2020-08-02

Sourcehttps://lockdownsceptics.org/2020/08/02/latest-news-92/
Published2020-08-02T12:23:17
Last updated2020-08-02T13:26:12
Scraped2020-12-20T20:18:04
Articles13
Comments1,428
Users213

Articles

Comments

73899 hotrod, replying to hotrod, 3, #1 of 1428 🔗

Aha BBC save the day again for Boris.

https://www.bbc.co.uk/bitesize/articles/zqx3p4j

74589 ▶▶ richard riewer, replying to hotrod, 3, #2 of 1428 🔗

BBC Saves. Move over Jesus.

74803 ▶▶ Eddie, replying to hotrod, #3 of 1428 🔗

Oh my…
Love, can you flip on the Beeb website and see what they suggest for having fun today?

73916 Lockdown Truth, replying to Lockdown Truth, 21, #4 of 1428 🔗

Hi all

Please let me know what you think of this idea .

The idea is to borrow from the Extinction Rebellion model and allow autonomous groups to come under one banner to help get traction with the public.
Thanks

73928 ▶▶ Basics, replying to Lockdown Truth, 7, #5 of 1428 🔗

Just commented on previous thread. Intended to be helpful. Replace allowing with gathering. Allowing doesn’t sound good. Pedantic is sometimes fundamental with comms.
Cheers Lockdown you are making good efforts.

73939 ▶▶ thedarkhorse, replying to Lockdown Truth, 1, #6 of 1428 🔗

Oops didnt notice the change of thread.
I like the bird in cage logo…that’s very clever.
But why Twitter?? Surely don’t you think that Twitter will rapidly take the account down?
I know it’s got more circulation than Gab, but we all know by now that Twitter is ruthless.

73949 ▶▶▶ Lockdown Truth, replying to thedarkhorse, 3, #7 of 1428 🔗

Twitter is just an example. We can be everywhere with multiple accounts like Extinction Rebellion do. There are so many heads on that hydra that it cannot be killed.

74269 ▶▶▶▶ richard riewer, replying to Lockdown Truth, #8 of 1428 🔗

What about the Greek (I forget the name) that turns everything to stone? Could we find one of those? Could be very useful. Point it at Twitter HQ. Stoned!

74365 ▶▶▶▶▶ DoesDimSyniad, replying to richard riewer, #9 of 1428 🔗

Medusa or Gorgon?

74901 ▶▶▶▶▶▶ Andrew Fish, replying to DoesDimSyniad, #10 of 1428 🔗

Medusa is the name – gorgon was the kind of creature she was.

74520 ▶▶▶▶▶ Binra, replying to richard riewer, #11 of 1428 🔗

Petrifying is already in act. What you need is the call by which to break the spell, AS for XR – I see that as a completely astroturfed to down PR job. They effectively own all the bases and so as with BLM – can organise anything at across a broad base of captured proxies. Hence astro-turfed.
The next thing is that ‘we’ can be totally infiltrated and subverted by the systems we run on so as to run with an illusion and be run by a master of illusion.
Everything runs on consent – and the inducement to fear or reward operates to get you to give your consent. You cannot really change another’s mind – but in holding open a mind that is rooted in the heart’s honesty you can be a light to others without trying – just by being yourself.
If you are fear-framed in problem you wont think this can mean anything. That’s ok. It means you choose to consent to the problem as the priority that your heart must be denied in order to adapt to. And if the self-betrayal is acceptable in exchange for a masked adaptation to a new normal you consent to wear it. I’m not talking about face covering here but the face we put on and over conflicts that we either bring to a reconciliation in our own choices or persist in conflicted choices – that effect a choice to doublethink under fear and threat of room 101.

74592 ▶▶▶▶▶▶ richard riewer, replying to Binra, #12 of 1428 🔗

Say no to the Consensus. Remain skeptical.

74858 ▶▶▶▶ Cristi.Neagu, replying to Lockdown Truth, #13 of 1428 🔗

I suggest you give Parler a try.

73945 ▶▶ Andy C, replying to Lockdown Truth, 14, #14 of 1428 🔗

I like it. A national poster campaign like this will help to rally more people to the cause. To gain traction with the public, we need to steer the conversation away from the media’s perception of people who don’t support the lockdown, i.e. conspiracy theorists, on to a more serious discussion involving facts and figures presented in an easy-to-understand manner – much like Project Fear was, I suppose.

73975 ▶▶▶ Lockdown Truth, replying to Andy C, 1, #15 of 1428 🔗

Well put. Thanks

74043 ▶▶▶ Darryl, replying to Andy C, 7, #16 of 1428 🔗

Good idea and worth a try. But the trouble is the media have always categorised any one who doesn’t agree with them as a conspiracy theorist or tries to discredit them as far right / far left or as being crazy or past it. Once public opinion changes the media then start to change their tone, but us early sceptics will unfortunately have to take abuse until it gets to that stage. They have ignored and smeared various medical professionals and individuals such as Lord Sumption and Peter Hitchens so us mere mortals don’t stand a chance.

74064 ▶▶▶▶ Nick Rose, replying to Darryl, 6, #17 of 1428 🔗

This is true Darryl, which is why we must steer clear of anything that IS conspiracy. Just the numbers.

74093 ▶▶▶▶▶ Darryl, replying to Nick Rose, 10, #18 of 1428 🔗

I personally think the case for lockdown can be discredited on the inflated official numbers. Unfortunately the population seems so dumbed down that they don’t realise around 550,000 would die this year without ‘Covid’ and some people believe you should lockdown to save a single life. It’s hard to counter that level of thinking.

74100 ▶▶▶▶▶▶ IMoz, replying to Darryl, 5, #19 of 1428 🔗

I often said to people (even before covid-19) that if they wanted to be perfectly safe, they could just try staying at home 24/7, but even then there’s a problem with atrophy, vitamin d, etc… and depending on what flies through their windows they might still get anaphylactic shock or get infected… Living—dangerous business 😉

74138 ▶▶▶▶▶▶ Lockdown Truth, replying to Darryl, 5, #20 of 1428 🔗

We need to get simple, proven to be true facts out.

If someone sees a sticker and it gets them thinking and then their sister tells them the same fact the next day then a change can occur.

74393 ▶▶▶▶▶▶ Lms23, replying to Darryl, 7, #21 of 1428 🔗

Those who think we should lockdown to save just one life should be asked how many cancer patients should be sacrificed to achieve that.

74521 ▶▶▶▶▶▶ Bella, replying to Darryl, 5, #22 of 1428 🔗

Then they should stop driving cars to save a single life. God I am getting so fucking angry with that moronic reasoning

74104 ▶▶▶▶▶ Drawde927, replying to Nick Rose, 11, #23 of 1428 🔗

Agreed – focus on the facts and statistics and avoid anything that could be labelled as “conspiracy”, even entirely plausible stuff related to WHO corruption and Big Pharma money. Also as much as possible avoid anything politically divisive that isn’t directly related, especially issues like Brexit and BLM.
I’d say it’s important to avoid anything that (a) makes it easy for the media to use labels like “conspiracy theorist” and “contrarian” (although they’ll probably do this anyway) and (b) might alienate or confirm the prejudices of people with different political opinions, especially those on the left who might automatically dismiss sceptics as “Brexiteers” and “libertarians”.
I might be too optimistic here but I think a lot of “lefties” outside the world of media/journalism (which seems, like the government, to have its own agenda regardless of what the actual facts are) might stop and think when confronted with the facts of the virus’s decline vs. the effects of the lockdown on so many people’s livelihoods and health.

74386 ▶▶▶▶▶ Catherine123, replying to Nick Rose, 4, #24 of 1428 🔗

By nature a conspiracy theorist and following research I think quite a few are easily verifiable with public domain facts but I agree with this. Steer away from conspiracy theories and stick with the numbers. That’s enough and it keeps the message clear.

74816 ▶▶▶▶▶ Rowan, replying to Nick Rose, 2, #25 of 1428 🔗

Yes, but government numbers result from a government conspiracy.

74895 ▶▶▶▶▶▶ Andrew Fish, replying to Rowan, #26 of 1428 🔗

I think the CEBM handled this element rather well. When they showed how it was technically impossible for anyone diagnosed with Covid to die with anything else they reported it as a statistically anomaly. Obviously, it came about because PHE had chosen to measure deaths in a particular way, but by simply highlighting the insanity of regarding someone dying in a bus crash months after recovering from Covid yet still being regarded as a Covid fatality they gave it more salience.

I personally don’t think the Government is responsible for this particular measurement issue – I think they’re simply too dim to understand this stuff – but people will draw their own conclusions from the basic facts.

74137 ▶▶▶▶ Lockdown Truth, replying to Darryl, 7, #27 of 1428 🔗

The idea is to bypass the MSM and let the sceptical people convert their friends, families, colleagues and neighbours one by one.

74423 ▶▶▶▶ Silke David, replying to Darryl, #28 of 1428 🔗

The more people speak up, stating facts, then they have to listen. Just look at what happened in Germany yesterday, 1.8. 1.3 Million on the streets. The main stream media reported 20k, and stating they are AfD, conspiracy people, anti Gates, anti 5g. No, they mainly ordinary people afraid for their human rights and for the future of their children.

74529 ▶▶▶▶ Binra, replying to Darryl, #29 of 1428 🔗

Lies do not establish the truth no matter how many or how forcefully asserted.
Rest in the truth and learn not to attend the lies.
I have not ignored Hitchens and Sumption and many others and I live the fruits of the choices I live. What others choose is not my business to control – but insofar as I am moved to I engage in communication – principally to wards waking to the fact that we are beings of choice and not set or locked down in anyone else’s meanings. The media are hollow tools of a desperate and deceitful lie. But their function remains a true service waiting to be fulfilled.

73953 ▶▶ Bazza, replying to Lockdown Truth, 6, #30 of 1428 🔗

I think this is a great idea…. a united alliance against covid tyranny will hopefully gain traction.
It will require a figurehead though….. we got any autistic Swedish teenagers here?

74066 ▶▶▶ Nick Rose, replying to Bazza, #31 of 1428 🔗

Perhaps the figurehead ought to be named Goldstein?
Edit: I mean that seriously btw. NOT a flippant comment.

74150 ▶▶▶▶ annie, replying to Nick Rose, 2, #32 of 1428 🔗

Sole guardian of truth in a world of lies.
Yes.

74615 ▶▶▶ richard riewer, replying to Bazza, #33 of 1428 🔗

Abduct Greta T and subject her to hypnosis.

73968 ▶▶ kh1485, replying to Lockdown Truth, 4, #34 of 1428 🔗

Great idea, LT. Thanks very much for doing this.

73972 ▶▶▶ Lockdown Truth, replying to kh1485, 1, #35 of 1428 🔗

Thanks

73969 ▶▶ Victoria, replying to Lockdown Truth, 1, #36 of 1428 🔗

Also engage with PR connected individuals (with connections) to get into the papers, on TV and other social media feeds.

73985 ▶▶ anon, replying to Lockdown Truth, 3, #37 of 1428 🔗

some music to accompany your great idea and gallant efforts:

https://www.youtube.com/watch?v=5hZBEr9FKEo

Duppy Conqueror – Bob Marley and the Wailers

74403 ▶▶▶ Eddie, replying to anon, 1, #38 of 1428 🔗

great choice!!

74003 ▶▶ Drawde927, replying to Lockdown Truth, 7, #39 of 1428 🔗

Anything like this is a move in the right direction! Yesterday’s Berlin demonstration was really inspiring, I really hope we can see something like this in the UK before too long.

I’d certainly be interested in joining a group local to me (Thames Valley, east Berkshire)

74139 ▶▶▶ Lockdown Truth, replying to Drawde927, 1, #40 of 1428 🔗

Set one up. You can be the guinea pig for the first autonomous group. Email me if you want leaflets designed etc

74052 ▶▶ Nick Rose, replying to Lockdown Truth, #41 of 1428 🔗

Cracking one.
Yes, count me in.

74103 ▶▶ RDawg, replying to Lockdown Truth, 1, #42 of 1428 🔗

Where did you get the name “We Will Be Free” from? I ask this because that’s the name of the Twitter campaign page I’ve been running since April:
https://twitter.com/WeWillBeFree82

Can I suggest you give it another name?

74118 ▶▶▶ RDawg, replying to RDawg, 3, #43 of 1428 🔗

You already have a pretty decent name in “Lockdown Truth”. I’d maybe stick with that?

Some others I’ve thought of:
– Lives B4 Lies
– I/We Do Not Consent
– No New Normal
– Our Lives Our Future
– The Great Covid Con

74148 ▶▶▶▶ Lockdown Truth, replying to RDawg, #44 of 1428 🔗

Just sent you a message on Twitter…

74280 ▶▶▶▶ Drawde927, replying to RDawg, 2, #45 of 1428 🔗

“Facts Not Fear” is a good one, not my idea but from this Twitter user: https://twitter.com/dockaurG

74618 ▶▶▶▶ richard riewer, replying to RDawg, #46 of 1428 🔗

The New Abnormal.

74181 ▶▶ guy153, replying to Lockdown Truth, 4, #47 of 1428 🔗

The worry is you might get too many 5G and “anti-vaxxers” involved.

There are some legitimate rational concerns about vaccines hence my quotes. And maybe we don’t need 5G but it has absolutely nothing to do with Covid.

This sort of thing is not a problem for Extinction Rebellion as they’re quite happy to be madder than any of the hangers-on they attract.

74205 ▶▶▶ Lockdown Truth, replying to guy153, 4, #48 of 1428 🔗

We would have our official principle aims on the website and people would be bound by that. If anyone strays into dodgy territory we tell them to stop etc.

We need to crowd source this and bypass MSM. So there will be a risk of some people being silly. We just need to have an iron clad constitution (in more ways than one!)

74505 ▶▶▶ JohnB, replying to guy153, 1, #49 of 1428 🔗

“anti-vaxxers”

That’s what big pharma and the MSM call us, guy. You seem like a rational human being – vaccine opponents ?

74619 ▶▶▶▶ richard riewer, replying to JohnB, #50 of 1428 🔗

Anti-War demonstrators during the Vietnam War.

74908 ▶▶▶▶ Alec in France, replying to JohnB, #51 of 1428 🔗

Vaccine sceptics? Vaccine realists?

75154 ▶▶▶▶ guy153, replying to JohnB, 1, #52 of 1428 🔗

Well I did use quotes and qualify the statement 🙂

75449 ▶▶▶▶▶ JohnB, replying to guy153, #53 of 1428 🔗

For sure. Just trying to save you some pondering/typing time. 🙂

74651 ▶▶▶ Youth_Unheard, replying to guy153, 1, #54 of 1428 🔗

The few people who will listen to me when they have said “anti vaxx” and then I explain how stupid it seems to have a vaccine to an illness in less than a year when we haven’t had a coronavirus vaccine for 70 years and suddenly they are anti this vaccine, so actually it is a good thing for this one time! However of course vaccines which do prevent illnesses measurably without side effects are useful and should be taken. As for 5G, people need to go back to GCSE physics and learn the electromagnetic spectrum and realise that it is literally impossible that they can alter anything. Maybe if they’re worried about it being high frequency they need to stop opening their eyes, because visible light has a frequency orders of magnitude higher….

74796 ▶▶▶▶ JohnB, replying to Youth_Unheard, 1, #55 of 1428 🔗

Crikey, if you’re the best the bad guys can do, this crisis is over.

‘vaccines which prevent illnesses measurably without side effects’ – go for it. There must be some …

5G radiation at around 60GHz is absorbed by oxygen, leading to problems with it (oxygen) being up taken by blood/haemoglobin. ‘Literally impossible they can alter anything’ is just untrue.

75158 ▶▶▶▶▶ guy153, replying to JohnB, #56 of 1428 🔗

How does that lead to problems with it being taken up by haemoglobin?

75550 ▶▶▶▶▶▶ JohnB, replying to guy153, #57 of 1428 🔗

Ideally, 5G proponents would have to prove there are no problems. 🙂

I dunno is the proper answer; the current status of 5G means that getting an accurate answer might be tricky. Vague recollection of an ancient Russian paper suggesting issues in animals ?

Always good to do these things one step at a time though – ‘5G can alter things’ being step one.

74259 ▶▶ Bart Simpson, replying to Lockdown Truth, #58 of 1428 🔗

Like the idea and have just followed the Twitter page.

Thanks a lot for this.

74363 ▶▶▶ Lockdown Truth, replying to Bart Simpson, 1, #59 of 1428 🔗

Thanks

74415 ▶▶ Silke David, replying to Lockdown Truth, #60 of 1428 🔗

In Germany they have local groups Querdenken. They orginsed the demo in Berlin yesterday, with 1.3 Million people attending, not 20k like the mainstream media claims. I would love to have a local group, mu town is so conservative, and all the people with half their faces covered give me anxiety attacks.

74534 ▶▶ Lili, replying to Lockdown Truth, 1, #61 of 1428 🔗

Great idea. Can I make a suggestion that I hope you will take as constructive criticism? Instead of ‘We Will Be Free’ how about ‘We’re Taking Back Our Freedom’? ‘We Will Be Free’ has the unspoken ending of ‘when they let us’ rather than the proactive ‘we’re doing this ourselves’. WE have the power, after all.

74630 ▶▶ AngloWelshDragon, replying to Lockdown Truth, #62 of 1428 🔗

ER are irritating, upper middle class, pseuds who were intensely annoying to most ordinary people. I certainly didn’t see them winning anyone over. If you want a model for a distributed network of activists Antifa would be a better example. Or AQ.

74791 ▶▶ nfw, replying to Lockdown Truth, #63 of 1428 🔗

Hey that’s a thought. Where are the Extinction Rebellion useful idiots? Don’t they want less humans? Well here’s the perfect chance for all of them to become “cases”. “Cases” does mean carriers of death on their way to the grave doesn’t it? Anyway, it’s what they want. They’re not cowards are they?

73917 anon, replying to anon, 9, #64 of 1428 🔗

great pic of the protests in Berlin Toby

I watched several streams and there were A LOT of people there

73921 ▶▶ anon, replying to anon, 2, #65 of 1428 🔗

some drone footage of the Berlin protests would have been helpful in guaging the number of people there

73919 guy153, replying to guy153, 20, #66 of 1428 🔗

I don’t think Melbourne is a “minor uptick”. It looks like they’re actually getting their Covid epidemic now.

Postcard to AU from the UK: it’s not that bad, protect the hospitals and care homes, go easy on the ventilators, wash your hands, don’t panic and it will all be over in three months.

73971 ▶▶ A. Contrarian, replying to guy153, 14, #67 of 1428 🔗

It will all be over in terms of the virus, but definitely not in terms of the madness to follow…

74011 ▶▶ Drawde927, replying to guy153, 9, #68 of 1428 🔗

I have a horrible feeling that, whether through incompetence or actual malice, they’ll make exactly the same mistakes with care home/hospital infections that the UK and many other European countries (and US states) did.

But maybe, just maybe, the Australian situation will also make more people realise the futility of the “zero Covid” approach.

74240 ▶▶▶ Carrie, replying to Drawde927, 7, #69 of 1428 🔗

Personally I don’t think the care home deaths were truly a ‘mistake’ – I think they wanted to reduce the pension ‘burden’…

74603 ▶▶▶▶ Binra, replying to Carrie, #70 of 1428 🔗

However, as overall mortality is not out of average range – the population is so far rather resilient despite the degradations.
While not applicable to those in end of life ‘care homes’ – the overall deaths may have dipped as a result of escaping medical treatments. Whie this may sound flippant. IN UK and USA iatrogenic disease is at least third leading cause of death. But as with masks, belief in protection can outweigh any evidences as a result in lack of belief in the body as resilient, regenerative and resourceful in coping under stress.

74155 ▶▶ nat, replying to guy153, 19, #71 of 1428 🔗

I live in Melbourne and think “minor uptick” is an appropriate description. There have been a total of 123 deaths in the entire state of Victoria over the last 6 months, and these mostly due to recent outbreaks in care homes. Yet our premier has just declared a state of disaster in Victoria, the media has hypnotised the population into a state of panic and hysteria over daily infection rates, and cowering in fear of the terrorizing police presence . I feel like I must have fallen down a rabbit hole, bewildered by the high strangeness that surrounds me.

74176 ▶▶▶ guy153, replying to nat, -1, #72 of 1428 🔗

A small number of deaths like that does potentially mean you’re close to a tipping point because there will be a great many more infections.

Australia has hardly any herd immunity. They managed to stomp on it before with about 100 deaths so perhaps they can again but I think the following is working against them: it’s winter, and lockdown fatigue.

If they do want to have another go at stamping it out they are going to need very strict restrictions for a short time, and then shift gears rapidly to herd immunity plus mitigation as soon as it’s clear they’ve failed. This is going to be almost impossible politically so I fear we are going to see the worst of both worlds. A few thousand Covid deaths depending on how well they do with treatments and management of care homes plus destructive and futile restrictions causing thousands more.

Is there any case for even trying to halt the inevitable? I know most here will think not and I’m inclined to agree. But a sketchy vaccine or two may not be far away and some people might think having come this far it’s worth a shot. You can make a case for that. It’s not Boris Johnson mad, not yet anyway.

74195 ▶▶▶▶ nat, replying to guy153, 8, #73 of 1428 🔗

I certainly agree it is futile to try and halt the spread and we should just “take it on the chin”. But I am afraid that would be going against carefully orchestrated public opinion. Almost no one here is able to put the deaths into context and come to terms with the fact that elderly people in care homes do die with predictable frequency .

74266 ▶▶▶▶▶ nat, replying to nat, 12, #74 of 1428 🔗

I am still reading the latest on Melbournes”State of Distaster ” to find out what it actually means.

From our Premier “This means that police and others have additional powers.We can suspend various acts of the Parliament and make sure that we get the job done and there’s no question about the enforceability and the way in which new rules will operate.

Anybody breaking the 8pm curfew, we always reserve the right not just to fine you on the spot but to take you to court – and then it’s not $1,652, it’s actually $10,000,”

So martial law then.

74276 ▶▶▶▶▶▶ guy153, replying to nat, 11, #75 of 1428 🔗

Very nasty stuff. We never had it that bad in the UK. They were fairly small fines and hardly any enforcement.

So their scientists have discovered that the virus is nocturnal and only stalks the streets after 8pm?

74299 ▶▶▶▶▶▶▶ nat, replying to guy153, 6, #76 of 1428 🔗

It’s either a nocturnal virus or a coup.

74339 ▶▶▶▶▶▶ Farinances, replying to nat, 3, #77 of 1428 🔗

The state of play in Australian cities at the mo literally sounds like V For Vendetta

74360 ▶▶▶▶▶▶▶ nat, replying to Farinances, 5, #78 of 1428 🔗

It really is. Part of me wants to pretend it is happening, because it couldn’t possibly happen in Australia.

74369 ▶▶▶▶▶▶ Cheezilla, replying to nat, 2, #79 of 1428 🔗

$1652 is a weird figure. Where did they conjure that from?

74395 ▶▶▶▶▶▶ DoesDimSyniad, replying to nat, 4, #80 of 1428 🔗

I don’t know about you Nat, but I’d think that a state of disaster would mean complete collapse of society and bodies lying dead in the streets. Someone needs to introduce Daniel Andrews’ ugly face to a brick wall. I am entirely against my will stuck in Australia until this nonsense ends, but my mother and aunt are just as furious as me, and my cousins and some of my friends get away with as much as they can. As my grandfather is dying from metastatic pancreatic cancer, we all have no patience for this ridiculous farce. I can only imagine we are far from alone, and this may well be the final straw. I hope to see police snubbed, violently if need be, in the streets soon (for what it would represent – the complacent populace finally pushed past breaking point).
I did see a woman walking her dog without a mask – it appeared to be in her hand, but that is certainly not permitted by their illegal regulations.

74271 ▶▶▶▶▶ guy153, replying to nat, 2, #81 of 1428 🔗

It’s going to be painful. At least in the UK infections had already peaked before the lockdown so all they all had to do was sit back and enjoy the tyranny while taking credit for falling cases. But in AU they’re going to be still going up for a while.

74381 ▶▶▶▶ DoesDimSyniad, replying to guy153, 2, #82 of 1428 🔗

Don’t expect herd immunity to be non existent in Australia. The considerable spread of common cold coronaviruses no doubt will have a considerable effect as elsewhere, and Australia has always been very popular among the Chinese so if the suspicions regarding much earlier spread of a milder form from this time last year are correct, Australia will have a lot of immunity already present in the population. This seems so far to be borne out by the figures, but we shall see anyway.

74838 ▶▶▶▶▶ Sally, replying to DoesDimSyniad, 3, #83 of 1428 🔗

The NSW chief medical officer recently revealed that tests on blood donations and serology surveys had shown that 1-2% of the Australian population has been infected. Upon questioning she later said that she believed that it would be less than 1%. At best, there is a long way to go if these figures are correct.

75152 ▶▶▶▶▶ guy153, replying to DoesDimSyniad, #84 of 1428 🔗

That’s a similar situation everywhere. I think the pre-existing cross-immunity is important but is likely to be about the same everywhere. At least, there’s no reason to think it would be any different in Australia.

When I say “no herd immunity” I mean nothing to stop the initial spread of SARS2 compared to any other country. I would expect it to follow the same sort of curve and to end up at about 20% serology.

74411 ▶▶▶ Eddie, replying to nat, 4, #85 of 1428 🔗

I feel for you Nat. I’d be losing my mind if I was living in your neck of the woods

75305 ▶▶▶ Caramel, replying to nat, #86 of 1428 🔗

The hysterical public and mad scientists got what they wanted. Stage 4. I’m miserable about it.

