening letting her go back – that should be the same for everyone so really hope that all schools are back open and not tied up in stupid rules for September.

The government of Scotland farcical counting record continues

Verbatim from Scot Gov site reported 2 August:

“Weekly figures
– Positive tests: week ending 2 August: 22,038 people tested – 125 positive

– Number of tests: 72,705 tests reported week ending 2 August”
—
How can the report two figues for weekly number of tests (22,038 & 72,705)? This is complete nonsense trying to obscure that 125 tests returned positive.
—
Also verbatim from ‘weekly figures’:reported 2 August:

“- Hospital admissions: week ending 22 July : 3 COVID-19 patients were admitted to hospital.

-Deaths: week ending 26 July: 8 COVID-19 deaths were registered, of which 2 were in care homes and 4 in hospital.

– Delayed discharges: As at 29 July: 920 people were delayed in hospital.

– NHS staff absence: week ending 28 July: On average, 4,241 NHS staff, or around 2.5% of the NHS workforce, reported absent each day for a range of reasons related to COVID-19.”

—
These weekly figures are for weeks ending 22, 26, 28 and 29 July above we were 2 August – all gathered together in the same bullet list.

Three admissions from, say*, 125 positive tests.

*say since the scot gov doesn’t give figures like for like to be able to draw conclusions. 3 (22 July) out of 125 (2 August).

Zero deaths widely reported by sturgeon et al. for 14? days in a row as at 2 August but not according to week ending 26 July which recorded 8 deaths.

NHS staff off for covid 19 (notice NOT corona) related reasons. Child care, self reporting symptoms to isolate in the good weather – is it that curious higher than average attack by covid 19 affecting the public sector – those with low motivation.
—

Finally verbatim again from Scot Gov:

“Scottish numbers: 2 August 2020
-31 new confirmed cases of COVID-19; this is 1.1% of newly tested individuals

– 8,243 new tests for COVID-19 that reported results”

—
Once again 31 is not 1.1% of 8,243. This remains unexplained.
Newly tested individuals // new tests … that reported results.
—

https://www.gov.scot/publications/coronavirus-covid-19-daily-data-for-scotland/

Also from Scot Gov 2 August:
– 0 new reported death(s) of people who have tested positive (noting that Register Offices are now generally closed at weekends)

– 3 people were in intensive care last night with confirmed COVID-19

– 265 people were in hospital with confirmed COVID-19

—
There is transparency and then there is this.

Re. the two different numbers of tests, I suspect the first (lower) number is the number of individual people tested, whereas the second number is the total number of tests carried out altogether, which is larger because many people are tested more than once.

In which senarios would there be call for a second test?

To check the first result?

If someone tests negative but has symptoms and is suspected to have covid. I know someone who had three tests before getting a positive result. I believe there have also been issues with them counting throat and nose swabs from the same person as two separate tests. At one point they were also including tests from NHS workers and others who have regular tests but I’ve got a feeling they stopped that a while back.

Thanks for your answer. These figures do not making reasonable reading, which is afterall the point of publishing them.

Three tests before they got the test they wanted. Seems like a poor test. A positive test therefore unlocks the covid drugs cabinet to that patient I presume.

It is a large difference 22k – 78k for it to be procedure for 3 tests. 125 postives as a result. Even half 22k indicates a very low ratio of success with a single test + confirmation 2nd = 250 total.

Confirming nagatives 22k × 2.

I agree, it’s a big difference, maybe too many to be explained by duplicate tests alone, but that’s probably part of it.

Three tests before a positive is ridiculous. It makes me wonder if he did in fact have covid, but he ended up very ill on a ventilator so there was definitely something quite wrong. They were already treating him as covid so I’m not sure why they were quite so desperate for a positive test. Just for the numbers I suppose!

If they’re coaches for a football team and the season is about to begin.

As many people have said before this is so contagious that you can’t sing in church, have to stay 2m away, wear a mask etc but they struggle to test you. Surely if your breath is so full of virus they could easily test you with some sort of breathalyser?

Need to add that to our campaign leaflet!

Even at 1% false positive rate 22k tests that’s upto 220 false positives, how many tested positive again?..

We know Covid 19 affects different communities differently

‘There is evidence of a wide disparity in deaths from COVID-19 amongst BAME people compared to white health and care workers in the United Kingdom (around 2/3rds of healthcare staff who have died are from a BAME background, whereas they make up around 20% of the overall workforce).’

https://www.rcpsych.ac.uk/docs/default-source/about-us/covid-19/impact-of-covid19-on-bame-staff-in-mental-healthcare-settings-report-2020.pdf?sfvrsn=22a9083a_2

But no-one has yet convincingly explained why. There is one explanation which, since it applies across Europe rather than just in Britain, seems, to me at least, to have legs.

‘…..some subgroups of migrants, including refugees, asylum seekers, and irregular migrants are particularly vulnerable to infectious diseases and may have worse health outcomes than the host population. In a number of EU/EEA Member States, subgroups of migrant populations are disproportionately affected by infectious diseases such as tuberculosis, HIV, and hepatitis B and C. Consequently, screening and vaccination programmes may be of benefit for newly arrived migrants, i.e. those who have arrived in the EU/EEA within the past five years.’

https://www.ecdc.europa.eu/sites/default/files/documents/Public%20health%20guidance%20on%20screening%20and%20vaccination%20of%20migrants%20in%20the%20EU%20EEA.pdf

It looks quite likely that BCG vaccination may give protection against covid 19, indicated by the low incidence of covid 19 in countries, Japan, Korea, Greece etc which still have community BCG vaccination programs nationwide. But many migrants may very well not have had BCG vaccination.

So the continuing measures across Europe that fly in the face of the blindingly obvious, that covid 19 is over bar the shouting, may be explained by a noble intention, and that is to the European governments and, indeed, our credit: to protect vulnerable minorities

But, for that protection to be properly reinforced, unfortunately we will all have to wait

‘Murdoch Children’s Research Institute has organized BRACE, a Phase 3, two-group, multicenter, open-label, randomized, controlled trial of up to 4170 health care workers in Australian hospitals to determine if BCG vaccination reduces the incidence and severity of COVID-19 during the 2020 pandemic. Primary results are expected in October 2020, and full study results are expected in March 2022.’

lifespan.io

The differences between countries are pretty obviously a multi-variate problem. It’s a mistake to look for single variables, and will take a long time to untangle – particularly because data is so incredibly corrupted.

As a gut reaction as to what the overall shape of enquiry should be, I reckon Karl Friston is on the right lines – big brain and rational framework :

https://unherd.com/2020/06/karl-friston-up-to-80-not-even-susceptible-to-covid-19/

‘Immunological dark matter’ could indeed be one explanation for covid 19 immunity.

But I know where my money is:

‘ The current evidence about BCG vaccination and prevention of acute respiratory infections is of high quality, as it is supported by results from 2 systematic reviews (one including meta-analysis) and 4 RCTs, which provide high level of evidence for prevention studies.’

https://www.cebm.net/covid-19/does-bcg-vaccination-protect-against-acute-respiratory-infections-and-covid-19-a-rapid-review-of-current-evidence/

‘After mitigating multiple confounding factors, several significant associations between BCG vaccination and reduced COVID-19 deaths were observed.’

‘Results fail to confirm the null hypothesis of no association between BCG vaccination and COVID-19 mortality, and suggest that BCG could have a protective effect.’

https://www.pnas.org/content/117/30/17720

And, by October 2020, we should have some even stronger indications, one way or the other.

Very interesting. I had BCG vaccine 20 years ago as a young adult. I wonder if it is still valid.

If you come from Alaska, then I can assist:

‘In this trial, BCG vaccine efficacy persisted for 50 to 60 years, suggesting that a single dose of an effective BCG vaccine can have a long duration of protection.’

https://pubmed.ncbi.nlm.nih.gov/15126436/

Ooh, good knowledge. Thanks @Tim Bidie. I’ll save that one for ‘no sorry, I’m not having the Covid-19 vaccine because my BCG vaccination will cover it’. And ‘my daughter is a no-thanks too, because she she’s too young to transmit and won’t be impacted by illness’.

Someone asked me yesterday if Swedes were vaccinated with the BCG vaccine. Just looked it up; here is the answer, direct from our Public Health authority:

Until the mid-1970s, BCG vaccination was routinely performed in ‘BB’ (which is the maternity department of a hospital – don’t know if that means they injected babies?) in Sweden. Nowadays, vaccination is only offered to children in certain risk groups.

Vaccination is recommended for:

• children up to 6 years of family origin from a country with increased or high TB incidence
• and to children and adolescents up to the age of 18 who, according to the following criteria, are at increased risk of being infected:

• current TB at a close relative or household contact
• before a planned longer (more than three months) stay in a country or area with a high incidence of TB, if the child comes into close contact with the local population.