74275 ▶▶ NickR, replying to guy153, 6, #87 of 1428 🔗

It’s winter in Melbourne. New Zealand likely to get a bit of it too. But neither country is very crowded, people live outside a lot so healthy. They’ll be fine, except for the poor sods with cancer etc who’ll get thrown under a passing bus.

74406 ▶▶▶ DoesDimSyniad, replying to NickR, 1, #88 of 1428 🔗

That’s the trouble with the restrictions in Melbourne – basically you’re not allowed outside. And the ‘infections’ are up one day, then massively down the next, there’s no clear trend. They’re also almost certainly from at least a week before the date they’re announced, given the amount of time it is reportedly taking for people to get results from the bogus tests.

74372 ▶▶ DoesDimSyniad, replying to guy153, 2, #89 of 1428 🔗

You are correct: Australia had no outbreak in March/April/May – it was almost entirely returned travellers.
Unfortunately for your advice, Daniel Andrews has already failed on care homes, despite the warning signs from abroad. Most hospitalisations are care home residents, though at least they’ve evacuated them FROM the care homes and not TO them like the UK.

75301 ▶▶▶ Caramel, replying to DoesDimSyniad, 1, #90 of 1428 🔗

I absolutely loathe Daniel Andrews but those people weren’t long for the world regardless. The care homes had issues before this and despite the Royal Commission inquiry, not that much improved.

73922 Basics, replying to Basics, 7, #91 of 1428 🔗

Ported across from the previous thread as just posted before new page.

Sunday View. The Richie Allen show. One hour of excellent comment taking apart the UK msm corona/covid19 propaganda.

https://www.podomatic.com/podcasts/richieallen/episodes/2020-08-02T04_11_34-07_00

Wise thoughts about not becoming depressed by this. Warnings about where this is leading and not to expect others to do what each of us must. A really good hour of a radio show.

Useful to share onwards to any open minds that do watch BBC SKY etc and are starting to question.

74625 ▶▶ richard riewer, replying to Basics, 1, #92 of 1428 🔗

I listened to it too. From Montreal, Canada. Am now listening to his Tuesday, July 21, 2020 broadcast.

73924 Tyneside Tigress, replying to Tyneside Tigress, 19, #93 of 1428 🔗

Not all academics have fallen for the panic narrative. Professor Dingwall, like Professors Heneghan and Gupta have been consistent throughout. Let’s hope, in addition to notable colleagues overseas, somebody – anybody – in government starts to listen before it is too late – that time is sooner than many think:

https://www.dailymail.co.uk/news/article-8585039/Professor-Robert-Dingwall-calls-sense-proportion-brands-Covid-19-nasty-infection.html

73974 ▶▶ A. Contrarian, replying to Tyneside Tigress, 3, #94 of 1428 🔗

Dingwall is great.

74005 ▶▶ BTLnewbie, replying to Tyneside Tigress, 3, #95 of 1428 🔗

Unfortunate typo, though. He is quoted as:
“‘Covid-19 has been linked to about 50,000 deaths in the first 16 weeks of the UK pandemic – but about 1,000 people normally die every week.”

That should be 10,000, not 1,000.

74092 ▶▶▶ Mark II, replying to BTLnewbie, 3, #96 of 1428 🔗

Unfortunate or deliberate by subbie?

74213 ▶▶▶ Cheezilla, replying to BTLnewbie, #97 of 1428 🔗

I thought that was odd!

73925 Ethelred the Unready, 5, #98 of 1428 🔗

Professor Robert Dingwall, whattaguy!!

73927 Smileits1984, 1, #99 of 1428 🔗

This is scary. Mainstream media is now running the UK and they love a disaster story. 2nd wave now inevitable whether it happens or not

73930 Ethelred the Unready, replying to Ethelred the Unready, 3, #100 of 1428 🔗

Whack-a-mole? I’d have more confidence in Guacamole!

73931 ▶▶ Farinances, replying to Ethelred the Unready, 3, #101 of 1428 🔗

I’m hungry

74627 ▶▶▶ richard riewer, replying to Farinances, #102 of 1428 🔗

Salsa anyone?

73933 PowerCorrupts, 7, #103 of 1428 🔗

HIGHLY RECOMMENDED : Please listen : Interview with Prof. Harvey Risch, Yale Prof. Epidemiology who is calling for immediate use of HCQ because it works:
https://pandemic.warroom.org/2020/07/31/ep-309-pandemic-emergency-tactic-w-dr-harvey-risch-david-bahnsen-bill-mcginley/

73936 ChrisDinBristol, replying to ChrisDinBristol, 28, #104 of 1428 🔗

AARGH! They are NOT CASES. A “case” is when an individual has symptoms, a doctor suggests it might be x & sends off tests and the test comes back + ve for x. That is a “case” of x. Perfectly healthy people wbo test +ve are NOT CASES. I know that most here know this, but the constant twisting of language is making me sick! I suggest all mention of “cases” (other than direct quotes) are placed in inverted commas as above. . . . Grrr!

73954 ▶▶ IMoz, replying to ChrisDinBristol, 18, #105 of 1428 🔗

Literally whole areas of science and medicinal practice are being re-written under COVID-19… I hope one day the society looks back on this period and realises just how moronically they’ve behaved.

74012 ▶▶ Farinances, replying to ChrisDinBristol, 4, #106 of 1428 🔗

They’ve changed their language a bit now and are referring to ‘infections’ more (because it sounds scary) and ‘positive tests’. ‘Cases’ is still their favourite.

74049 ▶▶▶ RickH, replying to Farinances, 5, #107 of 1428 🔗

Exactly. The term ‘case’ has developed this new Humpty-Dumpty meaning of a ‘positive’ result from a highly suspect and inappropriate test for RNA fragments.

It has nothing to do with viral infection or illness, except by coincidence.

74452 ▶▶▶ ChrisDinBristol, replying to Farinances, #108 of 1428 🔗

Yaas. Just saw ITV news reporting an increase in “cases” on South Africa. On screen was a sign of remembrance for the dead . . .

74616 ▶▶ Binra, replying to ChrisDinBristol, #109 of 1428 🔗

There are simply different versions of mind capture and those who still value the freedom to question the language and meanings that frame the mind of conditioned reaction or polarised identity, have the conscious recognition of just how unconscious we collectively are – when masking appearances are peeled away.

Almost everyone refers to Orwell but how many have chosen to learn to recognise and unpack doublethink?
So yes ‘cases’ are simply reinforcing a false assertion tha human beings are vectors of infection regardless of actual or clinical disease – as our new ‘conditioning’ or ‘normal. and every time anyone argues within such an idea they reinforce it and give it more power to choke the basis for any individual freedom, right or creative inheritance, outside the permissions of a bio-security state that is anti-biotic at its core.

73938 Basics, replying to Basics, 15, #110 of 1428 🔗

The figures for Berlin turnout cited above are very low compared to the impression gathered from following live streams. I’m sure the true numbers will be never known but high tens of thousands or more would be more in keeping with what I saw without being there.

German comments on youtube live stream were using the ‘m’ word for numbers. Regardless it was a very impressive demonstration and a high point of the gathering fight back.

Nertherlands and Bulgaria also had protests yesterday. And London.

73943 ▶▶ anon, replying to Basics, 5, #111 of 1428 🔗

I would agree, it honestly looked like hundreds of thousands to me

74002 ▶▶▶ Farinances, replying to anon, 2, #112 of 1428 🔗

I thought somewhere between 30-50k from the footage I saw

73997 ▶▶ Darryl, replying to Basics, 3, #113 of 1428 🔗

Shame Toby didn’t give a shout out to the London protest we need all the attention we can get to get to the Berlin numbers. This was the biggest anti Lockdown protest in the UK to date by far. https://www.youtube.com/watch?v=ncQRUu56np8

74056 ▶▶ Darryl, replying to Basics, 4, #114 of 1428 🔗

Favoured protests get their numbers inflated / unwanted protests deflated. Bit like with government pet projects they make the numbers fit with their agenda. YouTube apparently downgrade viewing numbers for videos it disapproves off as high viewing numbers equal more clicks – most people act in herds unfortunately.

74319 ▶▶▶ Basics, replying to Darryl, 1, #115 of 1428 🔗

Indy ref marches are hilarious forvthe war over the numbers. 90k claimed, police say 10k – police are skewing the figures.

All I know is Ihave had an ariel view of marches in edinburgh 12k max was claimed to be 100k.

It’s amazing what a bunch of flags and a telephoto lens can do.

Berlin live streams were in amongst it and walking backwards to the procession. It was big.

74905 ▶▶ Alexander, replying to Basics, 1, #116 of 1428 🔗

I was there, it was at least 250.000 protesters, 10x more than reported in mainstream media, biggest protest since 1989. Here is a good article about it (in german) https://multipolar-magazin.de/artikel/gedanken-zum-august-2020

73941 Harry hopkins, replying to Harry hopkins, 43, #117 of 1428 🔗

Bring out your dead!

I was thinking about past major pandemics that have plagued humanity and thought it might be pertinent to briefly compare the worst to the one we are currently faced with. Perhaps it may add some perspective to the situation we now find ourselves in..

*The Plague of Justinian.
Took place in the year 541 AD and was claiming up to 10,0000 lives per day in Constantinople. Bodies were so numerous that they were stacked inside buildings or left in the open. Over a third of Constantinoples’s residents died and the ‘plague’ (probably (bubonic) eventually spread to Europe where, according to the ancient historian Procopius, killed at least 25 million people. The actual death toll may have been much higher.

*The Black Death.
Started in 1347, probably from the east and invaded Europe. It lasted around five years, killed somewhere in the region of 50 million people which was estimated at half the population of Europe. Whole populations of towns were wiped out and it was said that the living spent most of their time burying the dead.

*The great plague of London.

This took place in 1665 and at its peak was claiming the lives of 8,000 people each week.
The wealthy fled to the countryside leaving the poor as the main victims. London’s authorities tried to contain the infected by quarantining them in their homes which were marked with a red cross. Total death rate was estimated at between 75,000–100,000—around 25% of London’s then population—before the outbreak eventually subsided and was finally extinguished by the Great fire .

*The third plague pandemic.
The first two major plague pandemics began with the Plague of Justinian and the Black Death. The most recent, the so-called “Third Pandemic,” erupted in 1855 in the Chinese province of Yunnan. The disease traversed the globe over the next several decades. The worldwide outbreak would eventually claim some 15 million lives before petering out in the 1950s.

*And now we have the 2020 major pandemic that has spread across the world at lightning speed locking us in our homes, shutting down economies and spreading fear and trepidation to billions of people. However, compared to its historical forbears this ‘plague’ really is something of a damp squib. Apparently, we can catch it or pass it on by inhalation, exhalation, touch, coughing, sneezing, and even when standing less than two meters from another person it can ‘leap’ across to contaminate. It can swim, is carried on currency, clothes, books, and, according to some, can even be transmitted by the evil eye.
This plague really is a bugger and judging by governments across the world this is a pandemic like no other and because of it we have to be locked in our homes for our own good.

The only problem of course is that this is a plague in search of a cause and indeed in search of victims. This deadly disease is notorious by its absence of dead and dying. No piles of bodies with this one. No towns or villages wiped out and barrows being pushed about to carry off those who have expired. It is unique in that no one knows anyone who has either had it, or indeed has it , save the so called Covid deaths that affect those in their eighties or over and who’s word on these are only released to us by official decree. It is called a Coronovirus, which to anybody who knows even the minimum about these things indicates that it is a ‘cold’ to varying degrees. So, we have the world locked down because there is the possibility of catching a cold..

What are we to make of it? Historical plagues were real because the dead and dying smacked everyone in the face and survivors had hard experience of the reality of it. This Covid plague does not present us with physical evidence that we can measure by experience. All we have are media assurances, dictated by government decree, that somewhere out there in the great blue yonder lies something that we cannot touch, cannot see, cannot feel, cannot smell, cannot comprehend and cannot see anyone so affected within our society. Never the less, we are constantly harangued that if we let down our guard, it will jump on us and deliver us towards a fate worse than death. In other words: this plague is real all right but it is a plague of fear, and that fear is stoked every day by a corrupt government and a compliant media..

Even with the Black death there were those who were genetically unique and naturally immune. Today, as we face this plague of ‘Fear’ there are those of us who are, in a similar vane, ‘naturally immune’.I would reckon that the naturally immune frequent places like this web site and as others have said, perhaps it is up to us to go out and appeal to those who also possess this immunity—they’re just not aware of it yet.

Plagues of the past were treated by medical ‘experts’ using bloodletting, leeches, lancing and other crude techniques which we now look back on with ridicule. Today, we are urged to wear masks, refrain from visiting our families, ceas

74041 ▶▶ RickH, replying to Harry hopkins, 33, #118 of 1428 🔗

Indeed. But you don’t have to go that far back to show up what an incredibly stupid shit-show is this pantomime. Simple fact :

Anyone my age ( mid-70s) will have lived through more than a dozen epidemic seasons of more mortality than this one!

… and (by definition) – have survived without noticing the fact.

I copped bad bouts of ‘flu in two of the real pandemics (as opposed to this political one) – so I don’t need any f.ing lectures from Cabinet idiots and their satraps, and I’m quite (actually *more*) capable – as someone in the vulnerable category – of assessing my own risks. I’ll take my chances and try to dodge any bullets – of which there are none around at present; it’s a cease-fire.

I certainly am not going to take medical risk advice from a narcissistic liar of no accomplishments other than self-advancement and bull-shit.

74234 ▶▶▶ Carrie, replying to RickH, 7, #119 of 1428 🔗

Yes, maybe we should (in our leaflet) quote the numbers who died in the UK in recent flu seasons where those number were similar to Covid deaths?

eg ‘In (year) x thousand died of flu in the UK, but we did not lock down, nor did we do social distancing, close schools or wear masks’

I also think we did to make people aware of the numbers who die daily in the UK under ‘normal’ circumstances..seems most people have no clue!

74255 ▶▶▶▶ bluemoon, replying to Carrie, 4, #120 of 1428 🔗

Absolutely. Especially for instance how many people died from pneumonia and bronchial complications last year, and how many this year.

74084 ▶▶ Harry hopkins, replying to Harry hopkins, 11, #121 of 1428 🔗

Sorry—glitch in posting!
Last paragraph in full:–

Plagues of the past were treated by medical ‘experts’ using bloodletting, leeches, lancing and other crude techniques which we now look back on with ridicule. Today, we are urged to wear masks, refrain from visiting our families, cease all methods of touching and affection, stand at least two meters apart and perform ridiculous gyratory movements in our efforts to avoid other people. All of this advice is given by today’s medical ‘experts’ complete with their plethoras of diplomas and degrees. I cannot help but think that the doctors of the middle ages might be worthy of more credibility.

74116 ▶▶▶ Nick Rose, replying to Harry hopkins, 6, #122 of 1428 🔗

This pandemic is one of government stupidity and so-called “scientists” trying to drive their own agendas. (btw, this is not meant to libel or decry those scientists who are still following scientific method using observation, data and only model as an aide, rather than as a theory)

74848 ▶▶ richard riewer, replying to Harry hopkins, #123 of 1428 🔗

The Immunity Clause.

73944 Margaret, replying to Margaret, 10, #124 of 1428 🔗

Fell through the gap so am posting this again.

Is there any mileage in asking shops and supermarkets to post the government’s list of exemptions to mask wearing at their entrances, along with links to where exemption cards can be printed off? After all, they display the mask signs but not every shop announces, like ASDA did on Friday, that some people are exempt and not everyone can hear what is said, or even wants to listen. I am aware that many people haven’t a clue about exemptions.

Some places, like railway stations carry the sunflower symbol for hidden disabilities but we were only made aware of that a few weeks ago when we enquired at our local station about maskless travel. Someone posted on here that Sainsbury’s are also selling the lanyards.

if comments in the Daily Fail are anything to go by, under the link posted here yesterday about loss of footfall, you would think that shops would be glad to do something to help themselves-many people there refusing to go shopping until masks are dropped.

kh in response to my post on the previous page says she thinks shops are too happy to wield their new power, but maybe it’s because they are terrified of breaking the rules and of litigation.

It certainly wouldn’t harm shops to explain alongside their “Must wear mask” posters that it is against the law to discriminate against disabilities and it could engender a £9000 fine.

73952 ▶▶ IMoz, replying to Margaret, 2, #125 of 1428 🔗

Not really, they are not “exemptions” they are examples of exemptions, the crucial part is the reasonable excuse (one that can be reasoned about against the use of mask).

73973 ▶▶▶ Margaret, replying to IMoz, 4, #126 of 1428 🔗

Yes, I take your point IMoz. Well then, display a poster saying that some people have a reasonable excuse for not wearing a mask then go on to list all the examples.
Or as an alternative do it by means of a question i.e. Do you have a reasonable excuse for not wearing a mask? See the list below.
As with most things, it’s all in the small print!

73983 ▶▶▶▶ IMoz, replying to Margaret, 7, #127 of 1428 🔗

That could enable arseholes to start nitpicking “you’re not on the list of reasons”… Just a poster saying that “Remember that others might have a legitimate excuse for not wearing a mask” and that’s it, is the most sensible solution that is difficult to argue with, I think.

74047 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to IMoz, 3, #128 of 1428 🔗

Yes. Northern rail is doing just that and it seems the right thing to do in my opinion. Nobody by law can question you and you only need to tell shop staff that you are exempt. No need for any more details.

74099 ▶▶▶▶▶ Margaret, replying to IMoz, 6, #129 of 1428 🔗

You are probably right. I like the poster idea. One of the points I was making above though, is that so many people are unaware that they personally could be exempt and would never think of looking on the government website for assistance. It’s those people that I want to help and “educate”. Also if people realised that they could be in breach of the Equality Act of 2010 and liable to be fined up to £9000, they might be less likely to bully a non mask wearer.

making above

74220 ▶▶▶▶▶▶ IMoz, replying to Margaret, #130 of 1428 🔗

Educating people tends to open up a whole can of worms, it’s probably safer to just say something along the lines of “see: [link to exemption examples in the SI itself]”

73957 ▶▶ kh1485, replying to Margaret, 5, #131 of 1428 🔗

Hi Margaret, I get the point that they may be “terrified” but they just seem a little too happy to enforce the rules (there’s absolutely no expression of regret – “we’re sorry for the inconvenience” type of thing). You should see the business WhatsApp page here, they’re absolutely bloody loving it.

74079 ▶▶ anon, replying to Margaret, 29, #132 of 1428 🔗

I saw this earlier

comment image

73950 MiriamW-sometimes-AlanG, replying to MiriamW-sometimes-AlanG, 31, #133 of 1428 🔗

Latest from the not-so-wild High Peak: Yesterday evening, the largest of the local Coops was faceless-zombie-city except for OH, me and a woman we know in the distance. We know she’s one of us but she’d clearly hedged her bets by wearing a loose scarf round her neck but at least she wasn’t using it as a mask. Sadly we didn’t get to speak to her but it was nice to see her face!

We didn’t get 2 yards in before a man (nutter?) shouted ‘masks’ at us. We said, ‘Excuse me?’ and he repeated, ‘Masks!’. His foul jockstrap was only over his mouth (just) and we said, ‘have you seen the guidelines?’ and he ran off. When we got to the till, we were greeted by huge smiles from 2 staff members who didn’t ask us anything (well briefed?)  We told them about the nutter and they were cross about it and apologised (needlessly). We asked why the Coop wasn’t displaying information about exemptions – something I need to get back to Customer Care about – and they said it is being regularly announced over the tannoy. (We didn’t hear it while we were there.)

Anyway, on we went to a birthday party. All rules followed, more-or-less, and we all spontaneously sang Happy Birthday to the 80-year-old birthday boy. (Hello churches!!) We were joined at our table by a friend. He’s a bit ‘out there’ but showed a good grasp of the politics. ‘Not sure how much he’s really resisting though, he wears a muzzle when he feels he has to. Anyway, our party was legal, no masks, no restrictions but if you enter the nearby chippy (1 in, 1 out) you have to wear a mask. Meanwhile, 5 miles away, in Marple, they are in lockdown so my real viola lesson of last Wednesday was the first and last for a while.

Earlier, a friend phoned. She follows the MSM, has a husband and daughter who buy-in to the lot, wears a mask to keep her safe but hates it yet every time I speak to her she’s getting more suspicious. They have been caught in the West Yorkshire new lockdown and, of course, like many good white middle-class people, she’s swallowed the line that it’s the South Asians’ fault because ‘they don’t socially distance.’  I put her as straight as I could,and she ended up agreeing that ‘government by Twatter’ the night before Eid is sadistic. She’s asked me for some links for information about what’s going on. Hooray, happy to oblige.

Anyway, we’ve heard a rumour that Edwina Currie, who lives locally, ‘follows Toby Young’ and ‘thinks it’s all about money and the cashless society’. If true, I wonder how many more retired Tory Grandees are keeping tabs.on us. If only they had any influence on the psychopaths currently waging war on their own people.

73958 ▶▶ Toby Pierides, replying to MiriamW-sometimes-AlanG, 18, #134 of 1428 🔗

Psychopaths indeed. I prefer “war criminals” as that runs nicely parallel to the terms they have used in their propaganda. Hopefully, we will get a chance to have a Nuremberg trials type event in the future where justice is meted out to everybody who gave or was “following” orders…

73999 ▶▶ Farinances, replying to MiriamW-sometimes-AlanG, 8, #135 of 1428 🔗

Hi Edwina if you’re reading!

I’m a great admirer of your….. shenanigans 😆

74129 ▶▶▶ Nick Rose, replying to Farinances, 4, #136 of 1428 🔗

I still eat my eggs sunny side up and runny :o))

74022 ▶▶ Tom Blackburn, replying to MiriamW-sometimes-AlanG, 22, #137 of 1428 🔗

Interesting that I’ve not had a single word said to me (re no mask) by anyone. One might surmise that these individuals choose their targets selectively ie bullies. I’m actually itching to fire off a polite ‘go fuck yourself’ – alas the opportunity hasn’t presented itself as yet.

74038 ▶▶▶ MiriamW-sometimes-AlanG, replying to Tom Blackburn, 7, #138 of 1428 🔗

As I said, we think he was bonkers and I can assure we don’t present as victims 🙂 . When we challenged him he ran off anyway.

We’ve had no trouble elsewhere and the Coop staff were friendly and didn’t even ask. What was funny was that his mask was round bis chin and he was not the only one not wearing them ‘properly’ in the store!

74119 ▶▶▶▶ Old Mum, replying to MiriamW-sometimes-AlanG, 6, #139 of 1428 🔗

I’m not large or hairy 😁 but no issues either – been into Tesco & Sainsbury’s, large & small stores, then went into town today – The Body Shop – 2 very sensible (maskless) ladies, M&S – just one maskless lady at the self-service till with a small child & Superdrug, no problems. Disappointed, like others here, at the mass compliance of everyone & the amount of people walking just in the street in masks 🤨

74048 ▶▶▶ Awkward Git, replying to Tom Blackburn, 6, #140 of 1428 🔗

Nor me.

Maybe because I’m a goon to seed rugby player build, fat, hairy and pissed off biker who likes wearing leather when I can.

No tattoos or beard though – tattoos because I never saw one I liked and beard, don’t have one as wife hate them.

74061 ▶▶▶▶ MiriamW-sometimes-AlanG, replying to Awkward Git, #141 of 1428 🔗

What do you think we look like then?

74076 ▶▶▶▶▶ mjr, replying to MiriamW-sometimes-AlanG, #142 of 1428 🔗

Miriam – I am sure that you are not fat and hairy. Tom and Awkward are right though. I also am on the larger and hirsute side and no one has said a word to me either .

74097 ▶▶▶▶▶ Awkward Git, replying to MiriamW-sometimes-AlanG, 3, #143 of 1428 🔗

No idea and I won’t even try and imagine.

Just glad you’ve had no confrontations but willing and able to handle it if someone was stupid enough to start.

Years of working overseas on the drilling rigs in very, very remote places I’ve met lots of very strange people and learnt a long time ago to go by performance, not looks or perceived notions.

74125 ▶▶▶ kh1485, replying to Tom Blackburn, 9, #144 of 1428 🔗

Me neither, got glared at by a bloke the other day but I just glared back. They don’t like it back at ’em these bullies.

74131 ▶▶▶▶ Nick Rose, replying to kh1485, 1, #145 of 1428 🔗

They don’t.

74134 ▶▶▶▶▶ Mr Dee, replying to Nick Rose, 3, #146 of 1428 🔗

I always smile sweetly at the glarers. They hate that even more, haha.

74510 ▶▶▶▶▶▶ Lili, replying to Mr Dee, #147 of 1428 🔗

Me too. It really throws them.

74140 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to Nick Rose, 2, #148 of 1428 🔗

Can I just, please, stress again, we were not bullied and we are not victims! I only mentioned it because, unlike us hard cases, some people are terrified of being singled out. I meant to demonstrate that, even if someone says something, you do not have to let them scare you.

Actually it was really a non-event. The person in question was actually terrified of us which was why he just said ‘masks’ and, literally, ran off as soon as we challenged him. Like Farinances and Mr Dee, we tend to smile at masked people which may or may not disconcert them, who can tell?

Please tell me this is not a competition for who (M or F) is the most macho? 🙂

74304 ▶▶▶▶▶▶ Tom Blackburn, replying to MiriamW-sometimes-AlanG, 7, #149 of 1428 🔗

Apologies- not trying to be macho. I pooed my pants going I to Lidl the first time. Just an observation based on what people post. It seems to me the ladies are getting more hassle than the men. I would advise anyone wanting to make a stand to start with cornershops,post offices and offies.