So it’s not our wonderful immune system that’s protecting us – it’s a vaccine

Possibly *enhancing* protection in age groups who would otherwise be more vulnerable?
Younger people who haven’t had the BCG must be using their immune system… Seems it is BAME young people who are not immune – but that is likely due to less vitamin D absorption in dark skinned individuals..

Off topic, but we need some relief. The Dragon Endeavour space capsule is returning from the ISS tonight, splashdown expected at 19:45 BST. This is human achievement and real science, rather than ‘the’. Let’s hope all goes well. Live stream available on Youtube.

Do you think they’ll be quarantined?!

Absolutely. That bastard virus knows whether you are in a pub or a park, so it can probably survive vacuum and even re-entry. Then again, are the astronauts from more than one household? Then again, do we really give a flying fuck?

Democracy in the UK: Government of the cretins, by the cretins, for the cretins.

the blind leading the blindest

“A democracy is run by those who care
For those who don’t care.”

Well those currently running our country clearly don’t care, so …..

Another off topic but – who’s that Conservative MP?

#HancockMustGo on Simon Dolan’s twitter feed today. I don’t do Twitter so I can’t join in, but I give it 100% support.

And this. Weekly care home testing abandoned.

https://twitter.com/doctor_oxford/status/1289821262471000064/photo/1

Disgusting.

No – not really ‘disgusting’. The testing causes as many problems as it pretends to solve.

All testing should be abandoned

I think we need to get some intelligent young people like Poppy to repeatedly point out to their peers that if you get tested it will lead to more restrictions and lockdowns – is that what young people really want??? I know students are unhappy that they will be paying fees for a uni experience that is 90% going to be delivered online – surely that point can be got across? Ie, if you want a normal uni experience, do NOT get tested!

In the general population yes. But personally I think it has some place amongst vulnerable people, if used in the right way. And more than anything it shows a complete disregard of care homes by the govt, despite the carnage already suffered during lockdown.

Cancel Matt.

https://www.charite.de/en/service/press_reports/artikel/detail/could_prior_exposure_to_common_cold_viruses_affect_the_severity_of_sars_cov_2_symptoms/
Press release Updated preprint published in Nature
 “The researchers found that one in three people with no prior exposure to SARS-CoV-2 nonetheless have T-helper cells capable of recognizing the virus. The likely reason for this is that SARS-CoV-2 shares certain structural similarities with coronaviruses which are responsible for the common cold. ” “This suggests that the T-helper cells of healthy individuals react to SARS-CoV-2 because of previous exposure to the endemic ‘common cold’ coronaviruses,” says Dr. Giesecke-Thiel. She goes on to explain: “One of the characteristics of T-helper cells is that they are not only activated by a pathogen with an ‘exact fit’, but also by pathogens with ‘sufficient similarity’.” Notably, the researchers were able to show that the T-helper cells isolated from healthy participants who reacted to SARS-CoV-2 were also activated by various ‘common cold’ coronaviruses – displaying what is known as ‘cross-reactivity’.

See Professor Sunetra Gupta (Oxford)

… but you’ll hear much more from time serving Big Pharma brown-nosers.

Most probably this is the reason why so many are “asymptomatic”—their immune system can cope with the infection as a matter of course!

https://www.youtube.com/watch?v=6mzJ4kkJqeU

I would pay lots of money to see congressman Jordan interrogate Mancock like he just did to Fauci on the first 5 minutes of this video.

Priceless.

Watched that earlier today, yes, I agree.

SURE IS SOMETHING SLICK GOIN ON

Ain’t that a bitch – Johnny Guitar Watson

https://m.youtube.com/watch?v=3sYUthjyTb8
lyrics are quite appropriate – plus ça change

happy Sunday everyone

Johnny Guitar Watson. Yessir! Wynonie Harris, Cleanhead Vinson, Big Joe Turner, Champion Jack Dupree, Elmore James …

Just wondering… do any of you know a single person who has a (symptomatic) case of COVID-19 in the UK right now? I know three people who had the symptoms back in March/April and recovered, but I can’t find anyone who has it now.

Not a soul.

Nope. Well, my 8 year old has a bit of a cough and he had a temperature for about an hour today. Does that count?

Only if you get her tested.

Don’t get her tested.

Him. No. Mostly, I’ve been thinking what a pain in the neck it would be. We’ve got my mother with us and she’s a GP and lives with my sister who’s a completely bed-wetting anaesthetist.

And the dreaded sister’s husband who has been discussed here before. Basically it means taking the poor kid to a car park where some drongo will shove a cotton bud up his nose. I don’t think he will like it. Why should you put him through that just to help Hancock be able to say he’s hit some stupid target number of tests he made up for himself?

Nope

No

no

No

I’ll join the long list too. No. Not come across a single person in my area who knows anyone either.

Me too – nobody. I keep asking people as well but nobody knows anyone who has had it since March, and most don’t know anyone at all. There were only 3 I can be sure of inis area. All recovered quite quickly by the way and 2 of them had it ‘badly’, caught in hospital.

Possibly because you don’t know anyone who works in a slaughterhouse, Amazon warehouse, test and trace call centre, or picking fruit.

During the whole lockdown period I do not know anyone who has had Covid 19, either a mild case or hospitalised, I do know someone however who has been attacked and seriously injured by a cow.

Not one. I haven’t even heard of anyone who’s tested positive since March.

Nope.

Nope.

The ‘symptoms’ of Covid19 seem to be completely meaningless. All of the so called symptoms are included on the warning leaflet of any prescribed medicine. My anti histamine pills list ALL the Covid symptoms and many more—it’s a load of bo*lox and that’s a fact.

Nope.

No

Nope.

Nope!

None at all for many weeks.

Knew of a couple in March / April, when there seemed to be a nasty virus going round – thank goodness it’s cleared up now!

My bf and I took a train through the North West today, via Manchester – pleased to say that the carriages were surprisingly busy for Sunday (it was an extra long train as well, two smaller trains stuck together), almost like normal times. Hardly any social distancing going on. I wore a muzzle to get on the train but as soon as I sat down I pulled it down to my chin and kept it there for the remainder of the journey. Baby steps, I’m not quite confident enough to go totally maskless yet because I feel quite daunted by judgemental Karens and I don’t want to attract confrontation but we’re doing our weekly shop tomorrow so I might try going barefaced then, I’ll bring my bf along for moral support. It sounds like a lot of you on here have gone maskless in shops with no aggro so here’s hoping!

I have now done quite a few with no problems at all.However,everytime I shop I see more and more bare faces!good luck!

That’s great news, Kelly. Every new bare face is a small victory.

Go for it Poppy. I haven’t worn a mask yet, and I’ve been in shops, on the underground, to the cinema, to a museum… Just go shopping like you used to, and forget about the crazy situation.

You’re doing fine,I admire you!

Forget the mask. Smile. Show the world your lovely face. If asked, another smile and “I’m exempt, thank you”. You can do it, honest.

Go for it Poppy. I’ve not been wearing them (due to medical condition) and have not had any problems. I don’t think you will either.

Go for it Poppy & smile! They don’t like it when you smile at them. Not worn a mask yet or will ever.

No need whatsoever to wear a muzzle. If you do it just the once, you’ll realise you don’t have to do it at all. And you’re exempt anyway.

Just act completely normal, like you’ve never even seen a person in a mask. (Which can prove difficult when you walk in and see them all. Eerie.) Nobody reacts, they just kinda ignore you pointedly. You may get a few stares which are easy to ignore. Unless you want to piss them off a bit, in which case, smile.

Important to keep body language confident. If you do not feel confident, imagine you are someone that you know who has oodles of self-confidence, and act like you are that person!

Lol yeah good point. For me confident is normal

Well done, Poppy. You have to do things at your own pace. I did my first brief visit to a shop today. I had my headphones in, in case anyone tried to get my attention and tried to keep my back turned to people so they couldn’t see I wasn’t muzzled. My ‘line’ if asked is ‘I have a heart condition’, because it’s my truth. My heart condition is that I care about what this government has done to people and I will do what is within my power, to put a stop to the fear.

First week of muzzle wearing in sunny Wales – Monday, nervous as hell, got on the bus (no mask) – the driver said (in an unfriendly tone) ‘where’s your mask love?’, I just said ‘I’m exempt’, gave a pleasant smile, fine – I was the only unmasked person, bus a third full. Tuesday no issues, same with Friday and Saturday. Took a couple of taxis in the week, no questions asked. On Friday accompanied someone to a GP appointment (I work in social care), unmasked – the GP was in full PPE – she didn’t bat an eyelid to the fact that I wasn’t wearing a mask or any other kind of PPE.