74484 ▶▶▶▶▶▶▶ RichardJames, replying to Tom Blackburn, 3, #150 of 1428 🔗

Of course women get bullied more; it’s what bullies do. Fortunately, if you stand up to them, they run off, because that’s what bullies do, too.

74130 ▶▶▶ Nick Rose, replying to Tom Blackburn, 2, #151 of 1428 🔗

Same here Tom. I do suspect they go for those they see as easy targets. But many of those know how to look after themselves too! (And quite right too)

74135 ▶▶▶ Farinances, replying to Tom Blackburn, 2, #152 of 1428 🔗

Me neither I just get stared at and then I smile at them. Which they hate.

74282 ▶▶▶ Bart Simpson, replying to Tom Blackburn, 4, #153 of 1428 🔗

I’m from an ethnic minority so I suppose these people would not want to be accused of racism.

Plus I do have a tendency to look like a miserable git so others tend to stay away.

74493 ▶▶▶ xplod, replying to Tom Blackburn, #154 of 1428 🔗

Somewhat similar round here – Tesco Express, local Co-op, local (Cherry Lane) garden centre and no-one says anything. Occasional looks, but can’t tell if it’s wistful or accusatory. Mind you, heaving around with a crutch does seem to help! (Genuine, BTW, recent new knee!).

73951 Edna, replying to Edna, 16, #155 of 1428 🔗

Just a quick post as I’m on holiday! We’re in Cornwall in our caravan and I’m trying to pretend the world doesn’t exist… Certainly on the campsite everyone seems ‘normal’! No masks evident (though required in the onsite shop). The worst thing was the people working in the onsite cafe – we ordered fish & chips from there and it was served through a hatch, so no mask required when we picked it up. But, the poor people working inside were wearing them, whilst cooking fish & chips! And it was very hot in there. We haven’t ventured into any towns yet so I don’t know if those reports about terrified residents were how it really is.

73955 ▶▶ Templeton, replying to Edna, 10, #156 of 1428 🔗

enjoy your break most importantly. We all deserve to live, despite whats currently being rammed down our throats.

74132 ▶▶▶ Edna, replying to Templeton, 1, #157 of 1428 🔗

Thank you 🙂

74238 ▶▶ Jonathan Palmer, replying to Edna, 7, #158 of 1428 🔗

I’m at a chalet site and apart from a new social distancing sign at the entrance you wouldn’t think anything was different this year.There is zero mask wearing and social distancing.Even the local shop has no restrictions.Children are playing and everyone has guests.

74258 ▶▶▶ bluemoon, replying to Jonathan Palmer, 4, #159 of 1428 🔗

Oh lord, there’s going to be so much on FB about that! ‘don’t they know there’s a pandemic on’ ‘nobody’s wearing a mask’.
Seriously have a great time, sorry about the weather today.

74474 ▶▶▶▶ Farinances, replying to bluemoon, #160 of 1428 🔗

I swear to god there people sat in their back gardens in Manchester having a house party whilst going on facebook and posting this shit

Like the sodding Karen who won’t send her kids back to school but is perfectly happy to take them to a crowded beach

74475 ▶▶▶▶▶ Farinances, replying to Farinances, #161 of 1428 🔗

Also like the douchebags beating up on Cummings who knew very well they’d been breaking the rules themselves.

We’re all hypocrites basically.
Except us :o)

74331 ▶▶▶ Farinances, replying to Jonathan Palmer, 2, #162 of 1428 🔗

See this is it. NOBODY CARES because we all know it’s bullshit. As long as you signal virtue in the right places (supermarket) you can act as you please. And people know it.

73956 Dave #KBF, replying to Dave #KBF, 30, #163 of 1428 🔗

Dave from Essex, one of the people who has submitted a short video to Anna Brees YT channel is aged 70yrs, has various medical conditions including a brain tumour.

He says he feels like The NHS has closed for him, and feels that either authorities want him to die naturally or he has thought about taking his own life.

What a mess we are in, I am sure that if this chap feels this way how many more do?

https://youtu.be/iiwKjU1XU8I

73996 ▶▶ Farinances, replying to Dave #KBF, 15, #164 of 1428 🔗

That video was sad when he started saying that killing himself is “an option”.

I’d like to sit Matt Hancock in a room, have him watch that video and film his response. I suspect the result would change a lot of hearts and minds.

74054 ▶▶▶ Awkward Git, replying to Farinances, 10, #165 of 1428 🔗

That guy is not alone. I read the other day suicides in the US are now higher than covid-19 deaths, will have to re-check to see if I remember correctly.

My wife is getting very despondent and friends of mine are on the verge of losing everything as tenants not paying rent and cannot be evicted, businesses got or cannot pay back the bounce back loan so going bankrupt.

74106 ▶▶▶ Darryl, replying to Farinances, 10, #166 of 1428 🔗

I honestly don’t think many of those in power at the highest level have any empathy. They don’t seem particularly upset over civilian casualties in illegal wars (Tony Blair). Many sadly get to the top by lying and backstabbing.

74121 ▶▶▶▶ Farinances, replying to Darryl, 15, #167 of 1428 🔗

Matt Hancock is a potential psychopath for sure. I think his response to such a video would show this pretty explicity
(There wouldn’t be one. He would probably roll out that sickening smirk of his)

74146 ▶▶▶▶▶ anon, replying to Farinances, 13, #168 of 1428 🔗

he sold his soul.

i work with prats like hancock.

nothing behind the eyes.

74153 ▶▶▶ annie, replying to Farinances, 2, #169 of 1428 🔗

Are we to give Matt the Death the same option?

74230 ▶▶▶▶ Cheezilla, replying to annie, 2, #170 of 1428 🔗

His should be much slower and excruciatingly painful!

74368 ▶▶▶▶▶ Bart Simpson, replying to Cheezilla, 1, #171 of 1428 🔗

Death by a thousand cuts?

74370 ▶▶▶▶▶▶ anon, replying to Bart Simpson, 1, #172 of 1428 🔗

that’s roughly what is being inflicted upon now it would seem

74527 ▶▶▶▶▶▶▶ Bart Simpson, replying to anon, #173 of 1428 🔗

Indeed!

74623 ▶▶▶▶▶ Binra, replying to Cheezilla, #174 of 1428 🔗

I see him as hollowed out and possessed – or if you prefer a muppet.

74643 ▶▶▶▶▶ richard riewer, replying to Cheezilla, #175 of 1428 🔗

Alex, A Clockwork Orange.

74426 ▶▶▶▶ RichardJames, replying to annie, 4, #176 of 1428 🔗

In the dim and distant past, there was a very nasty serial rapist/home invader in our area. I used to pray every night, and mean it, “Dear God, send him to me…”

I am much older now, but I am still available. I also am very cheap; I am happy to work for nothing, for deserving cases. I have a chair ready for a certain Professor in particular.

74091 ▶▶ Cruella, replying to Dave #KBF, 19, #177 of 1428 🔗

I think this will be a very common scenario. Doesn’t it feel like the NHS is closed? This is a return to pre NHS availability, quite literally. The NHS has not been saved it has been destroyed. This is why I am so livid everyday. The complete abandonment of our duty to the vulnerable and those in need without justification. Many people are going to die because of this, how can this be happening? A government inflicted assault on the people of this country. What is happening?

74117 ▶▶▶ Farinances, replying to Cruella, 6, #178 of 1428 🔗

This is one thing I think Corbyn may have been better on. His party is so in hock to NHS worship (irony!!) that I can’t see them switching the NHS off for this long. Whereas the Tories don’t seem to give a fuck, but are disguising that by saying they’re ‘protecting’ it. Ironically they probably started off with precisely that thought when they were shitting themselves about capacity but now…. It’s all gone off the boil. And weirdly everyone, includes Corbynistas, seem to be congratulating them for it. They’ve destroyed the NHS whilst ‘protecting’ it and the people who love the NHS seem to love them for it.

The whole situation is well…
EXTREMELY Ironic to say the least.

74632 ▶▶▶▶ Binra, replying to Farinances, #179 of 1428 🔗

I remember the NHS – amazing what can be restructured under PPP – while keeping a masking appearance of seeming to exist while being morphed into the CHS. Expect screen doctors to link with apps on your phone or wristband or implant. If you have the credits you get bio-genetic individual attention but if you are insider insider you will have a personal homeopath like old man Rockefeller.

74120 ▶▶▶ Farinances, replying to Cruella, 5, #180 of 1428 🔗

Thinking about it though what Better way to make sure we all get tested/jabbed. No in person service unless you do.

Something for the autumn then. 😣

“In person GP appointments restored!
Safety guaranteed because everyone will get a free test and vaccine whilst they’re there!”

Like… actually. That’s evil genius.

74142 ▶▶▶ Nick Rose, replying to Cruella, 1, #181 of 1428 🔗

I know I want my tax money back. Every last penny from the day I first paid it.

74164 ▶▶▶▶ Fed up, replying to Nick Rose, 8, #182 of 1428 🔗

in addition, I want every single one of my claps back. So angry with myself that I fell for the Vera Lynn old timie propaganda. Took about 5 weeks for the penny to drop. Been angry ever since and annoying all around with my granny-killing ways. It’s exhausting and some mornings I wake up fearing that we will never have the satisfaction (pretty small in the context of the carnage) of saying-told you so!

74241 ▶▶▶▶ Cheezilla, replying to Nick Rose, #183 of 1428 🔗

Sorry. It’s been used to pay backbenchers to stay home and do nothing.

74243 ▶▶▶ stevie119, replying to Cruella, #184 of 1428 🔗

I think the whole thing should be burnt to the ground. Then scatter diesel to prevent regrowth and build a new one somewhere else.

74141 ▶▶ Nick Rose, replying to Dave #KBF, 10, #185 of 1428 🔗

My anger for the vile bastards behind all this, whether government, SAGE, whoever, is starting to burn as hatred.

74154 ▶▶▶ annie, replying to Nick Rose, 4, #186 of 1428 🔗

Join the club.
Or rather, the battalion.
THEY will pay.

74648 ▶▶▶▶ richard riewer, replying to annie, #187 of 1428 🔗

‘You had your way, now you must pay’…

74659 ▶▶▶ Binra, replying to Nick Rose, #188 of 1428 🔗

Acknowledge THAT you have feelings and own what is your experience rather than give your power and freedom away, but note that hatred is very unlikely to reach its target but will poison you and leak into your relationships. So for what it is worth I feel for your experience as from time to time I also feel very disturbed.

One way of looking at this is as a profound cognitive dissonance – or indeed loss of capacity to recognise or relate to anything real. This is recognised in some who have lived extreme trauma and who literally lose their capacity to recognise anything when triggered.

Fight, flight or freeze. The first two have some movement through which to grow but a frozen or locked down mind is frozen in a torment they cannot move in or under and are simply compelled by fear. Fear may have a different narrative as insiders are privy to some of what is being enacted (ie they don’t fear a virus).

So who or what is behind all the acquired assets, crisis actors or proxies that are played by carrot and stick?

Or to look at it the other way – by what means are human beings corrupted, conflicted, compromised and betrayed even in their attempt to save themselves?

Fear of pain of loss given power by deceit?
If that is so – and we hate it in ourselves, do we not need to free our mind from deceit? Perhaps it is right that it sickens us to the point of refusing to listen and think in its frame as a command within our being rather than further conflict.

74379 ▶▶ Bart Simpson, replying to Dave #KBF, 5, #189 of 1428 🔗

This video is really sad especially after he says that taking his own life is something he’s considering.. The government and Sage should be locked in a room and made to watch it 1 million times or unless it enters into their thick skulls how much they have damaged this country.

Ditto the lockdownistas.

73966 ▶▶ Tenchy, replying to A. Contrarian, 8, #191 of 1428 🔗

Apparently it came from a wet market in Wuhan. This wet market is a stone’s throw away from a virus lab:

https://en.wikipedia.org/wiki/Wuhan_Institute_of_Virology

If it had emerged from a fishmonger’s in Porton, Wiltshire, I think the finger would have been pointing at Porton Down almost from the word go. But the Wuhan Lab – nah! couldn’t have been.

Read the above Wikipedia article, and see how this enormous coincidence is described as a “conspiracy theory”. LOL.

73991 ▶▶▶ Farinances, replying to Tenchy, 6, #192 of 1428 🔗

There is no way it came from anywhere other than that lab.
It is just too coincidental that the lab is in Wuhan. (And they don’t sell bats in that market 😉 )

74051 ▶▶▶▶ A. Contrarian, replying to Farinances, 2, #193 of 1428 🔗

So do the govt know this? Is that why they panicked so much? Seems like a good explanation to me.

74256 ▶▶▶▶ Cheezilla, replying to Farinances, 1, #194 of 1428 🔗

US lab. See my post above.

74673 ▶▶▶▶ Binra, replying to Farinances, 1, #195 of 1428 🔗

If this is a bioweapon it is a dud. As a psyop it is ‘working’ – every part of it is crafted including the wet market.
The core objective is to restate the fear of the virus as the basis for leveraging what is left of human consciousness into a new era of biosecurity (sic).

74057 ▶▶▶ Awkward Git, replying to Tenchy, 5, #196 of 1428 🔗

The virus lab was owned by a company that had Gates and Soros as major investors – Wuxi was the company’s name.

74253 ▶▶ Cheezilla, replying to A. Contrarian, 2, #198 of 1428 🔗

Excerpt from here: https://therealslog.com/2020/07/25/the-saturday-essay-the-best-whodunnit-hypothesis/

Time now to go back to the birth of Covid19, and ask the simple question: who was the father?

I spoke to 13 experts in the field at the time. Five thought it was the result of natural evolution, five thought it was produced in a US Lab, and three didn’t know. Interestingly, nobody thought it was a Chinese bio-weapon.
The factor persuading those who thought it was US made were the alleged ‘three AIDS-like spikes’ in its RNA: nobody, they argued, had more expertise than the US in working with AIDS. Indeed, arrests were made last January of Chinese and US citizens supposedly trying to export samples to China. The reaction of those who felt strongly Beijing had not developed Covid19 as a weapon was based on (a) their disbelief in such PRC bioweapon expertise and (b) simple reasoning – why develop a weapon against the West and than dump it onto your own people?
There remains, of course, the possibility that the Chinese released the drug by accident…..C19 did originate in Wuhan market, not far from a PRC bioweaponry lab. However, one argument strongly against that idea is the draconian, mass-panic bewilderment that the Chinese authorities displayed in the early days of the outbreak: this had all the hallmarks of a régime that didn’t know what it might be up against – and indeed, thought it might well be under attack.
In fact – bizarre as this may seem – the evidence favouring a US-run operation is more compelling:

  1. Washington had motive – China was playing dirty and talking tough on a trade deal which, if it didn’t materialise, could have serious cost and parts supply ramifications for the US
  2. The American led central banking system was already nervous about very high debt levels and a Dow index artificially inflated out of all proportion by years of overt and covert QE. Those running the system were badly in need of a patsy to explain the inevitable collapse
  3. Washington had the means. In the months leading up to the outbreak, further ‘SARS-like’ pandemics were a hot-topic at summits, at Davos, and at game-plan meetings organised by the Bill Gates Foundation. This seems odd, given that there hadn’t been an outbreak since 2008. At the State visit of Trump to the UK in June, the CEO of Big Pharma giant GSK is seen preening herself at top table right next to the President
  4. Washington had the opportunity. From October 18th-28th, the World Military Games was hosted by China…. in Wuhan. The American team was housed in a hotel just 200 yards from the Market were ‘patient zero’ is thought to have been. Some have rubbished this theory by saying that ‘the dates don’t fit with the Covid outbreak’. But there is plenty of evidence to suggest that the PRC kept the outbreak under wraps for longer than was initially thought….and asymptomatic carriers, we now know, can be incubating the virus for up to 23 days. More than a dozen athletes came forward at the time to report Covid-like symptoms.
  5. When Beijing laid out the likelihood that US athletes “brought the virus with them”, Secretary of State Mike Pompeo begged the Chinese not to go to the media with this theory. When it did become known, the Pentagon criticised the allegations, calling them “false and absurd.”
  6. But they are far from absurd. The US Games team was housed at Fort Kedrick where there is also one of America’s leading bio-weaponry labs. On August 5th 2019 the New York Times reported that ‘safety concerns at the prominent military germ lab have led the government to shut down research….In a statement, the C.D.C. cited “national security reasons” as the rationale for not releasing information about its decision’. Here we have a secret bioweapons lab being hastily shut down….and yet the statement about it comes from Dr Fauci’s very own Centers for Disease Control.
74333 ▶▶▶ A. Contrarian, replying to Cheezilla, 1, #199 of 1428 🔗

I didn’t know about the US theory, thanks.

74354 ▶▶▶▶ Cheezilla, replying to A. Contrarian, 1, #200 of 1428 🔗

It’s been around for several weeks.

73960 A. Contrarian, replying to A. Contrarian, 18, #201 of 1428 🔗

So WHO are now begging us not to go back into lockdown. Perhaps they should have thought a bit harder back in March when they were threatening countries that didn’t go into lockdown…

73980 ▶▶ IMoz, replying to A. Contrarian, 17, #202 of 1428 🔗

I’m starting to think Trump was right: get rid of the lot of them—they carry absolutely no liability for their words, yet they expect others to blindly obey

73989 ▶▶▶ Farinances, replying to IMoz, 9, #203 of 1428 🔗

This is one thing that he is 100% correct on.

74050 ▶▶▶ A. Contrarian, replying to IMoz, 3, #204 of 1428 🔗

I can’t think of a single positive or useful thing they have said or done since this first began back in January.

73994 ▶▶ mjr, replying to A. Contrarian, 9, #205 of 1428 🔗

Clearly the Chinese are now worrying that the Western economies are so knackered that no one will buy their tat anymore so WHO have now been instructed by their masters

74031 ▶▶▶ IMoz, replying to mjr, 1, #206 of 1428 🔗

If you go to WHO’s contributors page and compare the entirety of China with Bill & Melinda Gates Foundation you might be surprised — https://open.who.int/2018-19/contributors

74046 ▶▶▶▶ mjr, replying to IMoz, 1, #207 of 1428 🔗

It’s not the money. Gates might be large financial contributors (as were the US government) but the political clout is via the third world states who are now in hock to the chinese via the Belt and Road initiative

74071 ▶▶▶▶▶ IMoz, replying to mjr, #208 of 1428 🔗

You think so? I’d do some background reading on the guy who’s leading WHO now 😉

74098 ▶▶▶▶▶▶ Awkward Git, replying to IMoz, #209 of 1428 🔗

Isn’t he a raving communist agitator?

74101 ▶▶▶▶▶▶ mjr, replying to IMoz, 4, #210 of 1428 🔗

Old Tedros… from Ethiopia.. A third world state in hock to the Chinese.
Ethiopia has taken massive loans from China, estimated to be more than $12.1 billion since 2000.
According to the China-Africa Research Initiative African countries owe China about $130 billion .”
source
But yes – i think we can agree that WHO are being massively influenced

74110 ▶▶▶▶▶▶▶ IMoz, replying to mjr, 1, #211 of 1428 🔗

Read his history in Ethiopia

74109 ▶▶▶ Farinances, replying to mjr, 1, #212 of 1428 🔗

Lol you have a point

74144 ▶▶ Nick Rose, replying to A. Contrarian, 1, #213 of 1428 🔗

I’m more than happy to comply with that bit of begging.

74488 ▶▶ JulieR, replying to A. Contrarian, 4, #214 of 1428 🔗

I was discussing the lockdown with my teenage daughter yesterday and she naively said “But why would the government ruin the economy?” I said that they didn’t care about ordinary people, none of them are going to lose jobs and they probably benefit in some way we don’t know about. What is the better way to explain the government’s actions?
She is on social media and believes lots of misinformation.

74711 ▶▶▶ Binra, replying to JulieR, 1, #215 of 1428 🔗

Firstly, it is already ruined – but kept on life-support.
Insiders anticipate and even orchestrate big Crashes. The ability to hold back a Financial System Crash so as to mask it in a pandemic is to make even more of a control grab than simply buying up assets for peanuts. Insiders anticipate and even orchestrate wars. The ability to mask major shifts of geopolitical restructuring in a ‘moral obligation’ to sacrificial slaughter and destruction is also to draw a line under a past that is no longer returnable to as ‘a forgotten and lost ‘normal’.
This is a so called ‘soft war’ but pain and loss will not be soft so much as masked in narratives of masking denial.
It may not be yours to change her mind or anyone else.
And if she is not ready, this view of the world is more disturbing than a war on a virus (sic).
The gov is Gated – its a PPP.
Only in fairy tales do politicians do more than rubber stamp any important regulatory dictates.
So as it is going down anyway, its is being used to make covid as a ‘must be real’or they wouldn’t do such a drastic thing’, but this is exactly backwards.
The corporate realm is being restructured and the micro-economy shut down such as to only be opened again as part of the bio-metric Internment of Things.

73961 Mr Dee, replying to Mr Dee, 3, #216 of 1428 🔗

In their table-top wargame, was Boris playing the side commanded by Lord Skrolk, Plaguelord of Clan Pestilens? Or was that Rishi?

74212 ▶▶ Steve, replying to Mr Dee, 2, #217 of 1428 🔗

Skaven are positively sane and rational compared to our government.

73963 Templeton, replying to Templeton, 9, #218 of 1428 🔗

Am curious about HCID on gov.uk website.

Status was taken off Covid from mid March and has NEVER been changed, despite additional comment on the page regarding “government’s response”

https://www.gov.uk/guidance/high-consequence-infectious-diseases-hcid

The reason I ask is surely this is a very good base to start off with talking to “others” about this shitshow, along with the actual mortality rate (and its obvious overestimations)?
Ive tried to start a couple of conversations with long standing friends and am just getting stonewalled with “harder lockdowns” or “idiots at the beach”.
Its really hard to enter discourse lately and really need to find those “light-switch” bits of data that get people thinking for themselves.

73967 ▶▶ Sarigan, replying to Templeton, 9, #219 of 1428 🔗

I read somewhere at the beginning of all this that it was lowered so people could be treated in standard hospitals. HCIDs have to be treated in specialist isolation units of which there are very few.

Sadly, I do not think it is the ‘golden bullet’ we hope for.

73970 ▶▶▶ A. Contrarian, replying to Sarigan, 2, #220 of 1428 🔗

Yes, I remember reading the same thing, although I think it was also considered not deadly enough to be on the list anyway.

73977 ▶▶▶▶ Margaret, replying to A. Contrarian, 1, #221 of 1428 🔗

Yes, it said it was because mortality was low.

73981 ▶▶▶▶ Sarigan, replying to A. Contrarian, 2, #222 of 1428 🔗

The HCID list has some scary shit on it, poor little COVID would never make the grade,

74260 ▶▶▶ Carrie, replying to Sarigan, #223 of 1428 🔗

Offlands, does Mason Mills have anything to say on all this, that you feel able to reveal?

74559 ▶▶▶ Templeton, replying to Sarigan, #224 of 1428 🔗

Thanks for clarifying Offlands

74727 ▶▶▶ Binra, replying to Sarigan, #225 of 1428 🔗

I read it as a legal defence. Once the shock effects the leverage the headline is retracted or modified to leave the reactor holding the baby.
The fact that it restated complying with all gov covid regs on the same page has nothing to do with the fact that the basis for the regs has just been removed. Conforming to gov regs is in some cases not law but guidelines that were taken further by certain lockstepped actors that then set the public expectations that the gov could plausibly deny responsibility for.

74016 ▶▶ RickH, replying to Templeton, 6, #226 of 1428 🔗

those “light-switch” bits of data that get people thinking for themselves”

… but … but … but … ‘thinking’ is precisely what brainwashing eliminates. That is it’s purpose.

74024 ▶▶▶ RickH, replying to RickH, 2, #227 of 1428 🔗

And yes – you are right. Quote :

“A s of 19 March 2020, COVID-19 is no longer considered to be a high consequence infectious disease ( HCID ) in the UK.”

Note the date!!!!!

74201 ▶▶▶▶ Carrie, replying to RickH, #228 of 1428 🔗

That’s going to be their defence, when there (inevitably) is an enquiry…

74261 ▶▶▶▶ Cheezilla, replying to RickH, 2, #229 of 1428 🔗

Malcolm Kendrick suggested it was removed to avoid later legal implications – ie they were covering their backs.

74075 ▶▶ Awkward Git, replying to Templeton, #230 of 1428 🔗

Here is an e-mail from May that I sent to my MP:

From what I can tell it is all very strange or I have all my dates wrong.

What it says in the coronavirus Statutory Instrument which came into force on or about the 26th March 2020 is:

Serious and imminent threat declaration

3. —(1) These Regulations apply where the Secretary of State declares, by notice published on http://www.gov.uk , that the incidence or transmission of Coronavirus constitutes a serious and imminent threat to public health, and that the incidence or transmission of Coronavirus is at such a point that the measures outlined in these Regulations may reasonably be considered as an effective means of preventing the further, significant transmission of Coronavirus (“serious and imminent threat declaration”).

(2) The Secretary of State may revoke a serious and imminent threat declaration by way of a subsequent notice published on http://www.gov.uk .

(3) Before making a declaration under paragraph (1), or revoking a declaration under paragraph (2), the Secretary of State must have due regard to any advice from the Chief Medical Officer or one of the Deputy Chief Medical Officers of the Department of Health and Social Care.

The statement relating to the above was issued and posted on the gov.uk website but without fanfare or any notification given on 10th Feb 2020 and amended 25th Feb 2020 which is about 6 weeks prior to the quick draft emergency legislation being read in Parliament .:

https://www.gov.uk/government/news/secretary-of-state-makes-new-regulations-on-coronavirus

Then surely the announcement about downgrading of Covid-19 on March 19th 2020 which says it is no longer a high consequence infectious disease which makes the Coronavirus Statutory Instrument unnecessary and therefore null and void illegal as it is no longer “serious and imminent threat” :

https://www.gov.uk/guidance/high-consequence-infectious-diseases-hcid#status-of-covid-19

The forced imprisionment of the nation started on the 23rd March 2020 – prior to the commencement of the Statutory Instrument supposedly giving the Government the powers to lock us all up.

Why this order of things?

Why put the announcement on an obscure page of gov.uk without any fanfare etc and with nothing on the MSM sites?

Where is the guidance from Whitty, Vallance et al as reffered to in teh S.I.? At this time everyone in Government was saying it was all OK, no problems.

The only thing that amkes sense is it was all written planned and prepared in advance, scientists/medics who make the HCID decision (politicians were not involved in this decision making apparently) were telling us something that they will not say out loud but due to the lowering of education standards to the lowest common denominator no-one inoticed that it was all done in the incorrect order.

To me it should have been:

– declare the disease high consequence

– introduce legislation

– issue the imminent threat notice

– introduce the population imprisionment

– downgrade the disease

– lift any restrictions

What we have here is:

– issue declaration of imminent threat

– downgrade the disease

– introduce the population imprisionment

– introduce legislation

Is it me or something stinking to high heaven?

73976 Ned of the Hills, replying to Ned of the Hills, 20, #231 of 1428 🔗

Only slightly- not 2%. And the article explains it’s slightly up in Scotland.

But the article also says:-

“Compared with last year, footfall in England across all retail destinations remains 37.8 per cent lower”.

The whole masking policy I’m sure was principally intended to get footfalls back to the level they were. And early indications are it isn’t working. I’m certainly foot-falling less because the nearest shop to me has banned me for not wearing a mask.

73979 ▶▶ Lockdown Truth, replying to Ned of the Hills, 11, #232 of 1428 🔗

I think the masking policy is doing exactly what they wanted.

73982 ▶▶▶ kh1485, replying to Lockdown Truth, 8, #233 of 1428 🔗

My head is struggling to cope with all this (probably overdosed on inhaling the bloody gloop). Are you saying that the gov’t want the High Street to collapse, while pretending the exact opposite?

74015 ▶▶▶▶ Lockdown Truth, replying to kh1485, 19, #234 of 1428 🔗

I don’t think they care at all about the high street.

If they cared about reducing people’s fear they would remove the hazard signage from press conferences and start a clever campaign to reduce fear. They have done nothing remotely like that.

They still want people to be scared. I don’t know why. But they do. They do not care about the economy.

74039 ▶▶▶▶▶ Farinances, replying to Lockdown Truth, 3, #235 of 1428 🔗

They care about money being spent (flow of cash- which will eventually, they hope, make them look good)
They don’t care about the real economy (jobs and businesses- GDP will still be through the floor)

74044 ▶▶▶▶▶▶ A. Contrarian, replying to Farinances, 8, #236 of 1428 🔗

Yes. That’s why the first thing they have done in the new local lockdowns is to ban households from meeting – because that doesn’t make money. You can still however go to the pub or to a restaurant and spend your money there. Money first, people’s mental health and happiness later.

74107 ▶▶▶▶▶▶▶ Farinances, replying to A. Contrarian, 6, #237 of 1428 🔗

Exactemundo.

My theory that they don’t want people talking in private is a bonus but now I feel their primary motive is money (the spending of). Of course it is. It always is.

74199 ▶▶▶▶ Carrie, replying to kh1485, 4, #238 of 1428 🔗

Yes, they want you to buy online, so all your purchases are done by card, and therefore cash becomes unnecessary. Also means they can track people’s purchases and only the big players like Amazon will survive..
But for the moment they are pretending otherwise..

74545 ▶▶▶▶▶ Lili, replying to Carrie, 2, #239 of 1428 🔗

90% of my spending is now cash at our local outdoor market and soon to be car boot sales. I need some gardening tools so rather than B&Q (cards only) it will be cash at the car boot; and no muzzles.

74752 ▶▶▶▶ Binra, replying to kh1485, 1, #240 of 1428 🔗

First its a Gated Gov – a PPP. So it is acting in wider Corporate interests under various narrative ‘targets’ See World Economic Forum and Agenda 21.
And yes the Orwellian does the thing it says it is saving from. This happens over and over and over but few see it.
The replacement with Internet is bringing into a realm of systemic control.
NONE of this lockdown thing would have been feasible prior to the Internet being ready. the rehabilitation to the Internet is a further step of displacement and alienation from the land which once we knew our belonging to.
Don’t forget your heart! Discerning and navigating madness is calling for an honesty of being.This is what fear rules out – unless we face fears, keep breathing and learn to feel our way while also recognising logical inconsistencies. yes its insane. Tha fact you can recognise it is some part of you that isn’t insane. grow what you have – or what you appreciate, appreciates.

73984 ▶▶▶ Dave #KBF, replying to Lockdown Truth, 8, #241 of 1428 🔗

Showing people to be generally compliant, even if they should not be wearing masks due to pre existing breathing difficulties?

I have seen people who clearly should not be masked, wearing masks and possibly they are going to feel the results later.

73992 ▶▶▶ Ned of the Hills, replying to Lockdown Truth, #242 of 1428 🔗

What would you say was that intention? I think it is also intended to limit the spread of the virus – that’s also clearly the government’s line. I believe it possibly will but at the cost of generating such a climate of fear any gain will be more than cancelled by the negative effect the fear produces.

74013 ▶▶▶▶ RickH, replying to Ned of the Hills, 3, #243 of 1428 🔗

I believe it possibly will “

.. at about the same level of probability that is, in practice, indistinguishable from wearing a rabbit’s foot – which is far better for you in terms of harm and discomfort caused.

74268 ▶▶▶▶ Cheezilla, replying to Ned of the Hills, 3, #244 of 1428 🔗

The government know there’s no virus left to be spreading. Climate of fear is exactly what they want.

74265 ▶▶▶ Cheezilla, replying to Lockdown Truth, 3, #245 of 1428 🔗

Yes. More online shopping – cashless transactions. Can’t blame lockdown you were free to use the real shops ……

74027 ▶▶ Drawde927, replying to Ned of the Hills, 7, #246 of 1428 🔗

I’ve done all my non-food shopping online since the mask rule, and keep even my food shopping to the minimum of trips – I’m far more wary of going out now than I ever was in March (not that I was ever particularly worried about infection, more about being shouted at by some busybody for not social distancing enough)

74108 ▶▶▶ Farinances, replying to Drawde927, 7, #247 of 1428 🔗

Ironic isn’t it. Masks are supposed to make people feel more comfortable but the likes of Cressida Dick have ensured they won’t. Even if they wear them.

74145 ▶▶ Nick Rose, replying to Ned of the Hills, #248 of 1428 🔗

Brick falling maybe?

74219 ▶▶ Steve, replying to Ned of the Hills, #249 of 1428 🔗

Hard to say if this is having an effect on footfall or not. Tuesday and Friday seemed to be roughly as normal deliveries wise in our store. Wednesday and thursday were very quiet, although that could just have been because it was the last week of the month before people got paid on the friday. Saturday was completely dead though.

73987 John Ballard, replying to John Ballard, 34, #250 of 1428 🔗

Over 50s to stay home the latest scare story. Well I like millions of others I imagine will be ignoring that completely. Does this maniac wish to destroy the country?
Where are the politicians with enough brain to question the stats? Surely they can not all be so scared of Boris to point out the errors and stupidity?
Where are the big business owners who are having their businesses destroyed?
Why are they not leading the fight against this maniac and his cock of a sidekick?

73995 ▶▶ Victoria, replying to John Ballard, 8, #251 of 1428 🔗

Agree. Where is big business?

74006 ▶▶▶ anon, replying to Victoria, 10, #252 of 1428 🔗

(psssst… I think they might be in on it)

74429 ▶▶▶▶ RichardJames, replying to anon, 3, #253 of 1428 🔗

Yes; this lockdown is designed to remove all the entrepreneurial small businesses, leaving only the conformist monopolies.

74626 ▶▶▶▶▶ Kristian Short, replying to RichardJames, 2, #254 of 1428 🔗

Absolutely. You can’t lockdown the crony capitalist system without the help of the cronies.

74664 ▶▶▶▶▶ richard riewer, replying to RichardJames, #255 of 1428 🔗

Maybe. Sounds reasonable.

74757 ▶▶▶▶ Binra, replying to anon, 1, #256 of 1428 🔗

Not altogether – but when you are more insider to the way it works you are also more aware of who and what you are up against if you step out of line.
Boris is a crisis actor.

74004 ▶▶ RickH, replying to John Ballard, 1, #257 of 1428 🔗

Like you, I have a two-word answer.

But many, I fear, haven’t developed the brain and language skills required to utter two word phrases.

74072 ▶▶ Cruella, replying to John Ballard, 3, #258 of 1428 🔗

Of course all the head teachers and senior Consultants will need to keep going to work?

74089 ▶▶▶ A. Contrarian, replying to Cruella, 1, #259 of 1428 🔗

They will have exemptions as key workers, I would imagine.

74327 ▶▶▶▶ Laura Suckling, replying to A. Contrarian, 2, #260 of 1428 🔗

Of course, those of us on minimum wage or just above will be working. No sick pay and the £90 per week SSP is meant to keep us alive so we can just go back to the front line ASAP.

74967 ▶▶ NickR, replying to John Ballard, 1, #261 of 1428 🔗

It doesn’t help if you over dramatise this. The people who may be advised to shelter will be over 50s with serious illness or who are obese. I don’t think anyone is suggesting all over 50 get put under house arrest. This is just conspiracy madness. No organisation with more than 50 people can ever manage a conspiracy, it’s always cockup.

73988 Victoria, replying to Victoria, 8, #262 of 1428 🔗

America’s Frontline Doctors shred government coronavirus narrative, exposing it as “massive disinformation campaign”
“The medical deep state is hellbent on withholding the hydroxychloroquine-plus-zinc treatment option from the general public for as long as possible, all to ensure that remdesivir, in which Fauci has a direct financial stake, as well as the slew of vaccines currently in development by Bill Gates and others, are what get presented as the “cures” once they are ready for release.”

https://www.naturalnews.com/2020-07-31-americas-frontline-doctors-shred-government-coronavirus-narrative-disinformation.html

Perspectives on the Pandemic: America’s Frontline Doctors
https://www.brighteon.com/afc9a48a-a551-4b24-8dc5-82a4ecf10a3f

73990 Darryl, replying to Darryl, 12, #264 of 1428 🔗

I wonder if anyone in Whitehall has noticed that the Imperial College London model has been discredited and the mortality rate is much lower than first thought. They still seem to be making decisions based on the flawed information from March.

I can only assume they have so brought into the Global Reset and Vaccination agenda their is no way they will reverse now.

74001 ▶▶ RickH, replying to Darryl, 9, #265 of 1428 🔗

Well – you could hardly not have ‘noticed’ it – along with the massive, egregious errors committed by the same team in the past.

But, having been ‘noticed’, the evidence has been totally ignored.

74010 ▶▶▶ Darryl, replying to RickH, 4, #266 of 1428 🔗

I find it hard to fathom why the government would actually admit the death rate is overstated but make so little effort to correct the figures.

It is like they actively want to promote a constant state of elevated irrational fear – a bit like after 9/11.

74086 ▶▶▶▶ RickH, replying to Darryl, 1, #267 of 1428 🔗

No?!!! I’d never have guessed!!!

74772 ▶▶▶▶ Binra, replying to Darryl, #268 of 1428 🔗

You mean an insider orchestrated controlled demolition of the global economy and social organisation of humankind on the Earth?

They are playing the belief that any of it makes sense or that those inside the narrative have any intention of engaging in dialogue. And so trying to make sense of it and thinking some sort of governance for the nation or the people is still operating delays the simple recognition of abandonment from above and being ‘sold to the Corporate sector or to locked out of social inclusion (life support).

However another way or recognising our lives is to not give power to narrative definitions – but to listen in the heart of honesty and find who you are from the life itself – rather than the conflicted futility of a world of lies seeking to become true by coercion and deceit.
Lies run in darkness and in terms of free awareness being light, conflict binds or locks up attention to effectively mask out a primary curiosity. Though you are never truly absent and could wonder instead of being driven by constantly shifting narratives that as you discern, elevate undertainty, confusion and fear at expense of clear appreciation of the nature and fact of what is happenning – on many levels – not just where the public attention is managed or a captured opposition is contained.

Perhaps ‘they’ is no more that the vector of private self-interest set in a lock-step against deep fear and pain of loss? Some are broken by fear and others are deeply defiant and enraged – but as cold calculated determination that uses the greedy and the broken as tools.

74074 ▶▶ mhcp, replying to Darryl, 7, #269 of 1428 🔗

It’s not just discredited. In any engineering profession if you let this model get out in the real world you’d end up in jail. But it seems that when applied to people’s health you can get away with blue murder

73993 Victoria, replying to Victoria, 4, #270 of 1428 🔗

Two-tiered medicine: Why is hydroxychloroquine being censored and politicized?
https://www.naturalnews.com/2020-07-31-why-is-hydroxychloroquine-being-censored.html

74000 ▶▶ IMoz, replying to Victoria, 3, #271 of 1428 🔗

HCQ is on the approved treatment protocol for all but ventilated patients in Russia (pp 10–11 cross ref. 149–150) perhaps why the CRF is a factor of 10 or there abouts smaller? :- https://static-0.rosminzdrav.ru/system/attachments/attaches/000/050/584/original/03062020_%D0%9CR_COVID-19_v7.pdf

74515 ▶▶▶ JulieR, replying to IMoz, 1, #272 of 1428 🔗

The way UK is going Johnson will be a bigger tyrant than Putin soon.

74779 ▶▶▶▶ Binra, replying to JulieR, #273 of 1428 🔗

One of them is actually capable of coherent thought. regardless what you think of him. Putin is not merely a puppet. But he is in with the medical mafia or unwilling to openly defy them. I know nothing of belarus – but that its leader proclaimed covid19 a western psychosis. I find it interesting that amidst all the drama -there is always someone given the part of disclosure – but generally one that is not accorded any validity whatsoever. For we think if we align with truth we hear from another that we endorse and support whatever else they are and say – no?

74198 ▶▶ Carrie, replying to Victoria, 4, #274 of 1428 🔗

Because if a treatment exists then in the USA it means you cannot ‘rush out’ and mandate a emergency vaccine…

73998 RickH, replying to RickH, 7, #275 of 1428 🔗

The ONS infection survey data released on July 31st showed an increase in the number of people testing positive over the past two weeks of just five.”

This is the level of scientific/statistical intelligence on display not only from government but also scientifically illiterate ‘scientists’.

Scottie!!!!!

74676 ▶▶ richard riewer, replying to RickH, #276 of 1428 🔗

What a joke !

74007 Paul, replying to Paul, 24, #277 of 1428 🔗

So a resident of Cornwall finds living there ‘horrifying’ now ?,perhaps they should go and live in Yemen or Syria for a few months and maybe Wadebridge won’t seem quite so bad.
I didn’t think I could think much less of most of the population of this country but nearly everyday one them proves me wrong.

74020 ▶▶ Wesley, replying to Paul, 13, #278 of 1428 🔗

Trust me, they don’t, it’s MSM spin. Most tourism businesses here are small and haven’t qualified for c19 support – the visitors are extremely welcome.

74123 ▶▶▶ bluemoon, replying to Wesley, 5, #279 of 1428 🔗

You’re correct – those were just comments picked up from FB by a lazy reporter.
Most of the small shops in my little town qualified for the £10k council grant for which they were very grateful I’m sure because some of them are open only part time even now. But it seems that latent xenophobia in Cornwall has surfaced.

74045 ▶▶ John Ballard, replying to Paul, 7, #280 of 1428 🔗

I live in Cornwall and it’s great when not having to follow the government stupidity. Beaches are busy but no busier than Bournemouth and that had no impact.
Cornish people are as brain washed as the rest of the country no worse just today’s news….blame Boris and the useless politicians not the county.

74062 ▶▶ mhcp, replying to Paul, 10, #281 of 1428 🔗

I live in Bournemouth. By the beach. Apart from the extra cars I don’t mind people coming down. Feels normal.

74078 ▶▶▶ RickH, replying to mhcp, 3, #282 of 1428 🔗

Good for you – after all, you’re not forced to live by the sea.

74279 ▶▶▶ Cheezilla, replying to mhcp, 1, #283 of 1428 🔗

I would have expected any beaches to be busy on a hot weekend. Will probably be much quieter tomorrow.

74082 ▶▶ RickH, replying to Paul, 2, #284 of 1428 🔗

The silly sod doesn’t seem to have grasped that the local economy is largely dependent on people doing exactly what he/she dislikes.

74160 ▶▶ Nick Rose, replying to Paul, 1, #285 of 1428 🔗

Assuming this resident isn’t a plant, I do hope they don’t need to find work outside Cornwall. “Sorry, all our jobs are for locals. Perhaps you’d best return home to Cornwall.” Where does the nonsense end???

74197 ▶▶ Carrie, replying to Paul, #286 of 1428 🔗

Who is this resident?

74332 ▶▶▶ Mr Dee, replying to Carrie, 6, #287 of 1428 🔗

It’s Tubbs. She’s relocated to Cornwall from Royston Vasey.

75763 ▶▶▶▶ David Grimbleby, replying to Mr Dee, #288 of 1428 🔗

It’s a local shop for local local erm people

74506 ▶▶ TJN, replying to Paul, 2, #289 of 1428 🔗

Well I live just inside the boarder in Devon and pop into south-eastern Cornwall to the beach regularly. It’s been pretty normal for at least two months now, except perhaps a bit busier than usual for the time of year.

Usual MSM garbage – easy to spot: just look out for the emotive adjectives, along with a lack of any data or actual evidence.

74008 T. Prince, 3, #290 of 1428 🔗

swprs.org
August update now out.For those that haven’t seen this site, it provides a range of facts,graphs and information on corona related issues at a national and international level. Updated monthly

74014 Awkward Git, replying to Awkward Git, 71, #291 of 1428 🔗

My answer to Boris for an over 50s lockdown – fuck you and the horse you rode in on.

I am now in open rebellion.

No apologies for the profanity.

74018 ▶▶ IanE, replying to Awkward Git, 17, #292 of 1428 🔗

Yup – the only positive would be that that includes Bozo!

74021 ▶▶▶ MiriamW-sometimes-AlanG, replying to IanE, 9, #293 of 1428 🔗

He and all the others have special immunity, didn’t you know? 🙂

74023 ▶▶▶▶ Awkward Git, replying to MiriamW-sometimes-AlanG, 10, #294 of 1428 🔗

Not from a piece of hemp they don’t.

74028 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to Awkward Git, 1, #295 of 1428 🔗

Fair play.

74040 ▶▶▶▶▶ Dave #KBF, replying to Awkward Git, 1, #296 of 1428 🔗

Polyester just does not have the same friction.

74067 ▶▶▶▶ PowerCorrupts, replying to MiriamW-sometimes-AlanG, 3, #297 of 1428 🔗

Highly likely to be on hydroxychloroquine, as it works accordimng to well over 200 US doctors and doctors around the world. Just don’t tell the plebs or they’ll all want it

74168 ▶▶▶▶▶ guy153, replying to PowerCorrupts, 2, #298 of 1428 🔗

Plus he’s already had Covid anyway. As have enough other people to stop it spreading.

74335 ▶▶▶▶▶▶ Toby Pierides, replying to guy153, 9, #299 of 1428 🔗

Or he went on holiday to Barbados…When a prime minister is taken gravely ill there is a protocol whereby they end up in a totally secured floor of St Thomas’s Hospital and no member of the public or any tv crews have sight of them. Can anybody prove he had it? A nice convenient publicity stunt for his new world order masters…

74196 ▶▶▶▶ Carrie, replying to MiriamW-sometimes-AlanG, 5, #300 of 1428 🔗

I think we should make and publicise a list of all MPs over 50, so that if they lock us down, we can point out how many are not isolating. We can point out to doubters than the chances of politicians having some kind of super-immunity to the virus is impossible – it will be another ‘Cummings – Barnard Castle’ moment…

74087 ▶▶▶ A. Contrarian, replying to IanE, 3, #301 of 1428 🔗

He would exempt himself as a key worker.

74165 ▶▶▶▶ Nick Rose, replying to A. Contrarian, 3, #302 of 1428 🔗

Like Jezza did when they wanted the over 70s to stay at home. Politicians exempt.

74285 ▶▶▶▶ Cheezilla, replying to A. Contrarian, 3, #303 of 1428 🔗

Worker????

74019 ▶▶ Lockdown Truth, replying to Awkward Git, 2, #304 of 1428 🔗

Lol

74029 ▶▶ kh1485, replying to Awkward Git, 2, #305 of 1428 🔗

Agree Awkward.

74035 ▶▶ Farinances, replying to Awkward Git, 9, #306 of 1428 🔗

Even my mum just said “Well screw that for a game of soldiers”

It’s the rule that could turn the Karens!!

74037 ▶▶ Dave #KBF, replying to Awkward Git, 8, #307 of 1428 🔗

I think this is just another way of putting us off the scent. Whilst we are getting outraged that us over 50s are to be locked up other things are happening and we are ignoring or missing it.

74227 ▶▶▶ Carrie, replying to Dave #KBF, 1, #308 of 1428 🔗

You are probably right, but the question is what are they trying to distract us from seeing?

74783 ▶▶▶▶ Binra, replying to Carrie, #309 of 1428 🔗

That is a very pertinent question and deserves more than a cursory consideration. You could also include your own thought habits. What is going on here that I am not seeing? And allowing a space of attentiveness and receptivity to notice what a distracted attention discards or doesnt even see.

74236 ▶▶▶ ConstantBees, replying to Dave #KBF, 4, #310 of 1428 🔗

It’s divide and conquer. In the DM, the comments section is full of young people saying the old should be locked away, and older people saying the young should be locked away since they’re troublemakers not keeping to the rules.

Seemed like the obvious tactic considering the Manchester lockdown right before Eid. Everyone went mad with some making nasty comments about “dirty Muslims” and others calling them racist. Divide and conquer, tried and tested.

First post, long-time lurker. Also left-wing refugee from the Guardian where I kept getting jumped on for expressing disbelief about the benefits of lockdown. Now very few Guardian articles allow comments, so I guess I did my job.

75208 ▶▶▶▶ Yawnyaman, replying to ConstantBees, 1, #311 of 1428 🔗

Welcome, and a very good point!

74158 ▶▶ annie, replying to Awkward Git, 4, #312 of 1428 🔗

Just try it. Just.

74405 ▶▶▶ RichardJames, replying to annie, #313 of 1428 🔗

Agreed; I dare you. I DOUBLE-DARE you!

74162 ▶▶ Nick Rose, replying to Awkward Git, 10, #314 of 1428 🔗

I have no intention of obeying it even if they bring it in.

74216 ▶▶ fiery, replying to Awkward Git, 16, #315 of 1428 🔗

I second this. I’m 60 but fitter than many people half my age, have no existing health conditions and don’t take any medication. I’ve worked in a front line service since lockdown and have no intention of being forced to stay at home by Bojo and his team of health dictators.. I don’t think I’d seek treatment if I did develop any health condition that put me at risk. I’d rather die in a ditch.

74232 ▶▶ MiriamW-sometimes-AlanG, replying to Awkward Git, 18, #316 of 1428 🔗

My husband (71) got the Extremely Vulnerable letter because he has chronic leukemia. He took no notice as he is otherwise fit and well (as am I) and we’ve carried on as normally as possible throughout the lockdown and the ‘Lockdown Lite’. We travelled on buses before the muzzle rule came in and we shop twice a week. Now we avoid public transport and yomp round the place with rucksacks or on our bikes to do our shopping and we regularly go hill-walking. From this you can deduce we are hardly delicate old plants!

If they bring this crap in we’ll carry on the same. What are they going to do, lock us all up? Despite killing so many oldies off, I think we’re still in the majority (somebody please correct me if this is wrong!)

74414 ▶▶▶ RichardJames, replying to MiriamW-sometimes-AlanG, 21, #317 of 1428 🔗

We have a friend who we visit regularly. He’s 92 yrs old. He does his shopping every morning at 07.30 hrs, as he has done for the last 20 years, and doesn’t give a s***. He invites us in (and has done so for the entire lockdown period).

Why would he care? He hasn’t caught anything, he says he’s had a great life and would rather go down than live under the successors to the Gestapo. Good for him.

74691 ▶▶▶▶ richard riewer, replying to RichardJames, 2, #318 of 1428 🔗

Record his thoughts and send it to PM Johnson.

74500 ▶▶▶ Lili, replying to MiriamW-sometimes-AlanG, 3, #319 of 1428 🔗

You sound like fantastic role models. Good on you both and may you have many more wonderful years.

75127 ▶▶▶▶ MiriamW-sometimes-AlanG, replying to Lili, #320 of 1428 🔗

Thank you – we’ll try!

74684 ▶▶ richard riewer, replying to Awkward Git, #321 of 1428 🔗

It wasn’t a horse, it was a donkey.

74017 MiriamW-sometimes-AlanG, replying to MiriamW-sometimes-AlanG, 21, #322 of 1428 🔗

Toby’s analyses of the figures is, as ever, excellent and, of course, he’s working to debunk what’s being put out there by the MSM.

However, it looks like the ‘war-games’ story was fed to the Sunday Times as an exclusive (?) and cascaded out through all the MSM. I don’t buy any of it. It’s designed so we’re all supposed to talk about this ‘war-game’ scenario and buy-in to the war-like metaphors. We are presumably meant to imagine nice girlies in uniform pushing little models of the coronavirus around a map of the country, showing where the next ‘attack’ will be coming from. Oh please!