UK government exposed for telling lies:

https://www.zerohedge.com/geopolitical/austria-confirms-opcw-report-skripal-faking-british-exposes-ft-lies-cover

I was called a conspiracy theorist and worse at the time for exposing all the inconsistencies in the official narrative on this at the time. Are those people going to apologise and admit they were wrong? Do pigs fly?!

Notice how there is nothing in the mainstream media about this surprise surprise. And if they’d lie to you about the biggest story in the first half of 2018, then surely they wouldn’t lie to you about anything else would they including Covid?

It really pisses me off that the test they use is completely not fit for purpose, it can’t distinguish between a multitude of viruses and non-infectious RNA, yet the results they get from it play the key role in deciding what shambolic rules they chose to implement.

Testing positive is the equivalent of testing positive for drink driving even though you’ve not had an alcoholic drink. Then you get told you’re losing your driving licence but not just you, all your county are also losing their driving licences too.

The test needs to be completely discredited.

A good summary of the fiction.

Does anyone have a source for this claim that the PCR test gives you false positives because of other viruses? This seems unlikely to me.

I think the test is OK but has its limitations like any test. The biggest problem it’s up against now is that the prevalence is so low it’s well inside the false positive rate of the test (and this is true even though the test has a relatively low, though of course not precisely known, false positive rate).

https://bpa-pathology.com/covid19-pcr-tests-are-scientifically-meaningless/

It was also in the WHO testing guidelines, that given that a positive result in a pandemic couldn’t possibly be anything other than Covid, just test for some coronaviruses and it’ll be fine!

OK thanks everyone, I was sure I had seen that somewhere.

Now for the fact-checking. This seems to be what the fuss is about:

“If the sample was analyzed using the Roche method, we have given the measurement results for both target sequences of the PCR (ORF1 and E genes) separately. The ORF1 gene is specific for SARS-CoV-2, while the E gene is also found in other corona viruses. We have already rated the cases in which only the ORF gene was amplified as positive. […]Taking into account the epidemiological situation and the overall increased positive rate, we are now following the WHO recommendation and will issue a result as “positive” if only the E gene has been amplified.”

(from https://web.archive.org/web/20200417112824/http:/www.labor-augsburg-mvz.de/de/aktuelles/coronavirus translated from the German by Google).

Now it seems the reason they were looking for the E gene was that they developed this test before SARS2 had been completely sequenced. The E gene is common to SARS1 and SARS2 and so they were able to make a preliminary good-enough test:

https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf

“We designed candidate diagnostic RT-PCR assays before release of the first
sequence of 2019-nCoV”

OK fine. But the other document said the E gene was found in “other coronaviruses”. So which ones?

The actual E-genes they’re looking for are:

ACAGGTACGTTAATAGTTAATAGCGT,
ATATTGCAGCAGTACGCACACA and
ACACTAGCCATCCTTACTGCGCTTCG

(source: https://www.who.int/publications/m/item/molecular-assays-to-diagnose-covid-19-summary-table-of-available-protocols )

I downloaded all the known human coronavirus genomes from here: https://www.ncbi.nlm.nih.gov/genomes/GenomesGroup.cgi?taxid=11118

These are 229E, HKU1, NL63, OC43, SARS1 and SARS2. Then I searched for those genes in all six of these genomes. The first one appears in SARS1 and SARS2 and no others. So does the third one. The second one surprisingly doesn’t appear in any!

Apart from my failure to detect the second gene this makes sense– the Roche researchers presumably guessed at bits of SARS1 until they found something that matched on a SARS2 sample and that they knew wasn’t in 229E etc. (since those have all been sequenced and they could just download the genomes like I did).

So I think if you only have an E-gene match you have SARS2 or SARS1 (or it’s a false positive). It’s more likely to be SARS2 as SARS1 has not been seen for quite a few years. But anyway, SARS1 is like SARS2 only worse, so if you do have SARS1 take it easy, go to bed, and try to infect anyone– the advice is the same. You don’t have 229E, OC43, or any of those. Of course you may be infected with an unknown close relative of SARS1 and SARS2, but if you are, you should probably treat it the same anyway.

We also don’t know whether the actual tests in use now in the UK are only looking for E. I would hope they match on a few other genes, especially since they are likely newer tests by which time the whole SARS2 genome was known.