For the Minister of ‘Health’ to tweet (tweet?) late on Thursday the news that an immediate lockdown was going to be imposed hours before Eid-al-Adha in large areas of the north with a high proportion of Muslims is cynicism beyond belief. ‘Especially when the figures don’t make any sense and do not support any such thing.

I don’t think we should believe a word of it, even at the level of believing this is how Government decisions are currently being made. If we continue believing the ‘Boris the Clown playing Whack-a-Mole’ scenario, it just makes it easier for them to keep us down. It is another massive psy-op, almost certainly straight from the SPI-B playbook, and our task is to try our best to debunk it as much as we possibly can with as many people as possible. I think Toby’s analysis will prove useful here as I am quite sure that the other scenarios may well come to pass soon.

By any means possible, we should demolish the outrageous propaganda put out by the MSM but I’m not sure about taking our cue from it. They are serving as stenographers for the spooks and must not be trusted at all, even in the way they present the propaganda.  We need to keep telling people about what’s really going on, including the real figures and what they represent in terms of danger i.e. next-to-none, to anyone, anywhere.

And I agree, never use the word ‘case’ unless somebody is actually ill!

74112 ▶▶ James007, replying to MiriamW-sometimes-AlanG, 6, #323 of 1428 🔗

I find the idea of “guillotine” decisions terrifying. I prefer the idea of contingency planning and risk analysis, based sound evidence and judgement.
Great point about the war gaming.
Treating a public health crisis as if it we were at war and under aerial attack has been disastrous.

I can see the idea, we are all supposed to ralley round the government, as if we are all facing a common enemy.

74166 ▶▶▶ guy153, replying to James007, 3, #324 of 1428 🔗

A lot of wars are actually basically the same deal (only worse): the government sends a lot of people off somewhere to kill people they have nothing against in order to defend their image and whatever lies they’ve been telling. BecJT made a good post about the Vietnam War the other day.

74114 ▶▶ bluemoon, replying to MiriamW-sometimes-AlanG, 8, #325 of 1428 🔗

There’s a long dark corridor in Whitehall for 2 departments, fully staffed with every kind of expert. One is called ‘Let’s all have a laugh up our sleeve’ and the one next door is called ‘Let’s see if they’ll buy this’.

74300 ▶▶▶ Stephen, replying to bluemoon, 7, #326 of 1428 🔗

When I read about the war games in the article I thought mainly of General Melchett with Captain Darling in Blackadder.

“Our strategy of lock downs and evicting infected people into care homes has worked so well that we need to carry on with it. The virus will never expect that.”

General Melchett was smarter than this government though.

74291 ▶▶ Cheezilla, replying to MiriamW-sometimes-AlanG, 1, #327 of 1428 🔗

Use “false” positive instead.

74297 ▶▶▶ MiriamW-sometimes-AlanG, replying to Cheezilla, 3, #328 of 1428 🔗

I do. You would(n’t) be amazed how many people have no idea just how the figures are being manipulated. My neighbour, who half-believes the crap, told me that she’s heard young people are using testing like the ‘morning-after pill’ i.e. go for a night out and then get tested just in case (?!!*) How thick is it possible to get? Oh. . . . .

74306 ▶▶▶▶ Carrie, replying to MiriamW-sometimes-AlanG, 1, #329 of 1428 🔗

And of course the government are happy about that – another load of DNA collected…

74311 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to Carrie, 1, #330 of 1428 🔗

Quite so, they’re playing into their hands, the fools.

74413 ▶▶▶▶▶▶ Carrie, replying to MiriamW-sometimes-AlanG, #331 of 1428 🔗

The problem with what passes for ‘education’ these days…

74784 ▶▶▶▶▶▶▶ Binra, replying to Carrie, #332 of 1428 🔗

Well its pretty much social engineering by design.

74025 kh1485, replying to kh1485, 58, #333 of 1428 🔗

Sorry guys, it’s a rant:

I’m in my shop. I shouldn’t be in my shop but this f%^kwit government’s mishandling of this shit-show means that through no fault of my own I have to be here. I would far rather be at home, gardening or doing the ironing. But no, I am here. I am here having to endure the toss-pot hissy-fitters who have an arse-ache because we only have five flavours of ice cream and just now, the most serious/heinous error on my part is that (and string me up for this) I did not make sufficient scones today. So, a middle aged woman has just had a strop because she can’t have WHAT SHE WANTS! Well. love, neither can I!

I mean, it’s not as if the economy has just been completely trashed, probably not to recover for several generations or that our liberty has been pissed up the wall, oh no, don’t get mad about that will you.

And ,.. breathe – sorry 🙁

74032 ▶▶ Paul, replying to kh1485, 13, #334 of 1428 🔗

I sense that sooner or later one of your lovely customers is going to be wearing the food instead of eating it !.

74060 ▶▶▶ kh1485, replying to Paul, 8, #335 of 1428 🔗

Oh, if only I could afford to do that!

74081 ▶▶▶▶ Paul, replying to kh1485, 18, #336 of 1428 🔗

I know what you mean,you could imagine it I suppose !.I frog-marched someone out of our business once for his rudeness and constant moaning about how he could get the stuff cheaper somewhere else,I took the item off him and said he should go there and get it,I was a bit less polite than that though !,he was then quickly shown the exit.The amazing thing was an hour later he came back and said would I sell him the stuff because the ‘cheaper’ place hadn’t got any !,I just slammed the door in his face.

74033 ▶▶ Dave #KBF, replying to kh1485, 7, #337 of 1428 🔗

No need for apologies, we understand.

74068 ▶▶▶ kh1485, replying to Dave #KBF, 4, #338 of 1428 🔗

Thanks. I’ll save you a scone!

74069 ▶▶▶▶ kh1485, replying to kh1485, 1, #339 of 1428 🔗

And ditto to DRW – sorry reply to wrong post – knackered and angry!

74055 ▶▶ DRW, replying to kh1485, 5, #340 of 1428 🔗

I’m sorry KH, having taken similar crap in a customer service job, I feel your pain. I’ll pay you a visit if I’m ever up your way.

74059 ▶▶ mjr, replying to kh1485, 7, #341 of 1428 🔗

Put up a sign – “Unfortunately choices are limited because of Lockdown “

74073 ▶▶▶ RickH, replying to mjr, 7, #342 of 1428 🔗

Or “If you voted for this bunch of ****s – just **** off”

74416 ▶▶▶▶ RichardJames, replying to RickH, 3, #343 of 1428 🔗

I do understand, but as my wife just said to me, look at what the other side was pushing for! Like Mr Trump on the other side of the pond, he might be rubbish but Killary would have been a nightmare by comparison. Devil and deep blue sea, I’m afraid.

74083 ▶▶ James007, replying to kh1485, 2, #344 of 1428 🔗

Have you had any more shite for running your shop in a normal non-paranoid way?

74090 ▶▶▶ kh1485, replying to James007, 6, #345 of 1428 🔗

Touch wood, no. Though the BID chairwoman has a good stare when she walks past! Am I bothered? No, couldn’t give a toss 😉

74115 ▶▶▶▶ James007, replying to kh1485, 2, #346 of 1428 🔗

Not allowed to touch wood here. That’s why the NT children’s play areas are still cordoned off
Well done for standing up for sanity

74152 ▶▶ BecJT, replying to kh1485, 31, #347 of 1428 🔗

At age 18, I worked in a pub, for a proper hard drinking, smoking, hard working bloke called Alan and his lovely but fearsome wife. Great people, great job, taught me a lot about hard graft, and getting along with people. The pub, in summer, was in walking distance of 900 static caravans. You can imagine bar service on a summer’s evening.

One day some interminable toss pot and his family came in and made a right hulaballoo about the service. They weren’t polite. My colleague and I tried to placate them, no dice. The usual, you can see how busy we are, we’d be grateful if you could be patient in the circumstances etc etc. It was hardly our fault two coach loads of OAPs and a load of caravaners had all arrived at the same time.

Called the boss, and we expected a right telling off for presenting him with an unhappy customer, it’s not like he didn’t have other things to be doing. The boss listened patiently to this man’s rant, which was incredibly rude, signalled to him that he wanted to whisper in his ear. Man leaned in, boss cupped his ear, and in stage whisper said, loud enough for everyone to hear, ‘Do I look like I need your money or something? Now fuck off out of my pub’.

Bar went quiet, man left. What angered my boss was this idiot had done it to us as we were lowly bar staff, and he knew we had no power to fight back. I really admired him for that. I think people that are rude to people they know can’t argue back, are just bullies. Nobody’s that stupid, she knew exactly what she was doing to you. Sorry that happened. Some people are just arseholes. They’re still arseholes as we go over the edge of a cliff.

74157 ▶▶ annie, replying to kh1485, 1, #348 of 1428 🔗

What a load of toads.
Stamp on them.

74171 ▶▶▶ bluemoon, replying to annie, 2, #349 of 1428 🔗

Aren’t toads an endangered species? Hmm I’m sure KH wishes some of her customers were……..

74296 ▶▶ Cheezilla, replying to kh1485, #350 of 1428 🔗

Don’t be sorry! What a bunch of spoiled brats you have to put up with. Rant away.

74401 ▶▶ Bart Simpson, replying to kh1485, 2, #351 of 1428 🔗

It’s understandable. I feel like I’m losing the will to live most days.

74026 Awkward Git, replying to Awkward Git, 2, #352 of 1428 🔗

Lynyrd Skynyrd and a song from a few years ago called That Ain’t My America.

I think I’ll ask them them to do a version with UK/England instead:

https://www.youtube.com/watch?v=TSxeyG9bi4I

74034 ▶▶ Awkward Git, replying to Awkward Git, #353 of 1428 🔗
74030 Awkward Git, replying to Awkward Git, 50, #354 of 1428 🔗

10 seconds on the Daily Fail comments – 23+, 2-.

Boris – as an over 50 my only answer to you is get stuffed – or words to that effect, the real answer’s 2nd word is off, first word 4 letters, begins in F. You have lost the plot and finally showed you are 100% well and truly following orders from an unelected government of occupation. None of the statistics make sense – only an increase in 5 meaningless positive tests means incarceration of large swathes of the north west. You are truly demented and no longer fit to lead this country, not you, your cabinet nor any MP or member of the house of lords.

74308 ▶▶ Cheezilla, replying to Awkward Git, 1, #355 of 1428 🔗

Yay!!!

74846 ▶▶ richard riewer, replying to Awkward Git, #356 of 1428 🔗

Bedlam in the early 21st Century.

74036 DRW, replying to DRW, 14, #357 of 1428 🔗

Just seen the nauseating T&T ad on UKC. I soon expect similar propaganda for the vaccine. Similar video, maybe some ‘hospital chaos’ footage added for a good old guilt trip.
Ending pitch: “Noone’s safe until we’re all safe. Just a jab, so we’re all safe together.” Massive NHS logo, #JustAJab, #AllSafeTogether captions. Repeated every break on every terrestrial channel and insufferably ubiquitous on the internet.

74042 ▶▶ Farinances, replying to DRW, 8, #358 of 1428 🔗

That video is the cringiest thing I’ve seen in a long while. And I spent a whole afternoon watching celebrity BLM videos.

74053 ▶▶▶ IanE, replying to Farinances, 4, #359 of 1428 🔗

Wow – this covidiocy is taking its toll!

74122 ▶▶▶ Cicatriz, replying to Farinances, 5, #360 of 1428 🔗

Are you a masochist?

74124 ▶▶▶▶ Farinances, replying to Cicatriz, 5, #361 of 1428 🔗

I was making a list of who to boycott in future 😉

So yes, but it was worth the pain.

74159 ▶▶▶▶▶ anon, replying to Farinances, #362 of 1428 🔗

share the list!

74173 ▶▶▶▶▶▶ Farinances, replying to anon, 5, #363 of 1428 🔗

Basically, everyone 😣

74058 ▶▶ IMoz, replying to DRW, 7, #364 of 1428 🔗

Because we all need a vaccine for a disease where 80% remain symptom free (i. e. own immunity works well against the infection) [1], and of those who are symptomatic, 95% get moderate symptoms [2]… leaveing just 1% (100-80-20*.95) of all cases as “difficult to critical”… But as today’s blog post concludes: “CAUTION! Statistics Ahead”

1. https://www.bmj.com/content/369/bmj.m1375
2. https://swprs.org/studies-on-covid-19-lethality/#hospitalizations

74085 ▶▶▶ DRW, replying to IMoz, 2, #365 of 1428 🔗

We all know that here but The Science (TM) will say otherwise!

74063 ▶▶ RickH, replying to DRW, 11, #366 of 1428 🔗

All that needs to be said is that Big Pharma has been given indemnity against legal action over side effects of any rushed vaccine.

Work the rest out for yourself before you let your brain go walkabout and become just another prick.

74077 ▶▶▶ DRW, replying to RickH, 3, #367 of 1428 🔗

Oh yes, I know what that game is alright. It’s just how I imagine it’ll be sold to the sheeple- who will probably fall for it hook, line and sinker.

74190 ▶▶▶ Carrie, replying to RickH, 2, #368 of 1428 🔗

Plus this: https://clinicaltrials.gov/ct2/show/record/NCT04460703?term=Vaccine&cond=Covid19&cntry=US&draw=2&view=record showing how you will be ‘persuaded’/nudged into accepting it…

74316 ▶▶▶▶ Cheezilla, replying to Carrie, #369 of 1428 🔗

Chilling reading.

74070 ▶▶ A. Contrarian, replying to DRW, 11, #370 of 1428 🔗

“We had the jab, because we care”. Accompanied by a picture of a lonely old granny finally being able to hug her granchildren, who have been safely inoculated. Just as with masks, non-jabbers being accused of killing people and lynched in the street. I can’t wait.

74080 ▶▶▶ IMoz, replying to A. Contrarian, 6, #371 of 1428 🔗

Who knows, with potential side-effects and exclusions of liability for the pharma there might not be that many out in the street after all…

74094 ▶▶▶ RickH, replying to A. Contrarian, 7, #372 of 1428 🔗

Don’t be conflicted :

  1. When was a vaccine necessary for a generally mild illness like this?
  2. Just ask whether a safe, effective vaccine – proved through a range of RCTs – could be developed in any quick timescale.
  3. Do you buy snake oil?:-)
74127 ▶▶▶▶ T. Prince, replying to RickH, 9, #373 of 1428 🔗

Why, according to Gates, will we need two jabs (a month apart) and a booster in a few years time? Why are people willing to accept it?

74156 ▶▶▶▶▶ IMoz, replying to T. Prince, 6, #374 of 1428 🔗

Because generally people are dumb, and believe anything anyone in a position of authority tells them. It’s ingrained since school where pupils are taught how to answer questions based on what the teacher tells them (a person in a position of authority) versus thinking for themselves—nobody teaches people how to think anymore, just what to think!

74167 ▶▶▶▶▶▶ bluemoon, replying to IMoz, 5, #375 of 1428 🔗

You’re right! We were saying the other day about how the style of education we experienced in the 1950s and early 60s was trashed from the 70s onwards because it was rigid and dogmatic etc. But we were taught to think and reason, many young folk can’t seem to do that nowadays.
Yes I know I’m an old fart…….

74192 ▶▶▶▶▶▶▶ Carrie, replying to bluemoon, #376 of 1428 🔗

I agree!

74204 ▶▶▶▶▶▶▶▶ bluemoon, replying to Carrie, #377 of 1428 🔗

That makes 2 old farts then.

74206 ▶▶▶▶▶▶▶▶▶ Carrie, replying to bluemoon, #378 of 1428 🔗

I’m ‘only’ 56 😉

74217 ▶▶▶▶▶▶▶▶▶▶ bluemoon, replying to Carrie, 1, #379 of 1428 🔗

Sorry! Just a mere child then.

74323 ▶▶▶▶▶▶▶▶▶▶ Cheezilla, replying to Carrie, 1, #380 of 1428 🔗

Tha’s nobbut a sprog!

75774 ▶▶▶▶▶▶▶▶▶ David Grimbleby, replying to bluemoon, #381 of 1428 🔗

Three!

74191 ▶▶▶▶▶ Carrie, replying to T. Prince, 3, #382 of 1428 🔗

If the first jab doesn’t kill you, he wants two more goes..

74325 ▶▶▶▶▶ Farinances, replying to T. Prince, #383 of 1428 🔗

Yeah there’s no way I’m getting three injections for a common cold. F off.

74700 ▶▶▶▶▶ richard riewer, replying to T. Prince, 2, #384 of 1428 🔗

Because he’s used to built in glitches in his operating systems.

74102 ▶▶▶ DRW, replying to A. Contrarian, 7, #385 of 1428 🔗

My worry is that the govt will try to turn the pliant majority on the “nuts” (Bozo the Clown’s words) to ensure maximum compliance. Never mind the lack of testing or legal accountability, the selfish anti-vaxxers are holding back normality for everyone dammit.

74126 ▶▶▶▶ RickH, replying to DRW, 6, #386 of 1428 🔗

You are absolutely right.

Britain has always had this smug self-regard ever since, protected by the Channel, it joined with the US and Russia to resist the Third Reich.

But these last few months have demonstrated that, indeed, it ‘could happen here’ – as fundamental rights have been ditched for an illusory ‘safety’ from an illusory ‘enemy’.

74174 ▶▶▶▶ A. Contrarian, replying to DRW, 4, #387 of 1428 🔗

Absolutely my worry too. Just like Cressida Dickhead telling us to shame people not wearing masks. Perhaps they will come up with some visible sign of vaccination so that we know who to bully out of the supermarket.

74281 ▶▶▶▶▶ Jaguarpig, replying to A. Contrarian, 1, #388 of 1428 🔗

Oh I so hope someone takes down Dick

74788 ▶▶▶▶▶ richard riewer, replying to A. Contrarian, 1, #389 of 1428 🔗

When Michael Bloomberg was Mayor of New York City he told New Yorkers to shame people smoking on the streets of New York city. Bullies, Inc. He is also part of the Gates cartel, a fervent supporter (contributor to?) of the World Health Organization and subsidizes Public Health Schools throughout the United States.

74602 ▶▶▶▶ Lili, replying to DRW, #390 of 1428 🔗

Just tell people you’ve had the jab. It’s pointless arguing with them once they’ve convinced themselves that anyone who won’t have it is a murderer.

74601 ▶▶▶ Lili, replying to A. Contrarian, #391 of 1428 🔗

Just tell people you’ve had the jab. It’s pointless arguing with them once they’ve convinced themselves that anyone who won’t have it is a murderer.

74096 ▶▶ kh1485, replying to DRW, 5, #392 of 1428 🔗

#piss off

74105 ▶▶▶ DRW, replying to kh1485, 4, #393 of 1428 🔗

That’s the spirit!

74188 ▶▶ Carrie, replying to DRW, 1, #394 of 1428 🔗

We’ve already seen the study currently being done on how to get people to agree to the vaccine – think we should show that to people, before they actually start to use the strategies, then they will (hopefully) spot them as soon as they start being used!
https://clinicaltrials.gov/ct2/show/record/NCT04460703?term=Vaccine&cond=Covid19&cntry=US&draw=2&view=record

74995 ▶▶▶ Catherine123, replying to Carrie, #395 of 1428 🔗

Good strategy, raise things into conscious awareness.

74088 Awkward Git, replying to Awkward Git, 11, #396 of 1428 🔗

I had read about india giving it’s population HCQ recently but this is an interesting quote form a website I read:

“Bill Gates — is determined to bring a COVID-19 vaccine to market. Word on the street (K Street) is that Gates is also taking HCQ as a preventive. In fact, he has taken HCQ as a precautionary measure to avoid malaria for many years during his travels to the Third World nations that were subjected to his endless vaccine pitches and vaccination programs.
If Americans knew that India was successfully using HCQ nationwide, how would they react? New Delhi has even made the decision to make HCQ available as a prophylactic, so inexpensive is it.”

K Street is in Washington DC, known for where lobbyists “inhabit”.

74095 ▶▶ Farinances, replying to Awkward Git, 12, #397 of 1428 🔗

I’m assuming the rumours that Bill doesn’t vaccinate his own children are probably true.

Kinda like the people in silicon valley who don’t let their kids use social media.

74111 ▶▶▶ Awkward Git, replying to Farinances, 12, #398 of 1428 🔗

Him and Steve Jobs also did not let their children go to school where wifi, computers and tablets were used from what I’ve read in alternative news sites.

Says it all really – no vaccines and no computers for their own families.

74254 ▶▶▶▶ anon, replying to Awkward Git, #399 of 1428 🔗
74257 ▶▶▶▶ anon, replying to Awkward Git, #400 of 1428 🔗

comment image

74292 ▶▶▶▶▶ Farinances, replying to anon, 2, #402 of 1428 🔗

But…. How is breastfeeding unenvironmentally friendly??

74303 ▶▶▶▶▶▶ Carrie, replying to Farinances, #403 of 1428 🔗

Exactly!

74321 ▶▶▶▶▶▶▶ Farinances, replying to Carrie, #404 of 1428 🔗

Unless they want an alternative to formula milk for women who don’t breastfeed? But…. is there anything especially planet-wrecking about formula milk?

74328 ▶▶▶▶▶▶▶▶ Cheezilla, replying to Farinances, 1, #405 of 1428 🔗

Only if you’re trying to get rid of cows, sheep and goats.
Oh ……

74804 ▶▶▶ JohnB, replying to Farinances, #406 of 1428 🔗

No parent in their right mind should let their kids use social media.

74128 Biker, replying to Biker, 6, #407 of 1428 🔗

I’m beginning to warm to the mask wearers. You don’t have to gaze upon the ugly coupons of some punter with a face that could turn Medusa to stone.

74239 ▶▶ Jane in France, replying to Biker, 4, #408 of 1428 🔗

The First Minister’s face is vastly improved.

74133 BecJT, 1, #409 of 1428 🔗

Copying yesterday’s comment to today (have also put in the Forum):

Does anyone know, or can they point me at, the specific up to date legislation for GP practices and the NHS, as per the Corona Virus Act? I want to know what’s recommendation and what’s law?

I’ve also read this, but am unsure how it applies to GP practices? http://www.laworfiction.com/2020/07/risk-assessments-an-important-chink-in-the-lockdown-armour/

Given our overlords are talking about locking up the elderly again

My dad’s dementia has gone off a ski jump under lockdown, he’s gone from a fit, active, social 85 year old, to incredibly forgetful, anxious and lacking in confidence. His Gp was already disinterested, and so I got him an apt with a Harley St specialist who did a phone conference with me and my dad, he was fantastic and wrote to his GP to ask with help getting some tests and drugs organised. The GP won’t see him, only talk to him by phone.

I want to know what risk assessments, equality impact assessments and what bits of PSED GPs are still obliged to adhere to, as I’m going to send a letter asking them to tell me precisely on what basis they have withdrawn care from all their patients. I’m in a rural market town, where cases are incredibly low, as are deaths, it seems a bit heavy handed that they’ve mothballed an entire 20 GP practice, and nobody can see a doctor?

The original corona virus act: was revoked in almost its entirety, with no fanfare, announcement or anything on 4th July http://www.laworfiction.com/2020/07/lockdown-laws-in-england-have-been-revoked/

This is the new act https://www.legislation.gov.uk/uksi/2020/684/contents/made

That looks to me that they revoked almost everything relating to healthcare provision? My suspicion is this pronouncement by Hancock that care must be remote, isn’t in fact law?

74143 Cheezilla, replying to Cheezilla, 10, #410 of 1428 🔗

Regarding the composition of LS leaflets etc:

Any big numbers will probably make ther eyes (and brains) go blurry.

Yesterday, it was pointed out that people don’t get percentages and after Wankock’s recent magic with the stats for shopworkers, I suggest it’s an area to steer clear of.

I’m afraid to say that, despite 10 years of compulsory education, most people are pretty thick and only semi-literate. They read headlines and facts need to be very short and sweet.

Any numbers need to be positive – so not negative death counts but stats of the survivors.

Brief info why the tests are unreliable might be useful.

74147 ▶▶ Achilles, replying to Cheezilla, 6, #411 of 1428 🔗

I agree. People are responding emotionally to what they perceive as a deadly threat, only simple but powerful messages can work. Such as comparing deaths this year to last or number of avoidable cancer deaths, etc.

74313 ▶▶▶ Fed up, replying to Achilles, #412 of 1428 🔗

How about crowdfunding to get some top rate PR/Comms? Fear is very powerful and this is what has to be overcome.

74317 ▶▶▶▶ Andy C, replying to Fed up, #413 of 1428 🔗

This is probably going to be the solution if we want to make an impact with a campaign like this. We need to fight fire with fire. I’d be happy to put some in.

74361 ▶▶▶▶▶ Lockdown Truth, replying to Andy C, 1, #414 of 1428 🔗

Can we do it all under the “We Will Be Free” banner? I can supply all the graphics you’d need to add.

74792 ▶▶▶▶▶▶ richard riewer, replying to Lockdown Truth, 1, #415 of 1428 🔗

Martin Luther King had a good banner: “We Shall Overcome”.

74149 ▶▶ Tyneside Tigress, replying to Cheezilla, 12, #416 of 1428 🔗

Visuals necessary. How about either a pint glass, or a gin glass with divisions to reflect ‘quantities’ who have succumbed to various illnesses, or survive various illnesses. Many people – and I include many of our so-called leaders and those in the media – do not understand percentages, let alone rates of change. It is much easier, in my experience, to communicate complex issues (taxation, scale of the national debt) if it is visual.

74187 ▶▶▶ Carrie, replying to Tyneside Tigress, 1, #417 of 1428 🔗

Like that idea! Eye-catching too..

74200 ▶▶▶ Drawde927, replying to Tyneside Tigress, 5, #418 of 1428 🔗

I remember quite early on in the lockdown, the Times newspaper (which has had a slightly more sceptical streak than many other papers) had a divided bar showing the number of people killed by the virus (less than 100,000 at that date I think) vs. the number of people directly affected by lockdowns (a couple of billion I think).

Something similar with (a) Covid deaths in proportion with yearly deaths from all causes in the UK and (b) in proportion with all the projected deaths as a result of lockdown (cancer, suicide etc.) might work.

Another number comparison, not death-related but it shocked me when I first heard about it, is the goverment’s spending £15 billion on PPE, and even worse £10 billion on the track-and-tracing farce – in comparison to the £100 million Captain Tom raised for the NHS earlier in the year (and perhaps also how many new hospitals those billions could build, or NHS staff wages it could pay).
This might make people think twice about the government’s “protect the NHS” sloganeering!

74795 ▶▶▶ richard riewer, replying to Tyneside Tigress, #420 of 1428 🔗

In Quebec the percent of death of supposed deaths is around 6000. The population is 8, 500, 000. So, around 0.0007 percent of the total population have supposedly succumbed to Covid-19. How about two hourglasses side by side, one full to the top, the other with a few grains at its bottom? Something like that.

74170 ▶▶ Major Panic, replying to Cheezilla, 5, #421 of 1428 🔗

IRR – infection recovery rate of 995 out 1000.

Recovery rate of people under 65 who have no serious illnesses 999994 put of 1000000
Or 999.99 out of 1000

No of children and teachers who died after Sweden’s schools stayed open; zero

74179 ▶▶▶ Major Panic, replying to Major Panic, 2, #422 of 1428 🔗

resurch is showing that over 50 million of the British already have natural imunity to covid and many scientist believe we already have population immunity which is possibly why the hospitals are nearly empty

74183 ▶▶▶▶ Major Panic, replying to Major Panic, 4, #423 of 1428 🔗

Sweden believe they have population Immunity with no lockdown and less deaths than the British, their scientists also believe masks are pointless

74189 ▶▶▶▶▶ Major Panic, replying to Major Panic, 7, #424 of 1428 🔗

Government research suggests that up to 200000 people may die as a direct consequence of the lockdown experiment
(I think I saw that somewhere in here)

74194 ▶▶▶▶▶▶ DomW, replying to Major Panic, #425 of 1428 🔗

Yes, this (Government research… post)

74233 ▶▶▶▶▶▶▶ Major Panic, replying to DomW, 2, #426 of 1428 🔗

More than 43700 of the 46000 people who have died with covid already had life threatening health conditions

74235 ▶▶▶▶▶▶▶▶ Major Panic, replying to Major Panic, 5, #427 of 1428 🔗

The average age of people who die with covid is older than the average age we live to

74264 ▶▶▶▶▶▶▶▶▶ Major Panic, replying to Major Panic, 7, #428 of 1428 🔗

The Swedish now think that the Brits are fucking wimps

74350 ▶▶▶▶▶▶▶▶▶▶ Major Panic, replying to Major Panic, 1, #429 of 1428 🔗

Regulators are stopping the media from criticising the government covid failures

74378 ▶▶▶▶▶▶▶▶▶▶ Cheezilla, replying to Major Panic, #430 of 1428 🔗

They’re not wrong!

74286 ▶▶▶▶▶▶▶▶▶ Major Panic, replying to Major Panic, 2, #431 of 1428 🔗

Many of the world’s leading scientists say that the lockdown experiment caused enormous harm and will not have saved lives in the long term

74247 ▶▶▶▶▶▶▶▶ Carrie, replying to Major Panic, #432 of 1428 🔗

‘Only (insert figure) of those who have died from Covid-19 in the UK had no underlying medical conditions that they were aware of…’

Or, ‘x % of those who have died of Covid-19 in the Uk had underlying health conditions..’

74229 ▶▶▶▶▶▶ Major Panic, replying to Major Panic, 4, #433 of 1428 🔗

The gov. Failed to protect the vulnerable and locked up the healthy instead

74244 ▶▶▶▶▶▶▶ Drawde927, replying to Major Panic, 5, #434 of 1428 🔗

I definitely think the care home situation (sending back infectious patients, refusing hospital care etc.) is an important angle to focus on.
Given that “protecting the elderly” has always been a big justification for lockdown measures, it’s worth pointing out that the goverment has been the biggest “granny-killer” of them all.

Personally this was one of the things that really made me wake up to the fact that those in charge either do NOT know what they’re doing, or do not have our best interests at heart (or a mixture of both).

74252 ▶▶▶▶▶▶▶ Major Panic, replying to Major Panic, 2, #435 of 1428 🔗

The vast majority of people who died with covid caught the virus in nursing homes and hospitals

74322 ▶▶▶▶▶▶ DavidC, replying to Major Panic, #436 of 1428 🔗

Would that be another Imperial College ‘model’?!

DavidC

74320 ▶▶▶▶ DavidC, replying to Major Panic, #437 of 1428 🔗

Link please? The UK population is (officially) around 67 million so that’s great if it is that high!

DavidC

74364 ▶▶▶▶▶ Major Panic, replying to DavidC, #438 of 1428 🔗

Link please to which one?

74399 ▶▶▶▶▶▶ Major Panic, replying to Major Panic, #439 of 1428 🔗

If its the 50 mil immune, many scientist have said up to 80% t cell etc. Dr Lee said upto 90%

74178 ▶▶ stefarm, replying to Cheezilla, 3, #440 of 1428 🔗

Some simple pie charts with no numbers or %’s or link it to something tangible.

i.e. ‘ask yourself if I bet you £100 that you would beat me at heads or tails 99.95 times out of 100 you would bite my hand off. That’s how much chance you have of surviving cv19’ or the sweets in a jar, x infected sweets out of y.

74631 ▶▶▶ Cicatriz, replying to stefarm, #441 of 1428 🔗

Or correctly call a toin coss 26 times running.

Or roll 8 dice and get all 6s.

74185 ▶▶ Carrie, replying to Cheezilla, 2, #442 of 1428 🔗

Would people understand if we wrote something like ‘today in (town) you have a 1 in x thousand chance of catching the virus’ ???

74193 ▶▶▶ BJJ, replying to Carrie, 2, #443 of 1428 🔗

What is the problem with catching the virus?

74203 ▶▶▶▶ Carrie, replying to BJJ, 4, #444 of 1428 🔗

Because a lot of people are stupid enough to think that getting it means certain death!

74543 ▶▶▶▶ Nobody2020, replying to BJJ, #445 of 1428 🔗

Because somebody might die as long as it exists.

74634 ▶▶▶▶ Cicatriz, replying to BJJ, #446 of 1428 🔗

Viruses are entirely new to the human species, apparently. It’s a bit like an alien invasion or zombie apocolypse.

74288 ▶▶▶ Farinances, replying to Carrie, 2, #447 of 1428 🔗

But then they go “BUT THERE’S STILL A CHANCE!!” 🙄

I feel like there’s no winning with risk statistics unf at this point. Far better to go with facts about consequences of lockdowns, like the cancer deaths, child suicides etc. And def more concentrated on death and health rather than the economy because we all know they think that’s an abstraction that doesn’t impact lives

74302 ▶▶▶▶ Carrie, replying to Farinances, 3, #448 of 1428 🔗

Ok, how about: ‘Are you happy for your child’s school to stay closed for another academic year?’
(because that is how long it might be before there is a vaccine..)

74314 ▶▶▶▶▶ Farinances, replying to Carrie, #449 of 1428 🔗

Yes, more practical negative outcomes and negative consequences that we can prove have already happened (21,000 excess non corona deaths ?)

74186 ▶▶ DomW, replying to Cheezilla, 5, #450 of 1428 🔗

Anyone heard the phrase “Change happens when the pain of staying the same is greater than the pain of change.” ?

It may be advantageous on the leaflet to also highlight real pain being caused by the lockdown, both now and projected for the future, that people can relate to.

Many on here have reported that bringing people round with logic doesn’t really work because the beliefs have an emotional basis (fear for example) so maybe the same approach can be used on an LS leaflet to break the spell for some.

74245 ▶▶▶ Lisa from Toronto, replying to DomW, 5, #451 of 1428 🔗

Yup, I’ve been one of those people. The madness might end when people are more afraid of something other than Covid — like not having a job, starving, losing their home, more lockdowns, etc. It shouldn’t have to get that bad, but I’m afraid we’ve gone so far down the rabbit hole that life for most people will have to get a lot worse before they come to their senses.

74214 ▶▶ bluemoon, replying to Cheezilla, 1, #452 of 1428 🔗

Agree. Recovery stats very important.

74218 ▶▶ Dave #KBF, replying to Cheezilla, 2, #453 of 1428 🔗

Keep stuff simple, not too wordy. People loose interest very quickly. keep stuff visual, maybe simple pie charts?

74384 ▶▶ Barney McGrew, replying to Cheezilla, 2, #454 of 1428 🔗

An observation: figures are infinitely zoom-in-able. Toby observed that the Northern lockdown was triggered by a change from 0.05% to 0.07%. If you draw a graph of it at full scale, it’s invisible (unless the scale is logarithmic – and this is meaningless to people), and if you zoom in on the ‘surge’ it looks identical whether the figures are 0.07%, 0.007% or 0.00000007%. If it goes from 1 person in 100 million to 2 people, that’s a 100% rise!!!!

Really, statistics are a losing game to base an argument on. But I don’t know what the alternative is, because most people don’t get ideas. For example, the difference in ‘level of tragedy’ between the death of a 30 year-old and that of a 96 year-old is huge, but as a headline statistic it’s identical. An epidemic that has merely brought forward by a few months the demise of 50,000 people (and I’m not saying I believe that figure is anywhere near correct) who were at death’s door already is not very serious at all, but the figures just don’t convey that.

74481 ▶▶▶ Major Panic, replying to Barney McGrew, #455 of 1428 🔗

Simple ‘headline’ bullet points – references can be on a web page and references on leaflet

War and peace us a waist if time

74507 ▶▶▶▶ Major Panic, replying to Major Panic, #456 of 1428 🔗

About 600000 people die naturally if old age every year in the UK, most of the 46000 who have died with covid were very old and frail and would probably have died in 2020 without covid

74151 The Dark Lord, replying to The Dark Lord, 1, #457 of 1428 🔗

I have a rule of thumb about “experts” and their numbers that has served me well for my 63 years on this mortal coil and 35 years on Wall Street … anyone who spouts percentages and doesn’t also give the raw numbers is deceiving you … without the raw numbers they remove context and percentages without context is almost always a deception …

76461 ▶▶ Sophie123, replying to The Dark Lord, #458 of 1428 🔗

Good advice

74161 Northern Chubs, replying to Northern Chubs, 32, #459 of 1428 🔗

I’ve been to a Tesco Express several times with no mask, but decided to try some larger supermarkets. It was an interesting psychological experiment for me.

On my first Tesco Express visit I had some marginal anxiety. Not enough to make me not go, but enough to make me think about it. I powered through and everything was fine. The second time there was a tiny bit of anxiety, but that dissipated almost immediately. The 3rd time was just like before all this nonsense started.

But I went to a large Morrisons on Friday for a few things, and today went to a large Sainsburys for a big shop. Like my first Tesco trip, Morrisons made me think I was taking on a new challenge, but I got through it. Sainsburys today was like the 2nd Tesco trip; any anxiety immediately dissipated and took my sweet-ass time too . No one said anything. I had a few conversations with staff. I didn’t notice anyone staring or tutting. But generally people didn’t care and had a couple of pleasant exchanges with customers.

The disappointing thing is that I have seen approx 50% of people not wearing a mask in the small Tesco, but in Morrisons, everyone was wearing a mask. In Sainsburys I only saw one man and one woman without one. I only hope that most sceptics are just staying away and ordering online.

I can understand why some sceptics don’t want to go for it. It can be daunting. But it can be done and it gets easier, very quickly. I felt liberated and hope I was helping some muzzled sceptics see that it can be done.

Next challenge is Meadowhall Shopping centre 😀

74169 ▶▶ bluemoon, replying to Northern Chubs, 10, #460 of 1428 🔗

Thanks for this. I think this is a new career for you! Trundling around the country checking out attitudes. Until we go into full scale lockdown anyway!

74172 ▶▶ Farinances, replying to Northern Chubs, 6, #461 of 1428 🔗

Keep doing it. Eventually you forget until you get inside and are confronted with all the floating pairs of eyes.

74211 ▶▶ Dave #KBF, replying to Northern Chubs, 3, #462 of 1428 🔗

Meadowhell never a nice experience at the best of times.

Agree about more venturing out face free.

74800 ▶▶▶ Northern Chubs, replying to Dave #KBF, #463 of 1428 🔗

Indeed. I hate it. I am just going to pick up something for someone. Looking forward to it 😀

74307 ▶▶ guy153, replying to Northern Chubs, 7, #464 of 1428 🔗

I think it’s quite important not to wear a mask in order to encourage others. I was worried people might disapprove, and I don’t really want to offend anyone, but I think quite a lot of them were thinking note to self if that guy is getting away with not wearing it maybe I can too.

If hardly any of the staff are masked that’s a good sign the shop is cool.

74312 ▶▶ DavidC, replying to Northern Chubs, 3, #465 of 1428 🔗

“I only hope that most sceptics are just staying away and ordering online”.

Why? Wear your face with pride!

DavidC

74798 ▶▶▶ Northern Chubs, replying to DavidC, #466 of 1428 🔗

My hope was that there are lots of sceptics but I am just not seeing them in the shops. If the supermarket is representative of the public mindset then it’s pretty disheartening. I would prefer it if they were showing their faces, but I understand the trepidation of doing so. However it is temporary. Nothing bad has happened to me 5 times in a row. I will keep doing it 🙂

74163 swedenborg, replying to swedenborg, 6, #467 of 1428 🔗

I posted this yesterday but repost this again together with today’s world ometer of Luxembourg
https://t.co/nL6XKi9CBv?amp=1A
https://www.worldometers.info/coronavirus/country/luxembourg/
The reason is that this document from 19th July from the Health Authorities is an alarming document predicting a soon coming second wave in Luxembourg with predicted 9000 cases in that country soon. This document might have influenced UK (but not quarantining Luxembourg as far as I am aware of) so it could be interesting to analyse the document and compare to reality 11 days later.
They said 8000 cases 29th July but 6793 2nd Aug
They state “These increases will lead to more hospital stays due to COVID-19 which have themselves also been steadily increasing since the beginning of July. Although the large-scale testing(LST)is contributing towards the detection of new positive cases, there has been a general trend for more positive tests in relation to the overall number of tests performed”
But they don’t give any clear figures of newly hospitalized cases nor any percentage of PCR pos detected of tests done.
“ If the current dynamics persist, a shortfall in available intensive care unit (ICU)beds may be expected already by the end of August. Given the range of doubling times of 8to 13.2daysfrom the presented analyses, it remains unclear whether the recent rise in cases is restricted to clusters(which evidence indicates)or whether broader community transmission of SARS-CoV-2 is occurring.”Rather gloomy prediction but startling there is no indication where these positive tests come from. Screening, hospitalizations, are they all PCR or srology included ,are they from selected community screening? Amazing that a central body seem to have no information where the tests come from. They calculate 600 cases 30th July(Reality 83).There are more confusing graphs but the ICUs would be overwhelmed early.Now have a look at the actual cases and deaths. Cases have increased after this document max 150 but long from 600 cases 30th July as predicted. Five scattered deaths since the document but most likely elderly cases from the earlier pandemic. The recent spike can’t have produced those deaths.If a prediction what is going to happen in two weeks  is so bad wouldn’t it be better to start collecting real data incl. URI surveillance, divide testing results from asymptomatic and symptomatic, hospitalization data, which are contact tracing, which are clusters ,which are occupational screening and what are the false positive ratio?But tiny Luxembourg is perhaps not much worse in their predictions than the UK.

74182 ▶▶ Carrie, replying to swedenborg, 2, #468 of 1428 🔗

With no actual numbers of hospitalisations, deaths, tests carried out (and how many positive) this is all just scaremongering…
Need to get the swprs onto it!

74175 wendy, replying to wendy, 23, #469 of 1428 🔗

Yesterday my partners 79 year old mother broke the law 7 times with 7 separate people. She did this because it is illegal in the north west to enter someone else’s home or private garden or to invite anyone into your own home or garden. I have to say I am struggling to accept that the government can make a private persons home or garden an illegal space for others to enter. If it is owned and freehold how can a property and land be subject to such a law?

Now we don’t have control over our own homes and gardens.

Of course thousands of people are ignoring this law and some don’t even know about it. I wonder what comes next if 79 year old people won’t obey the law?

74210 ▶▶ MiriamW-sometimes-AlanG, replying to wendy, 9, #470 of 1428 🔗

If they can dictate what you wear, why not dictate what happens in your own home? This is not a problem for most people, it seems.

I’m not surprised people don’t know what you can and can’t do. I know I don’t!

74224 ▶▶ Farinances, replying to wendy, 4, #471 of 1428 🔗

It’s not the law though to be fair. It is merely “guidance”. I had to explain this to my mum last night when she was having a thromby about me being here (despite the fact we’re not in the lockdown zone yet).

74177 Cheezilla, replying to Cheezilla, 2, #473 of 1428 🔗

This is what we’re up against!

The 43-year-old, [Dr Van Kerkhove – why do we need ot know her age??] who has become a familiar face having appeared alongside WHO chief Dr Tedros Adhanom Ghebreyesus at press briefings for months, added that countries should not rely on a jab as a silver bullet to bring the raging pandemic to a close.

74180 ▶▶ Carrie, replying to Cheezilla, 8, #474 of 1428 🔗

In other words they want everyone to be living in a constant state of uncertainty/panic/stress from now on until the end of time, whilst at the same time being constantly tracked and monitored. No more freedom, ever…

74504 ▶▶ HelzBelz, replying to Cheezilla, 2, #475 of 1428 🔗

Raging pandemic??? WTF?

74184 profund chap, replying to profund chap, 17, #476 of 1428 🔗

What is more moronic? Wearing a mask in the open air or wearing a mask in the car on your own!
I am sure mask fiddling must be leading yo car accidents.

74202 ▶▶ Dave #KBF, replying to profund chap, 4, #477 of 1428 🔗

Wait until they are driving trying to apply makeup & or eat breakfast whilst wearing a mask.

The fun has only just started.

74249 ▶▶▶ Farinances, replying to Dave #KBF, 10, #478 of 1428 🔗

I’ve already seen people on instagram doing makeup tutorials where they apply nothing to the lower half of the face (to ‘let the slin breathe’ – lol!!) and really elaborate eye makeup.

And this is why social media is cancer.

74284 ▶▶ BobT, replying to profund chap, 6, #479 of 1428 🔗

We were having a laugh in the bar about people wearing masks alone in a car. Someone said, yes its like wearing a condom in bed when you are home, alone.

74289 ▶▶▶ annie, replying to BobT, 5, #480 of 1428 🔗

Self love in both cases.

74528 ▶▶▶ Nobody2020, replying to BobT, #481 of 1428 🔗

I thought wearing a condom in bed was classy or maybe I’m thinking of something else.

75421 ▶▶ Alec in France, replying to profund chap, #482 of 1428 🔗

Maybe fiddling is less dangerous than nodding off through lack of oxygen / excess CO2?

74207 arfurmo, 1, #483 of 1428 🔗

https://www.dailymail.co.uk/news/article-8585307/Eight-coronavirus-deaths-recorded-England-Wales.html . I thought that the figures would be around 150 when they tried to find those who tested positive in March and died of a cobra bite today. All had underlying health conditions and none under 52. 774 more positive cases . I’m fearing an Australain lcokdown with horrifying figures like these.

74209 BecJT, replying to BecJT, 9, #484 of 1428 🔗

Copying yesterday’s comment to today (have also put in the Forum):

Does anyone know, or can they point me at, the specific up to date legislation for GP practices and the NHS, as per the Corona Virus Act? I want to know what’s recommendation and what’s law?

I’ve also read this, but am unsure how it applies to GP practices? http://www.laworfiction.com/2020/07/risk-assessments-an-important-chink-in-the-lockdown-armour/

Given our overlords are talking about locking up the elderly again

My dad’s dementia has gone off a ski jump under lockdown, he’s gone from a fit, active, social 85 year old, to incredibly forgetful, anxious and lacking in confidence. His Gp was already disinterested, and so I got him an apt with a Harley St specialist who did a phone conference with me and my dad, he was fantastic and wrote to his GP to ask with help getting some tests and drugs organised. The GP won’t see him, only talk to him by phone.

I want to know what risk assessments, equality impact assessments and what bits of PSED GPs are still obliged to adhere to, as I’m going to send a letter asking them to tell me precisely on what basis they have withdrawn care from all their patients. I’m in a rural market town, where cases are incredibly low, as are deaths, it seems a bit heavy handed that they’ve mothballed an entire 20 GP practice, and nobody can see a doctor?
The original corona virus act: was revoked in almost its entirety, with no fanfare, announcement or anything on 4th July http://www.laworfiction.com/2020/07/lockdown-laws-in-england-have-been-revoked/

This is the new act https://www.legislation.gov.uk/uksi/2020/684/contents/made

That looks to me that they revoked almost everything relating to healthcare provision? My suspicion is this pronouncement by Hancock that care must be remote, isn’t in fact law?

74223 ▶▶ Farinances, replying to BecJT, 3, #485 of 1428 🔗

Don’t think so. They’re just trying to ‘reform’ the NHS with the ‘crisis’ as cover.

Pretty vile actually.

74251 ▶▶▶ BecJT, replying to Farinances, 7, #486 of 1428 🔗

Really vile, GPs must be coining it in on their little internal market. So you reckon it’s just a recommendation? Don’t suppose you happen to know whether PSED and risk assessments still apply? If I look on the Gov website for the Act, they risk and equality impact assessed the legislation (although a good lawyer could drive a coach and horses through it). i want to write a terrifying letter to our GP and find out on precisely what basis they’ve done this, and whether I can see their risk and impact assessments (covid, in rural Shropshire, not being the only risk to life and limb).

The worst I heard, a new mother who had a tear during childbirth got infected stitches, the doc receptionist asked her to photograph the affect body part (!!) and text it! How the F is that risk assessed? Would only take one perv in the office to whack it on pornhub and that would be a) life wrecking and b) a whopping invasion of privacy, dignity, and confidentiality!

74270 ▶▶▶▶ Farinances, replying to BecJT, 4, #487 of 1428 🔗

Maybe get in touch with Law or Fiction about this?
It would make an interesting blog post for them.
I for one want to know whether a GP surgery can enforce masks BY LAW (don’t think so now, but maybe from August 8th) and therefore if they refused treatment to someone without one whether that would constitute an offence under discrimination and human rights law.

74274 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to Farinances, #488 of 1428 🔗

Sorry to be out of the loop but what changes on August 8th?

74278 ▶▶▶▶▶▶ Farinances, replying to MiriamW-sometimes-AlanG, 1, #489 of 1428 🔗

More mask rules come into force I think. Extension into more ‘public places’.

74287 ▶▶▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to Farinances, 2, #490 of 1428 🔗

I hadn’t heard that but checked and you’re right: cinemas, museums and churches etc. Doctors not mentioned but only checked BBC, if they can be believed!

74298 ▶▶▶▶▶▶ Carrie, replying to MiriamW-sometimes-AlanG, 1, #491 of 1428 🔗

Apparently Jenrick on the radio was saying earlier that there are no plans for a new shielding regime, so I would expect it to be rolled out sometime this week, if they are still following the usual modus operandi.. Maybe by 8th???

74324 ▶▶▶▶▶▶▶ A. Contrarian, replying to Carrie, 3, #492 of 1428 🔗

Tomorrow more like.

Ironically, a properly managed and supported shielding regime is exactly what we needed back in March. Let the healthy carry on as normal, herd immunity reached, we’d all be out of it by now, vulnerable and elderly included. Instead they made them shield for months on end for precisely nothing, and are now letting them out for a month or two only to have to go back into it for the winter with nothing gained. It’s utterly sh*t.

74347 ▶▶▶▶▶ BecJT, replying to Farinances, 5, #493 of 1428 🔗

Yep I’ve dropped them a line, waiting to hear. It’d be a really good blog post. I also want to know about visits, it turns I’m fairly sure, being denied visits by relatives if you were sick was never law, all those awful stories we heard of people dying without their loved ones wasn’t on a solid footing. My mum’s just got back from visiting a family friend in hospital, you book a slot, 30 mins allowed, they kept her waiting in the corridor for 15 mins, and then 15 mins later told her her half hour was up. Our friend was in tears, he’s been in there two weeks, feels awful, the food is crap, he’s scared and poorly and this was the first friendly face he’d clapped eyes on in all that time. My mum objected, they got the sister, gave her a dressing down, and booted her out. Who the bloody hell do they think they are?

74273 ▶▶▶▶ Farinances, replying to BecJT, 3, #494 of 1428 🔗

Yes it’s one thing taking a pic of a facial mole, quite another taking one of your hoohaa! !

74341 ▶▶▶▶▶ BecJT, replying to Farinances, 5, #495 of 1428 🔗

Exactly! I mean what planet are these people on? What woman in her right mind, never mind a sick one, would photograph her foufou and send the photo to some gimp at the GP surgery????

The only reason I’m sniffing around this is I’ve been here before on another issue, and it was shocking just how much local authorities and the NHS were getting wrong. It’s amazing what one well aimed, terrifying letter can do.