So I think this is all a bit of a stretch (like a lot of other things in that controversial off-guardian article most of this comes from).

The greatest source of false positives in a PCR test is usually thought to be contamination or human error. The false positive rate is low (but to be any use with the prevalence now so low it has to be almost zero).

Your chance of a false positive if you have any other cold is no higher than your chance of false positive anyway. If the authors of that off-guardian article want to prove this instead of just throwing speculation around they need to get some PCR test kits and some people with OC43 etc. infections and demonstrate that they are testing positive.

Many thanks guy 153 for hanging in here and injecting some scientific rigour into the debate.

Thanks! Thinking about this some more it’s fairly reasonable to treat an E-only match as a positive for the purposes of quarantining etc. since the test has poor sensitivity. So if you’re positive for E you most likely have ORF1 or whatever else it’s looking for but there just wasn’t quite enough of it to pass the cycle threshold. If I was running Iceland I would ask people to quarantine based on E even if I wouldn’t call it a “diagnosis”.

It’s all completely irrelevant in the UK now but for different reasons. I think this particular WHO update was rational and in good faith.

I’m not very scientific. In simple terms if somebody had a common cold or the flu and not Covid would they 100% test negative with this current test?

95% to 99.999% would test negative. If that person didn’t have a common cold or flu, and also didn’t have Covid, then they would also test 95% to 99.999% negative. The other cold makes no difference.

99.999% is a number I pulled out of thin air– the point is it’s something close to 100 but not 100.

Sorry if this is a stupid question but for the potential 5% that might test positive but didn’t have covid, common cold or flu. How would that happen?

Contamination is the most likely reason as the test works by amplifying the hell out of whatever tiny bits of RNA it found. Maybe the equipment wasn’t cleaned properly between tests, or the samples got contaminated by each other. Another thing that is known to happen is that someone who recovered from Covid some time ago might still have fragments of it around that the test picks up, even though they aren’t viable, are not causing disease and can’t infect anyone.

Another possibility is just someone clicks the wrong box on the computer– doesn’t happen often but will happen some of the time.

But if you have another cold, that virus will not contain the genes the test is looking for, and so there is no reason for it to give you a positive because of that.

Thanks. You’ve posted some very useful information on this thread.

Where it picks up harmless fragments from somebody who’s already had it. How long can these fragments stay in the body for?

What do you reckon the split currently is for positive tests between currently infectious and previously had it and now non infectious is?

Is there a certain amount of RNA that needs to be infected before a person could pass the virus on?

The fragments could stick around for months. But the longer you wait the lower the chance of a false positive from them.

Impossible to say what the current split is– we don’t even know the false positive rate with any certainty. Usually you calibrate it against samples of known true negatives, but these probably aren’t from recovered people.

You need to be infected with probably a few 100 or 1000 complete virus particles for it to actually start replicating in your body so you can pass it on. But the fragments in a recovered patient that might cause a false positive aren’t complete viruses, they’re just smashed-up pieces.

The complete genome for SARS2 is about 30,000 nucleotides (ATTAAAGGTT… etc. about 30,000 of those letters). This is all stuck together inside the little ball with spikes on that we keep seeing pictures of. That sequence is the recipe for how to make a new little ball with spikes.

The tests are looking for a couple of short sections, only about 10 nucleotides long. It’s a bit like going to the scene of a plane crash and finding a bit of twisted metal with “ritish Ai” on it. This tells you it was a British Airways plane that crashed. But that little bit of metal is not going to get up and start flying.

Great explanation. Now I need to try and remember it so I can explain it to other people.

This is the first pandemic that’s occurred in the social media age & just look at the consequences. Partly, I think, because of the death of religion (the churches! Talk about an organisation that never misses an opportunity to miss an opportunity!) people now deify themselves. Their Facebook account becomes their shrine, their selfies become their Icons. They construe it as a blasphemy if someone offends them. Then we get into the whole ‘victimhood’ thing. So many people want to star in their very own drama, they seem to want to catastrophise their lives. Their success isn’t measured in their achievements but by the ‘unique’ set of invented ‘set-backs’ they’ve overcome.
They think themselves uniquely sensitive to the suffering of themselves and others. Are they guilty that they live comfortable lives that makes them want to find new ways in which they imagine they’re suffering?
It’s a weird thing. It used to be that when people started paying tax & realised that the only money a government has is that which comes from the taxpayer, which in turn only comes from the profit of businesses, they stopped behaving like spoiled 3 year olds but now this sense of needy entitlement seems to be a lifelong affliction.