I think it must be the same with this, in fact not just with the NHS, but with HSE, Environmental Health, schools, shopping centres etc. If we had a library of templates, we could be firing them off and getting this sorted out. That way it wouldn’t matter that we were the minority, it’d just matter that we were right. And we are right.

74400 ▶▶▶▶▶▶ janis pennance, replying to BecJT, 3, #496 of 1428 🔗

Exactly , we need to be able to challenge so much .
Another is schools and mask wearing
My neighbours school is enforcing mask wearing for 11 + years

I would be asking …Has the school risk assessed my child individually for wearing an item of PPE all day ?

It’s ludicrous , in the workplace PPE is monitored , even a dust mask , the individual wearers health , the temp, humidity, ventilation, hours worn , level of activity etc
And yet you want to stick any old mask on a child all day !!!

74404 ▶▶▶▶▶▶▶ Carrie, replying to janis pennance, 6, #497 of 1428 🔗

Yes, parents should demand INDIVIDUAL risk assessments for their child wearing PPE all day – think the requirement might soon be dropped, especially if you threatened legal action if the child suffered ill-effects..or alternatively get the school to sign a form saying they accept responsibility and will pay damages if the child suffers any illness as a result of mask-wearing…

74410 ▶▶▶▶▶▶▶▶ janis pennance, replying to Carrie, 2, #498 of 1428 🔗

Folk just seem to accept it …slap a mask on their child and off you go . Bonkers

74617 ▶▶▶▶▶▶▶▶ JulieR, replying to Carrie, 1, #499 of 1428 🔗

Thank you for this.

If my daughter’s school will demand masks this is what I will do.

74599 ▶▶▶▶▶▶▶ BecJT, replying to janis pennance, 1, #500 of 1428 🔗

Equality Impact Assessments also, plus safeguarding. We could do with some experts, all coming together and getting us some factsheets, then we could write letters. Masks on kids is just dangerous and inhumane, makes me so sad.

74797 ▶▶▶▶▶▶▶▶ richard riewer, replying to BecJT, 1, #501 of 1428 🔗

Don’t get sad, get even.

74389 ▶▶ janis pennance, replying to BecJT, 6, #502 of 1428 🔗

Same here , my Dad is 93 with diabetes, heart failure …can’t see a Dr , can only have telephone appoint. He is deaf so no can do . Resulted in changing tablets on my say so …pure guesswork as i am not a Dr . Disgusted how they can get away with this

I feel so sorry for you and your Dad trying to battle your way to simply getting care

74600 ▶▶▶ BecJT, replying to janis pennance, 1, #503 of 1428 🔗

It’s crap isn’t it? Your poor dad. I don’t think they can do this, I’ll report back when I find out, but I’m not letting it drop, my dad’s paid his stamp, he’s entitled to the care, and they can’t just make the rules up to suit themselves.

74221 OKUK, replying to OKUK, 15, #504 of 1428 🔗

Boris weighs the nuclear options:

1. Destroy the UK economy.

2. Kill the Conservative Party.

3. Plead guilty to criminal negligence.

4. Resign.

74225 ▶▶ Dave #KBF, replying to OKUK, 14, #505 of 1428 🔗

OKUK you forgot 5. Take up extremely well paid pretend position with big pharma company.

74250 ▶▶▶ Jay Berger, replying to Dave #KBF, 5, #506 of 1428 🔗

At that speed and extent of economic destruction, there won’t even be money for big pharma anymore.

74799 ▶▶▶ richard riewer, replying to Dave #KBF, #507 of 1428 🔗

Join the Bill & Melinda Gates Foundation.

74295 ▶▶ Tom Blackburn, replying to OKUK, 1, #508 of 1428 🔗

Boris has already deployed the nuclear option; we’ve been sussed – double down on the nonsense.

74334 ▶▶ RickH, replying to OKUK, 3, #509 of 1428 🔗

I think that the Tory Party committed hari-kiri. Nobody else chose the bloated lying pillock!

74417 ▶▶▶ Carrie, replying to RickH, 2, #510 of 1428 🔗

Even the Bruges group seem to have had enough! https://twitter.com/BrugesGroup/status/1289897027392872450?cxt=HHwWhICtqeSg0eYjAAAA
Shielding for over 50s was not part of the Government’s initial Covid response.
The very suggestion appears to be not only an overreaction, but a surefire vote loser.
Allowing people to enjoy some semblance of normality only to revoke it soon afterwards would border on cruel.’

74222 Peter Saunders, replying to Peter Saunders, 2, #511 of 1428 🔗

“Aussies love to make out they are this rough, tough, she’ll be right, bunch of rebels when in reality they are a nation of supine, compliant rule followers who love nothing more than ‘dobbing in’ someone else for not following the most petty of rules and regulations.”

After 10 years living there, I’d say that’s true. Unfortunately, the last few months have demonstrated that the UK is exactly the same. Officially the most scared nation in Europe. It’s embarrassing.

75344 ▶▶ Adrian, replying to Peter Saunders, 1, #512 of 1428 🔗

As an Australian living in Melbourne, can 100% confirm that’s true. Nation of bedwetters, grassing up their neighbors. Embarassing

74228 HereticHereward, #513 of 1428 🔗

The English speaking world has committed cultural and economic suicide and handed the world to the Communist Chinese on a platter.

74231 Tyneside Tigress, replying to Tyneside Tigress, 12, #514 of 1428 🔗

Just posted on The Telegraph, quoting Carl Heneghan:

‘Where’s the rise? By date of test through July there’s no change if you factor in all the increased testing that’s going on’

Between July 22 and July 29 the seven day rolling average of reported cases jumped between those two dates from 659 to 753 – 16.7 per cent. However when judged by specimen date the seven day rolling average actually dropped from 641 to 442, a 31 per cent decrease.

Why is no one checking this out at government level?,” added Prof Heneghan.

Why indeed!

https://www.telegraph.co.uk/news/2020/08/02/lockdown-north-england-rash-decision-not-backed-data-oxford/

74248 ▶▶ Achilles, replying to Tyneside Tigress, 3, #515 of 1428 🔗

This is what we’re up against.

74326 ▶▶▶ Stephen, replying to Achilles, 5, #516 of 1428 🔗

The government has totally lost it. This is appalling. They cannot even read data properly.

74338 ▶▶▶▶ RickH, replying to Stephen, 5, #517 of 1428 🔗

You sound surprised. They never have in the period of this whole sad carnival.

The only question is whether it’s deliberate.

74262 ▶▶ Farinances, replying to Tyneside Tigress, 8, #518 of 1428 🔗

Oh they’re checking it out. They know full well what they’re doing.

I think most people up here know this. Well not THIS (they don’t know about the figures, neither do they care) but they DO know that there is no ‘spike’ and they are well aware that corona is now basically a non-entity. So when you speak to them about a possible local lockdown hitting them they roll their eyes and say something like “Yeah yah whatever” and intimate that will ignore the rules. Most of them still wear their mask in the supermarket though.

74283 ▶▶▶ RickH, replying to Farinances, 6, #519 of 1428 🔗

Most of them still wear their mask in the supermarket though.”

That’s the problem.

A lot of people in 1933 Germany probably didn’t invest in the hatred of Jews. But they didn’t make waves, either.

‘they DO know there is no ‘spike’.

… I’m not so sure …. the general level of ignorance is pretty high, with vast over-estimates of the mortality caused by Covid shown by surveys.

You really can fool most of the people most of the time, and there is indeed what we might call ‘evil’ stalking the land – as usual, banal and unthinking rather than spectacularly surmounted by horns.

74467 ▶▶▶▶ Farinances, replying to RickH, 2, #520 of 1428 🔗

I don’t believe the surveys.
I believe talking to people in the street.

74318 ▶▶ A. Contrarian, replying to Tyneside Tigress, 4, #521 of 1428 🔗

Heneghan needs to break down the door of No.10 and give BoJo a good talking to.

I wish he could gain more traction and influence on the media and government alike.

74349 ▶▶ hotrod, replying to Tyneside Tigress, 2, #522 of 1428 🔗

Note the word “claimed”. Of course he can’t possibly be right can he. Disgraceful attempt to discredit.

Carl needs to march to Number 10 and present these facts on Live TV.

74382 ▶▶ wendy, replying to Tyneside Tigress, 2, #523 of 1428 🔗

Carl Henegan to the rescue again!

74246 Jay Berger, 11, #524 of 1428 🔗

The UK war-gaming and Victoria curfew stories clearly indicate that they have lost their mind but won’t retract an inch, ever.
There, as well as in Germany, the general public has now been so brainwashed, was financially soothed temporarily and is economically completely illiterate, that they won’t face any meaningful, let alone successful, resistance anytime soon, if ever.

The German demo was peaceful, overwhelmingly attended by normal people able to think critically and for themselves, with the usual and very justifiable concerns voiced.
The media has focussed on actively LOOKING FOR right-wing banners and people, and would only start its cameras once it saw one, and broadcast only those, of course.
It also states that the main speaker was a far right Pegida one, omitting the others and that most of the others couldn’t speak, just because the demo was aborted by the police.
Aborted because most people didn’t wear masks, of course, as this was the point, and as it didn’t matter at the BLM demos.

It also seems to have underreported massively the attendance figure, as participants claim that there were close to a million people attending, instead of the 10k, 17 or 20k reported by the MSM.
See the link, although I don’t understand why organizers don’t have better pics/drone coverage of that if this was true.
https://www.rubikon.news/artikel/lugen-die-medien-2
Also, the million+ figure is allegedly one obtained from the police directly.

Which gives the lie-op an additional dimension and another active and as such corrupted participant, if true.

The MSM neglects to report completely that violence occurred at the Antifa counterdemos, claims that policemen were hurt by demonstrators at the Freedom demo
instead, and zooms in on a famous bedwetter journo’s claim that she felt
threatened and had to abort her
‘reporting’.

In short, such efforts and demos will currently be actively sabotaged by the authorities (I wouldn’t be surprised if the BVS actually TOLD its right-wing informers &co to attend and be visible) and the MSM, and the public will fall for it.

The people do not want freedom anymore, and as such, they don’t deserve it, least of all the either lethargic or fanatically woke young.
Let’s hope and try to ensure that those of us who do can obtain some niches for a few more years, but with regard to society/pre-Corona freedom status, I am afraid that the ship has sailed for good.

74263 richard riewer, replying to richard riewer, 8, #525 of 1428 🔗

TOBY YOUNG SAID:
Can’t the over-65s just carry crucifixes and cloves of garlic to ward off the vampiric virus? I’m sure that would result in a far lower loss of life than imprisoning them in their homes.

It would also result in less taxpayers monies going down the drain.

74330 ▶▶ Tom Blackburn, replying to richard riewer, #526 of 1428 🔗

Lock up the boomers. I think that’s what they actually want (apart from my folks). Send them Aldi beans and tinned macaroni – how do you like those apples? No need for a masks when you are at home chowing on Smart Price corned beef

74844 ▶▶▶ richard riewer, replying to Tom Blackburn, #527 of 1428 🔗

I am a locked up boomer, living in an HLM social housing unit with 120 other locked up boomers over age 60. Nearly every inch of wall space in our lobby is covered by posters telling us not to do this, that and the other. All for our own good, of course. Because they are so concerned. Example: you can smoke cannabis in your apartment but not at your neighbor.
Just a few weeks from the lockdown the HLM administration put up a poster pleading with us to be nice to our neighbors, not say bad things about them, not give them the cold shoulder or socially distance yourself from them. Funny! One month after the lockdown began, in the last week of April, I received an official letter from them accusing me of being a menace to the health of my neighbors and myself. It stated unequivocably that, according to a complaint from another resident in my building, I, resident of Apartment 214, ‘let anybody get in the building’. ‘So it meen that you put your healt in danger for you and others’. The following morning the HLM agent who wrote the letter and a policewoman knocked on my door and made the same accusation to my face. The neighbor that made this claim about me must have been invisible because there is only one way to let people into the building from inside the apartment and that is with the intercom box on the wall next to the bathroom. Mine stopped working eight years ago. I told the HLM agent that it didn’t work, so he went downstairs to ring my bell while the Policewoman stood outside in the hallway, hoping to hear it ring. It didn’t. What a shame. I further stood my ground and demanded that they show me concrete proof of my criminal activity: date, time, how was I dressed, who I let in, etc. They didn’t have one shred of evidence to shove in my face, so they left. Unfortunately, unsavoury types like my not very nice neighbor have been granted complete, legal, anonymity/immunity, so any official inquiries that I make will be met by silence. Kafkaesque, no?

74267 Ewan Duffy, replying to Ewan Duffy, 15, #528 of 1428 🔗

The Irish edition of the Sunday Times commissioned a survey about schools reopening at the end of this month. 60% in favour and 14% no opinion with 26% against.

It will be hard for the teachers unions (as big a pack of bed wetting welfare queens as they are in the UK) to ignore this.

74277 ▶▶ Carrie, replying to Ewan Duffy, 2, #529 of 1428 🔗

However the government don’t really want schools to open again, according to UK column way back in May. I think they want unions to insist on ‘safety’ measures that parents will not go along with, thus the parents will homeschool and the government will get their wish, without appearing to have actively ‘chosen’ this course of action…

74337 ▶▶▶ Martin Spencer, replying to Carrie, #530 of 1428 🔗

Why don’t they want schools to open?

74353 ▶▶▶▶ Ewan Duffy, replying to Martin Spencer, 1, #531 of 1428 🔗

Because they don’t want a fight with the teachers unions.

74431 ▶▶▶▶ Cheezilla, replying to Martin Spencer, 2, #532 of 1428 🔗

They want everything to be online.

74561 ▶▶▶ Christopher Bowyer, replying to Carrie, 1, #533 of 1428 🔗

I think the govt do want schools to open, as if they don’t lots of parents can’t go to work & so the economy collapses even further. The govt seems to want a booming economy while terrifying the life out of everyone!

74290 ▶▶ Tom Blackburn, replying to Ewan Duffy, 10, #534 of 1428 🔗

It’s fucking scandalous that kids’ lives are being treated in such throwaway fashion

74383 ▶▶▶ Country Mumkin, replying to Tom Blackburn, 2, #535 of 1428 🔗

Surely those sending kids to private or boarding schools must be livid. Paying significant costs for no returns. Surely they would be demanding return in September no matter what?

If the anger of those parents and the owners of private school rebel, surely state schools cannot be left behind. It would be beyond scandalous. What do you think?

74425 ▶▶▶▶ Richard, replying to Country Mumkin, 3, #536 of 1428 🔗

It hasn’t been widely reported but suspect you will find a lot private schools opened up for many more years / pupils last term than the government suggested ones. My daughters prep school for example got all years and all pupils back for over a month. There had been reported challenges with insurance etc but that was obviously solved (assume once the government conceded in the Dolan case that the closures were not law). Would expect therefore that they will open fully in September and as you suggest the state schools pupils could be left behind again.

74438 ▶▶▶▶▶ Carrie, replying to Richard, #537 of 1428 🔗

Out of interest, did they do social distancing, bubbles etc?

74469 ▶▶▶▶▶▶ Richard, replying to Carrie, 3, #538 of 1428 🔗

In some ways – class sizes were reduced to 15 and then the teacher stayed with them all day so the specialist subject teachers didn’t come into to teach (I think they were allocated to the newly created overspill classes) Staggered drop off and pick up – and now hanging around in the playground after school. Uniform ditched so it was clear everyone had clean clothes on every day. Temperature taken at gate on way in. Lunch was given to them in classroom as well. Didn’t see inside the classrooms but they were still given lego etc which was cleaned every week.

Our daughter is only just five so we were worried about how many changes there would be but overall they seemed to handle it well with minimal disruption – none of the teachers or assistants were wearing masks. They basically accepted social distancing within the class was impossible.

For next term uniforms are back and other elements like after school clubs were on the agenda to be returned. I was doing the school run the afternoon they heard they could get everyone back and the staff were genuinely elated.

Pretty much all parents sent their kids in – on the first day back there were 12 out of 15 which very quickly became 14 consistently.

74550 ▶▶▶▶▶▶▶ Carrie, replying to Richard, 1, #539 of 1428 🔗

Thanks; interesting. Here in Sweden there are no school uniforms. I have a friend who works in school admin and she said that in her school they spaced the kids out a bit more at lunchtimes, and they were not allowed to serve themselves the food like they usually do (staff served them) but they did not do much else in the way of precautions, apart from encouraging hand washing.

74551 ▶▶▶▶▶▶▶▶ Carrie, replying to Carrie, 1, #540 of 1428 🔗

Up to about age 13 kids here sit at individual desks, spaced out and facing the teacher anyway – above that age that they usually sit in pairs, again facing the teacher. She said that whatever they said, the kids were not going to stay away from each other in the corridors and playground, so it was pointless running around trying to enforce distancing!

74629 ▶▶▶▶▶▶▶▶▶ Richard, replying to Carrie, 1, #541 of 1428 🔗

All sounds very sensible ! Think the lunch in the classroom was the same idea – they used to have in a dining hall and serve themselves. Their classroom sitting was around square tables that took eight – not sure what happened to those. They definitely encouraged hand washing. My sister works as a teaching assistant in a state school that was open throughout for key workers in London – any illness in the teaching staff there was over the by the end of the Easter holiday and they haven’t had any issues since then (which corolates to the estimated peak in London overall pretty tightly). For us it was a big step back to normality and losing fears about what was happening letting her go back – that should be the same for everyone so really hope that all schools are back open and not tied up in stupid rules for September.

74294 Basics, replying to Basics, 5, #542 of 1428 🔗

The government of Scotland farcical counting record continues

Verbatim from Scot Gov site reported 2 August:

“Weekly figures
– Positive tests: week ending 2 August: 22,038 people tested – 125 positive

– Number of tests: 72,705 tests reported week ending 2 August”

How can the report two figues for weekly number of tests (22,038 & 72,705)? This is complete nonsense trying to obscure that 125 tests returned positive.

Also verbatim from ‘weekly figures’:reported 2 August:

“- Hospital admissions: week ending 22 July : 3 COVID-19 patients were admitted to hospital.

-Deaths: week ending 26 July: 8 COVID-19 deaths were registered, of which 2 were in care homes and 4 in hospital.

– Delayed discharges: As at 29 July: 920 people were delayed in hospital.

– NHS staff absence: week ending 28 July: On average, 4,241 NHS staff, or around 2.5% of the NHS workforce, reported absent each day for a range of reasons related to COVID-19.”


These weekly figures are for weeks ending 22, 26, 28 and 29 July above we were 2 August – all gathered together in the same bullet list.

Three admissions from, say*, 125 positive tests.

*say since the scot gov doesn’t give figures like for like to be able to draw conclusions. 3 (22 July) out of 125 (2 August).

Zero deaths widely reported by sturgeon et al. for 14? days in a row as at 2 August but not according to week ending 26 July which recorded 8 deaths.

NHS staff off for covid 19 (notice NOT corona) related reasons. Child care, self reporting symptoms to isolate in the good weather – is it that curious higher than average attack by covid 19 affecting the public sector – those with low motivation.

Finally verbatim again from Scot Gov:

“Scottish numbers: 2 August 2020
-31 new confirmed cases of COVID-19; this is 1.1% of newly tested individuals

– 8,243 new tests for COVID-19 that reported results”


Once again 31 is not 1.1% of 8,243. This remains unexplained.
Newly tested individuals // new tests … that reported results.

https://www.gov.scot/publications/coronavirus-covid-19-daily-data-for-scotland/

Also from Scot Gov 2 August:
– 0 new reported death(s) of people who have tested positive (noting that Register Offices are now generally closed at weekends)

– 3 people were in intensive care last night with confirmed COVID-19

– 265 people were in hospital with confirmed COVID-19


There is transparency and then there is this.

74301 ▶▶ A. Contrarian, replying to Basics, 3, #543 of 1428 🔗

Re. the two different numbers of tests, I suspect the first (lower) number is the number of individual people tested, whereas the second number is the total number of tests carried out altogether, which is larger because many people are tested more than once.

74305 ▶▶▶ Basics, replying to A. Contrarian, #544 of 1428 🔗

In which senarios would there be call for a second test?

74309 ▶▶▶▶ DressageRider, replying to Basics, #545 of 1428 🔗

To check the first result?

74310 ▶▶▶▶ A. Contrarian, replying to Basics, 3, #546 of 1428 🔗

If someone tests negative but has symptoms and is suspected to have covid. I know someone who had three tests before getting a positive result. I believe there have also been issues with them counting throat and nose swabs from the same person as two separate tests. At one point they were also including tests from NHS workers and others who have regular tests but I’ve got a feeling they stopped that a while back.

74336 ▶▶▶▶▶ Basics, replying to A. Contrarian, 1, #547 of 1428 🔗

Thanks for your answer. These figures do not making reasonable reading, which is afterall the point of publishing them.

Three tests before they got the test they wanted. Seems like a poor test. A positive test therefore unlocks the covid drugs cabinet to that patient I presume.

It is a large difference 22k – 78k for it to be procedure for 3 tests. 125 postives as a result. Even half 22k indicates a very low ratio of success with a single test + confirmation 2nd = 250 total.

Confirming nagatives 22k × 2.

74344 ▶▶▶▶▶▶ A. Contrarian, replying to Basics, 2, #548 of 1428 🔗

I agree, it’s a big difference, maybe too many to be explained by duplicate tests alone, but that’s probably part of it.

Three tests before a positive is ridiculous. It makes me wonder if he did in fact have covid, but he ended up very ill on a ventilator so there was definitely something quite wrong. They were already treating him as covid so I’m not sure why they were quite so desperate for a positive test. Just for the numbers I suppose!

74569 ▶▶▶▶ Nobody2020, replying to Basics, #549 of 1428 🔗

If they’re coaches for a football team and the season is about to begin.

74352 ▶▶▶ dpj, replying to A. Contrarian, 7, #550 of 1428 🔗

As many people have said before this is so contagious that you can’t sing in church, have to stay 2m away, wear a mask etc but they struggle to test you. Surely if your breath is so full of virus they could easily test you with some sort of breathalyser?

74398 ▶▶▶▶ Carrie, replying to dpj, 4, #551 of 1428 🔗

Need to add that to our campaign leaflet!

74407 ▶▶ IMoz, replying to Basics, 2, #552 of 1428 🔗

Even at 1% false positive rate 22k tests that’s upto 220 false positives, how many tested positive again?..

74329 Tim Bidie, replying to Tim Bidie, #553 of 1428 🔗

We know Covid 19 affects different communities differently

‘There is evidence of a wide disparity in deaths from COVID-19 amongst BAME people compared to white health and care workers in the United Kingdom (around 2/3rds of healthcare staff who have died are from a BAME background, whereas they make up around 20% of the overall workforce).’

https://www.rcpsych.ac.uk/docs/default-source/about-us/covid-19/impact-of-covid19-on-bame-staff-in-mental-healthcare-settings-report-2020.pdf?sfvrsn=22a9083a_2

But no-one has yet convincingly explained why. There is one explanation which, since it applies across Europe rather than just in Britain, seems, to me at least, to have legs.

‘…..some subgroups of migrants, including refugees, asylum seekers, and irregular migrants are particularly vulnerable to infectious diseases and may have worse health outcomes than the host population. In a number of EU/EEA Member States, subgroups of migrant populations are disproportionately affected by infectious diseases such as tuberculosis, HIV, and hepatitis B and C. Consequently, screening and vaccination programmes may be of benefit for newly arrived migrants, i.e. those who have arrived in the EU/EEA within the past five years.’

https://www.ecdc.europa.eu/sites/default/files/documents/Public%20health%20guidance%20on%20screening%20and%20vaccination%20of%20migrants%20in%20the%20EU%20EEA.pdf

It looks quite likely that BCG vaccination may give protection against covid 19, indicated by the low incidence of covid 19 in countries, Japan, Korea, Greece etc which still have community BCG vaccination programs nationwide. But many migrants may very well not have had BCG vaccination.

So the continuing measures across Europe that fly in the face of the blindingly obvious, that covid 19 is over bar the shouting, may be explained by a noble intention, and that is to the European governments and, indeed, our credit: to protect vulnerable minorities

But, for that protection to be properly reinforced, unfortunately we will all have to wait

‘Murdoch Children’s Research Institute has organized BRACE, a Phase 3, two-group, multicenter, open-label, randomized, controlled trial of up to 4170 health care workers in Australian hospitals to determine if BCG vaccination reduces the incidence and severity of COVID-19 during the 2020 pandemic. Primary results are expected in October 2020, and full study results are expected in March 2022.’

lifespan.io

74351 ▶▶ RickH, replying to Tim Bidie, 3, #554 of 1428 🔗

The differences between countries are pretty obviously a multi-variate problem. It’s a mistake to look for single variables, and will take a long time to untangle – particularly because data is so incredibly corrupted.

As a gut reaction as to what the overall shape of enquiry should be, I reckon Karl Friston is on the right lines – big brain and rational framework :

https://unherd.com/2020/06/karl-friston-up-to-80-not-even-susceptible-to-covid-19/

74366 ▶▶▶ Tim Bidie, replying to RickH, #555 of 1428 🔗

‘Immunological dark matter’ could indeed be one explanation for covid 19 immunity.

But I know where my money is:

The current evidence about BCG vaccination and prevention of acute respiratory infections is of high quality, as it is supported by results from 2 systematic reviews (one including meta-analysis) and 4 RCTs, which provide high level of evidence for prevention studies.’

https://www.cebm.net/covid-19/does-bcg-vaccination-protect-against-acute-respiratory-infections-and-covid-19-a-rapid-review-of-current-evidence/

‘After mitigating multiple confounding factors, several significant associations between BCG vaccination and reduced COVID-19 deaths were observed.’