Well said. And don’t forget that the hand sanitiser becomes their “holy water” and the face masks becomes their talisman (i.e crucifix, rosary, medals, relics) which they believe will protect them from the virus

It’s homeopathic.

Please leave out the religion bit – there’s enough virus superstition around.

The Zombieville Gazette

Masthead: Stay put, question nothing, be very afraid, think second wave

Obituaries

Mrs Prunaprismia Craven-Bedwetter

We regret to announce the death from Covid 19 of Mrs Craven-Bedwetter, aged 51, which occurred on 1 August.

Mrs Craven-Bedwetter was one of our early lockdown heroines, having spent twenty-five weeks in total self-isolation without leaving her one-bedroomed flat. She was in excellent health, but the wise woman knew that you couldn’t be too careful.

Her shopping was done by a neighbour, Mrs Lucy Goodheart, who left the shopping outside Mrs C-B’s door. Mrs C-B never exchanged a single word with Mrs Goodheart, being well aware that the virus can be passed on well within the time it takes to say ‘thank you’. And she always set an example by spraying all her groceries with neat bleach. ‘It makes the fruit and veg taste a bit odd,’ she once tweeted, ‘but it’s worth it to be sure that they are totally safe to eat.’

[Note: Mrs Goodheart, who is 82, has been detected in numerous illicit excursions from her home, and has delivered shopping to many local residents at the risk of spreading the virus. Loyal Zombies will be disturbed to learn that despite this reprehensible behaviour, Mrs Goodheart appears to continue in excellent health and spirits and has been seen several times to sink a pint in the local Wetherspoons. Worse still, she has not paid for any of these drinks because deluded locals have been buying them for ‘our dear, valiant old girl’. We cannot over-emphasise how much loyal Zombies should condemn such dangerous conduct.]

Mrs C-B was a founder member of Zombieville’s celebrated ‘Snitch on your Neighbour’ movement and repeatedly contacted the police to demand drastic action against those whom, from behind those virtuous lace curtains, she had observed criminally behaving like human beings. One example of her righteous anger must suffice. When she realised that Ginny Tearaway (15) was taking 35 minutes’ exercise every day instead of 30, Mrs C-B telephoned the police to insist that they sent a drone to follow Ms Tearaway’s every move, and have her arrested and fined the instant her 30 minutes were up. Mrs C-B’s anger when told that no drones were available, because they had all been sent to spy on walkers in the Pennines, nearly set Twitter on fire! Few can aspire to such a degree of spite. We can only envy and admire her achievements.

Mrs C-B’s end was a sad one. Misled by false, extreme-right-wing propaganda to the effect that it was now acceptable for shielding people to go out, and knowing that face masks are guaranteed to keep you safe, she unfortunately fastened one so tightly round her nose and mouth that at the corner of her street she fainted, fell into the road, and was crushed flat by a lorry. Her death from Covid was certified on her arrival at NoHope hospital, whose valiant and self-sacrificing staff, Tik-Tokking on so bravely in an empty building with no patients, she had never ceased to praise in her tweets.

We salute a true Bedwetter.

Brilliant!

N. F. Simpson, ‘A Resounding Tinkle’.

Being reported in the guardian as a possible measure is blocking london in. Around the M25. As is clear the goverment are attacking the nation pyschologically and so whether this is just a story to destabilise or an actual fact is debateable. That it is even an alleged government concept is of note.
From the guardian:
M25 road block
To stop a major surge in London spreading across the country, ministers are considering advising no travel for Londoners past the M25, effectively isolating the capital city. In practice this would be ialmost impossible to police and highly disruptive for the 9 millon people living in the city. It would have to take the form of guidance rather than an edict and could lead to anger against any Londoners found elsewhere in the country.

It would lead to anger amidst many Londoners found in London!

I think this would be the riot straw.

Especially if done just before Christmas..

Doing it just before Christmas wouldn’t be a problem, surely?

Virtually everybody would have bought their presents and food and drink, and Christmas Day and Boxing Day tend to be quiet.

They’d need to do it 7-10 days before to properly f@ck us.

Well that was what I meant by ‘just before’!

Let us pray that the ghost of Christma Past drops by and knocks on his chamber door.

Bring it on!

Will there come a point when people will begin saying: enough’s enough?

No sign of it yet.