‘Results fail to confirm the null hypothesis of no association between BCG vaccination and COVID-19 mortality, and suggest that BCG could have a protective effect.’

https://www.pnas.org/content/117/30/17720

And, by October 2020, we should have some even stronger indications, one way or the other.

74371 ▶▶▶▶ Country Mumkin, replying to Tim Bidie, 2, #556 of 1428 🔗

Very interesting. I had BCG vaccine 20 years ago as a young adult. I wonder if it is still valid.

74380 ▶▶▶▶▶ Tim Bidie, replying to Country Mumkin, 4, #557 of 1428 🔗

If you come from Alaska, then I can assist:

‘In this trial, BCG vaccine efficacy persisted for 50 to 60 years, suggesting that a single dose of an effective BCG vaccine can have a long duration of protection.’

https://pubmed.ncbi.nlm.nih.gov/15126436/

74387 ▶▶▶▶▶▶ Country Mumkin, replying to Tim Bidie, 4, #558 of 1428 🔗

Ooh, good knowledge. Thanks Bidie. I’ll save that one for ‘no sorry, I’m not having the Covid-19 vaccine because my BCG vaccination will cover it’. And ‘my daughter is a no-thanks too, because she she’s too young to transmit and won’t be impacted by illness’.

74433 ▶▶▶▶ Carrie, replying to Tim Bidie, 2, #559 of 1428 🔗

Someone asked me yesterday if Swedes were vaccinated with the BCG vaccine. Just looked it up; here is the answer, direct from our Public Health authority:

Until the mid-1970s, BCG vaccination was routinely performed in ‘BB’ (which is the maternity department of a hospital – don’t know if that means they injected babies?) in Sweden. Nowadays, vaccination is only offered to children in certain risk groups.

Vaccination is recommended for:

  • children up to 6 years of family origin from a country with increased or high TB incidence
  • and to children and adolescents up to the age of 18 who, according to the following criteria, are at increased risk of being infected:
  • current TB at a close relative or household contact
  • before a planned longer (more than three months) stay in a country or area with a high incidence of TB, if the child comes into close contact with the local population.
74491 ▶▶▶▶ Major Panic, replying to Tim Bidie, 1, #560 of 1428 🔗

So it’s not our wonderful immune system that’s protecting us – it’s a vaccine

74526 ▶▶▶▶▶ Carrie, replying to Major Panic, 2, #561 of 1428 🔗

Possibly *enhancing* protection in age groups who would otherwise be more vulnerable?
Younger people who haven’t had the BCG must be using their immune system… Seems it is BAME young people who are not immune – but that is likely due to less vitamin D absorption in dark skinned individuals..

74340 Sam Vimes, replying to Sam Vimes, 6, #562 of 1428 🔗

Off topic, but we need some relief. The Dragon Endeavour space capsule is returning from the ISS tonight, splashdown expected at 19:45 BST. This is human achievement and real science, rather than ‘the’. Let’s hope all goes well. Live stream available on Youtube.

74356 ▶▶ Achilles, replying to Sam Vimes, 1, #563 of 1428 🔗

Do you think they’ll be quarantined?!

74362 ▶▶▶ Sam Vimes, replying to Achilles, 4, #564 of 1428 🔗

Absolutely. That bastard virus knows whether you are in a pub or a park, so it can probably survive vacuum and even re-entry. Then again, are the astronauts from more than one household? Then again, do we really give a flying fuck?

74343 Hammer Onats, replying to Hammer Onats, 7, #565 of 1428 🔗

Democracy in the UK: Government of the cretins, by the cretins, for the cretins.

74390 ▶▶ anon, replying to Hammer Onats, 1, #566 of 1428 🔗

the blind leading the blindest

74421 ▶▶ Cheezilla, replying to Hammer Onats, 1, #567 of 1428 🔗

“A democracy is run by those who care
For those who don’t care.”

Well those currently running our country clearly don’t care, so …..

74345 Tenchy, #568 of 1428 🔗

Another off topic but – who’s that Conservative MP?

74346 A. Contrarian, replying to A. Contrarian, 5, #569 of 1428 🔗

#HancockMustGo on Simon Dolan’s twitter feed today. I don’t do Twitter so I can’t join in, but I give it 100% support.

74348 ▶▶ A. Contrarian, replying to A. Contrarian, #570 of 1428 🔗

And this. Weekly care home testing abandoned.

https://twitter.com/doctor_oxford/status/1289821262471000064/photo/1

Disgusting.

74392 ▶▶▶ RickH, replying to A. Contrarian, 3, #571 of 1428 🔗

No – not really ‘disgusting’. The testing causes as many problems as it pretends to solve.

74420 ▶▶▶▶ Hubes, replying to RickH, 3, #572 of 1428 🔗

All testing should be abandoned

74424 ▶▶▶▶▶ Carrie, replying to Hubes, 2, #573 of 1428 🔗

I think we need to get some intelligent young people like Poppy to repeatedly point out to their peers that if you get tested it will lead to more restrictions and lockdowns – is that what young people really want??? I know students are unhappy that they will be paying fees for a uni experience that is 90% going to be delivered online – surely that point can be got across? Ie, if you want a normal uni experience, do NOT get tested!

74476 ▶▶▶▶ A. Contrarian, replying to RickH, #574 of 1428 🔗

In the general population yes. But personally I think it has some place amongst vulnerable people, if used in the right way. And more than anything it shows a complete disregard of care homes by the govt, despite the carnage already suffered during lockdown.

74851 ▶▶ richard riewer, replying to A. Contrarian, #575 of 1428 🔗

Cancel Matt.

74355 swedenborg, replying to swedenborg, 11, #576 of 1428 🔗

https://www.charite.de/en/service/press_reports/artikel/detail/could_prior_exposure_to_common_cold_viruses_affect_the_severity_of_sars_cov_2_symptoms/
Press release Updated preprint published in Nature
 “The researchers found that one in three people with no prior exposure to SARS-CoV-2 nonetheless have T-helper cells capable of recognizing the virus. The likely reason for this is that SARS-CoV-2 shares certain structural similarities with coronaviruses which are responsible for the common cold. “This suggests that the T-helper cells of healthy individuals react to SARS-CoV-2 because of previous exposure to the endemic ‘common cold’ coronaviruses,” says Dr. Giesecke-Thiel. She goes on to explain: “One of the characteristics of T-helper cells is that they are not only activated by a pathogen with an ‘exact fit’, but also by pathogens with ‘sufficient similarity’.” Notably, the researchers were able to show that the T-helper cells isolated from healthy participants who reacted to SARS-CoV-2 were also activated by various ‘common cold’ coronaviruses – displaying what is known as ‘cross-reactivity’.

74388 ▶▶ RickH, replying to swedenborg, 3, #577 of 1428 🔗

See Professor Sunetra Gupta (Oxford)

… but you’ll hear much more from time serving Big Pharma brown-nosers.

74402 ▶▶ IMoz, replying to swedenborg, 2, #578 of 1428 🔗

Most probably this is the reason why so many are “asymptomatic”—their immune system can cope with the infection as a matter of course!

74357 tallandbald, replying to tallandbald, 11, #579 of 1428 🔗

https://www.youtube.com/watch?v=6mzJ4kkJqeU

I would pay lots of money to see congressman Jordan interrogate Mancock like he just did to Fauci on the first 5 minutes of this video.

74376 ▶▶ Nick Rose, replying to tallandbald, 1, #580 of 1428 🔗

Priceless.

74605 ▶▶ Kath Andrews, replying to tallandbald, #581 of 1428 🔗

Watched that earlier today, yes, I agree.

74358 anon, replying to anon, 3, #582 of 1428 🔗

SURE IS SOMETHING SLICK GOIN ON

Ain’t that a bitch – Johnny Guitar Watson

https://m.youtube.com/watch?v=3sYUthjyTb8
lyrics are quite appropriate – plus ça change

happy Sunday everyone

74852 ▶▶ richard riewer, replying to anon, 1, #583 of 1428 🔗

Johnny Guitar Watson. Yessir! Wynonie Harris, Cleanhead Vinson, Big Joe Turner, Champion Jack Dupree, Elmore James …

74359 Lorenzo Basso, replying to Lorenzo Basso, 15, #584 of 1428 🔗

Just wondering… do any of you know a single person who has a (symptomatic) case of COVID-19 in the UK right now? I know three people who had the symptoms back in March/April and recovered, but I can’t find anyone who has it now.

74367 ▶▶ Nick Rose, replying to Lorenzo Basso, 5, #585 of 1428 🔗

Not a soul.

74374 ▶▶ matt, replying to Lorenzo Basso, 3, #586 of 1428 🔗

Nope. Well, my 8 year old has a bit of a cough and he had a temperature for about an hour today. Does that count?

74412 ▶▶▶ Cheezilla, replying to matt, 2, #587 of 1428 🔗

Only if you get her tested.

74501 ▶▶▶▶ guy153, replying to Cheezilla, 1, #588 of 1428 🔗

Don’t get her tested.

74696 ▶▶▶▶▶ matt, replying to guy153, 2, #589 of 1428 🔗

Him. No. Mostly, I’ve been thinking what a pain in the neck it would be. We’ve got my mother with us and she’s a GP and lives with my sister who’s a completely bed-wetting anaesthetist.

75149 ▶▶▶▶▶▶ guy153, replying to matt, 1, #590 of 1428 🔗

And the dreaded sister’s husband who has been discussed here before. Basically it means taking the poor kid to a car park where some drongo will shove a cotton bud up his nose. I don’t think he will like it. Why should you put him through that just to help Hancock be able to say he’s hit some stupid target number of tests he made up for himself?

74375 ▶▶ janis pennance, replying to Lorenzo Basso, 1, #591 of 1428 🔗

Nope

74385 ▶▶ RickH, replying to Lorenzo Basso, #592 of 1428 🔗

No

74408 ▶▶ DressageRider, replying to Lorenzo Basso, #593 of 1428 🔗

no

74409 ▶▶ Cheezilla, replying to Lorenzo Basso, #594 of 1428 🔗

No

74432 ▶▶ Tyneside Tigress, replying to Lorenzo Basso, 2, #595 of 1428 🔗

I’ll join the long list too. No. Not come across a single person in my area who knows anyone either.

74450 ▶▶▶ MiriamW-sometimes-AlanG, replying to Tyneside Tigress, 2, #596 of 1428 🔗

Me too – nobody. I keep asking people as well but nobody knows anyone who has had it since March, and most don’t know anyone at all. There were only 3 I can be sure of inis area. All recovered quite quickly by the way and 2 of them had it ‘badly’, caught in hospital.

74471 ▶▶▶▶ Bruno, replying to MiriamW-sometimes-AlanG, 2, #597 of 1428 🔗

Possibly because you don’t know anyone who works in a slaughterhouse, Amazon warehouse, test and trace call centre, or picking fruit.

74449 ▶▶ tonys, replying to Lorenzo Basso, #598 of 1428 🔗

During the whole lockdown period I do not know anyone who has had Covid 19, either a mild case or hospitalised, I do know someone however who has been attacked and seriously injured by a cow.

74453 ▶▶ Andy C, replying to Lorenzo Basso, 3, #599 of 1428 🔗

Not one. I haven’t even heard of anyone who’s tested positive since March.

74456 ▶▶ Bart Simpson, replying to Lorenzo Basso, #600 of 1428 🔗

Nope.

74489 ▶▶ Mr Dee, replying to Lorenzo Basso, #601 of 1428 🔗

Nope.

74523 ▶▶ Harry hopkins, replying to Lorenzo Basso, #602 of 1428 🔗

The ‘symptoms’ of Covid19 seem to be completely meaningless. All of the so called symptoms are included on the warning leaflet of any prescribed medicine. My anti histamine pills list ALL the Covid symptoms and many more—it’s a load of bo*lox and that’s a fact.

74525 ▶▶ DRW, replying to Lorenzo Basso, #603 of 1428 🔗

Nope.

74562 ▶▶ DocRC, replying to Lorenzo Basso, #604 of 1428 🔗

No

74566 ▶▶ Chicot, replying to Lorenzo Basso, #605 of 1428 🔗

Nope.

74681 ▶▶ Suitejb, replying to Lorenzo Basso, #606 of 1428 🔗

Nope!

74776 ▶▶ BTLnewbie, replying to Lorenzo Basso, #607 of 1428 🔗

None at all for many weeks.

Knew of a couple in March / April, when there seemed to be a nasty virus going round – thank goodness it’s cleared up now!

74373 Poppy, replying to Poppy, 26, #608 of 1428 🔗

My bf and I took a train through the North West today, via Manchester – pleased to say that the carriages were surprisingly busy for Sunday (it was an extra long train as well, two smaller trains stuck together), almost like normal times. Hardly any social distancing going on. I wore a muzzle to get on the train but as soon as I sat down I pulled it down to my chin and kept it there for the remainder of the journey. Baby steps, I’m not quite confident enough to go totally maskless yet because I feel quite daunted by judgemental Karens and I don’t want to attract confrontation but we’re doing our weekly shop tomorrow so I might try going barefaced then, I’ll bring my bf along for moral support. It sounds like a lot of you on here have gone maskless in shops with no aggro so here’s hoping!

74391 ▶▶ Kelly deacons, replying to Poppy, 8, #609 of 1428 🔗

I have now done quite a few with no problems at all.However,everytime I shop I see more and more bare faces!good luck!

74576 ▶▶▶ Lili, replying to Kelly deacons, 3, #610 of 1428 🔗

That’s great news, Kelly. Every new bare face is a small victory.

74397 ▶▶ bluefreddy, replying to Poppy, 11, #611 of 1428 🔗

Go for it Poppy. I haven’t worn a mask yet, and I’ve been in shops, on the underground, to the cinema, to a museum… Just go shopping like you used to, and forget about the crazy situation.

74418 ▶▶ annie, replying to Poppy, 5, #612 of 1428 🔗

You’re doing fine,I admire you!

74439 ▶▶ Sam Vimes, replying to Poppy, 10, #613 of 1428 🔗

Forget the mask. Smile. Show the world your lovely face. If asked, another smile and “I’m exempt, thank you”. You can do it, honest.

74454 ▶▶ Bart Simpson, replying to Poppy, 6, #614 of 1428 🔗

Go for it Poppy. I’ve not been wearing them (due to medical condition) and have not had any problems. I don’t think you will either.

74457 ▶▶ smileymiley, replying to Poppy, 5, #615 of 1428 🔗

Go for it Poppy & smile! They don’t like it when you smile at them. Not worn a mask yet or will ever.

74485 ▶▶ TJN, replying to Poppy, 4, #616 of 1428 🔗

No need whatsoever to wear a muzzle. If you do it just the once, you’ll realise you don’t have to do it at all. And you’re exempt anyway.

74552 ▶▶ Farinances, replying to Poppy, 6, #617 of 1428 🔗

Just act completely normal, like you’ve never even seen a person in a mask. (Which can prove difficult when you walk in and see them all. Eerie.) Nobody reacts, they just kinda ignore you pointedly. You may get a few stares which are easy to ignore. Unless you want to piss them off a bit, in which case, smile.

74707 ▶▶▶ Carrie, replying to Farinances, 1, #618 of 1428 🔗

Important to keep body language confident. If you do not feel confident, imagine you are someone that you know who has oodles of self-confidence, and act like you are that person!

74723 ▶▶▶▶ Farinances, replying to Carrie, #619 of 1428 🔗

Lol yeah good point. For me confident is normal 😉

74574 ▶▶ Lili, replying to Poppy, 6, #620 of 1428 🔗

Well done, Poppy. You have to do things at your own pace. I did my first brief visit to a shop today. I had my headphones in, in case anyone tried to get my attention and tried to keep my back turned to people so they couldn’t see I wasn’t muzzled. My ‘line’ if asked is ‘I have a heart condition’, because it’s my truth. My heart condition is that I care about what this government has done to people and I will do what is within my power, to put a stop to the fear.

74579 ▶▶ Kath Andrews, replying to Poppy, 5, #621 of 1428 🔗

First week of muzzle wearing in sunny Wales – Monday, nervous as hell, got on the bus (no mask) – the driver said (in an unfriendly tone) ‘where’s your mask love?’, I just said ‘I’m exempt’, gave a pleasant smile, fine – I was the only unmasked person, bus a third full. Tuesday no issues, same with Friday and Saturday. Took a couple of taxis in the week, no questions asked. On Friday accompanied someone to a GP appointment (I work in social care), unmasked – the GP was in full PPE – she didn’t bat an eyelid to the fact that I wasn’t wearing a mask or any other kind of PPE.

74377 anti_corruption_tsar, 5, #622 of 1428 🔗

UK government exposed for telling lies:

https://www.zerohedge.com/geopolitical/austria-confirms-opcw-report-skripal-faking-british-exposes-ft-lies-cover

I was called a conspiracy theorist and worse at the time for exposing all the inconsistencies in the official narrative on this at the time. Are those people going to apologise and admit they were wrong? Do pigs fly?!

Notice how there is nothing in the mainstream media about this surprise surprise. And if they’d lie to you about the biggest story in the first half of 2018, then surely they wouldn’t lie to you about anything else would they including Covid?

74396 Hubes, replying to Hubes, 15, #623 of 1428 🔗

It really pisses me off that the test they use is completely not fit for purpose, it can’t distinguish between a multitude of viruses and non-infectious RNA, yet the results they get from it play the key role in deciding what shambolic rules they chose to implement.

Testing positive is the equivalent of testing positive for drink driving even though you’ve not had an alcoholic drink. Then you get told you’re losing your driving licence but not just you, all your county are also losing their driving licences too.

The test needs to be completely discredited.

74464 ▶▶ RickH, replying to Hubes, 3, #624 of 1428 🔗

A good summary of the fiction.

74495 ▶▶ guy153, replying to Hubes, 4, #625 of 1428 🔗

Does anyone have a source for this claim that the PCR test gives you false positives because of other viruses? This seems unlikely to me.

I think the test is OK but has its limitations like any test. The biggest problem it’s up against now is that the prevalence is so low it’s well inside the false positive rate of the test (and this is true even though the test has a relatively low, though of course not precisely known, false positive rate).

74585 ▶▶▶ BecJT, replying to guy153, 2, #627 of 1428 🔗

It was also in the WHO testing guidelines, that given that a positive result in a pandemic couldn’t possibly be anything other than Covid, just test for some coronaviruses and it’ll be fine!

74653 ▶▶▶▶ guy153, replying to BecJT, 3, #628 of 1428 🔗

OK thanks everyone, I was sure I had seen that somewhere.

Now for the fact-checking. This seems to be what the fuss is about:

“If the sample was analyzed using the Roche method, we have given the measurement results for both target sequences of the PCR (ORF1 and E genes) separately. The ORF1 gene is specific for SARS-CoV-2, while the E gene is also found in other corona viruses. We have already rated the cases in which only the ORF gene was amplified as positive. […]Taking into account the epidemiological situation and the overall increased positive rate, we are now following the WHO recommendation and will issue a result as “positive” if only the E gene has been amplified.”

(from https://web.archive.org/web/20200417112824/http:/www.labor-augsburg-mvz.de/de/aktuelles/coronavirus translated from the German by Google).

Now it seems the reason they were looking for the E gene was that they developed this test before SARS2 had been completely sequenced. The E gene is common to SARS1 and SARS2 and so they were able to make a preliminary good-enough test:

https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf

“We designed candidate diagnostic RT-PCR assays before release of the first
sequence of 2019-nCoV”

OK fine. But the other document said the E gene was found in “other coronaviruses”. So which ones?

The actual E-genes they’re looking for are:

ACAGGTACGTTAATAGTTAATAGCGT,
ATATTGCAGCAGTACGCACACA and
ACACTAGCCATCCTTACTGCGCTTCG

(source: https://www.who.int/publications/m/item/molecular-assays-to-diagnose-covid-19-summary-table-of-available-protocols )

I downloaded all the known human coronavirus genomes from here: https://www.ncbi.nlm.nih.gov/genomes/GenomesGroup.cgi?taxid=11118

These are 229E, HKU1, NL63, OC43, SARS1 and SARS2. Then I searched for those genes in all six of these genomes. The first one appears in SARS1 and SARS2 and no others. So does the third one. The second one surprisingly doesn’t appear in any!

Apart from my failure to detect the second gene this makes sense– the Roche researchers presumably guessed at bits of SARS1 until they found something that matched on a SARS2 sample and that they knew wasn’t in 229E etc. (since those have all been sequenced and they could just download the genomes like I did).

So I think if you only have an E-gene match you have SARS2 or SARS1 (or it’s a false positive). It’s more likely to be SARS2 as SARS1 has not been seen for quite a few years. But anyway, SARS1 is like SARS2 only worse, so if you do have SARS1 take it easy, go to bed, and try to infect anyone– the advice is the same. You don’t have 229E, OC43, or any of those. Of course you may be infected with an unknown close relative of SARS1 and SARS2, but if you are, you should probably treat it the same anyway.

We also don’t know whether the actual tests in use now in the UK are only looking for E. I would hope they match on a few other genes, especially since they are likely newer tests by which time the whole SARS2 genome was known.

So I think this is all a bit of a stretch (like a lot of other things in that controversial off-guardian article most of this comes from).

The greatest source of false positives in a PCR test is usually thought to be contamination or human error. The false positive rate is low (but to be any use with the prevalence now so low it has to be almost zero).

Your chance of a false positive if you have any other cold is no higher than your chance of false positive anyway. If the authors of that off-guardian article want to prove this instead of just throwing speculation around they need to get some PCR test kits and some people with OC43 etc. infections and demonstrate that they are testing positive.

74702 ▶▶▶▶▶ Bruno, replying to guy153, 1, #629 of 1428 🔗

Many thanks guy 153 for hanging in here and injecting some scientific rigour into the debate.

74734 ▶▶▶▶▶▶ guy153, replying to Bruno, #630 of 1428 🔗

Thanks! Thinking about this some more it’s fairly reasonable to treat an E-only match as a positive for the purposes of quarantining etc. since the test has poor sensitivity. So if you’re positive for E you most likely have ORF1 or whatever else it’s looking for but there just wasn’t quite enough of it to pass the cycle threshold. If I was running Iceland I would ask people to quarantine based on E even if I wouldn’t call it a “diagnosis”.

It’s all completely irrelevant in the UK now but for different reasons. I think this particular WHO update was rational and in good faith.

74726 ▶▶▶▶▶ Hubes, replying to guy153, 1, #631 of 1428 🔗

I’m not very scientific. In simple terms if somebody had a common cold or the flu and not Covid would they 100% test negative with this current test?

75005 ▶▶▶▶▶▶ guy153, replying to Hubes, #632 of 1428 🔗

95% to 99.999% would test negative. If that person didn’t have a common cold or flu, and also didn’t have Covid, then they would also test 95% to 99.999% negative. The other cold makes no difference.

99.999% is a number I pulled out of thin air– the point is it’s something close to 100 but not 100.

75124 ▶▶▶▶▶▶▶ Hubes, replying to guy153, #633 of 1428 🔗

Sorry if this is a stupid question but for the potential 5% that might test positive but didn’t have covid, common cold or flu. How would that happen?

75144 ▶▶▶▶▶▶▶▶ guy153, replying to Hubes, #634 of 1428 🔗

Contamination is the most likely reason as the test works by amplifying the hell out of whatever tiny bits of RNA it found. Maybe the equipment wasn’t cleaned properly between tests, or the samples got contaminated by each other. Another thing that is known to happen is that someone who recovered from Covid some time ago might still have fragments of it around that the test picks up, even though they aren’t viable, are not causing disease and can’t infect anyone.

Another possibility is just someone clicks the wrong box on the computer– doesn’t happen often but will happen some of the time.

But if you have another cold, that virus will not contain the genes the test is looking for, and so there is no reason for it to give you a positive because of that.

75164 ▶▶▶▶▶▶▶▶▶ Hubes, replying to guy153, #635 of 1428 🔗

Thanks. You’ve posted some very useful information on this thread.

Where it picks up harmless fragments from somebody who’s already had it. How long can these fragments stay in the body for?

What do you reckon the split currently is for positive tests between currently infectious and previously had it and now non infectious is?

Is there a certain amount of RNA that needs to be infected before a person could pass the virus on?

75328 ▶▶▶▶▶▶▶▶▶▶ guy153, replying to Hubes, 2, #636 of 1428 🔗

The fragments could stick around for months. But the longer you wait the lower the chance of a false positive from them.

Impossible to say what the current split is– we don’t even know the false positive rate with any certainty. Usually you calibrate it against samples of known true negatives, but these probably aren’t from recovered people.

You need to be infected with probably a few 100 or 1000 complete virus particles for it to actually start replicating in your body so you can pass it on. But the fragments in a recovered patient that might cause a false positive aren’t complete viruses, they’re just smashed-up pieces.

The complete genome for SARS2 is about 30,000 nucleotides (ATTAAAGGTT… etc. about 30,000 of those letters). This is all stuck together inside the little ball with spikes on that we keep seeing pictures of. That sequence is the recipe for how to make a new little ball with spikes.

The tests are looking for a couple of short sections, only about 10 nucleotides long. It’s a bit like going to the scene of a plane crash and finding a bit of twisted metal with “ritish Ai” on it. This tells you it was a British Airways plane that crashed. But that little bit of metal is not going to get up and start flying.

75730 ▶▶▶▶▶▶▶▶▶▶▶ Hubes, replying to guy153, 1, #637 of 1428 🔗

Great explanation. Now I need to try and remember it so I can explain it to other people.

74419 NickR, replying to NickR, 21, #638 of 1428 🔗

This is the first pandemic that’s occurred in the social media age & just look at the consequences. Partly, I think, because of the death of religion (the churches! Talk about an organisation that never misses an opportunity to miss an opportunity!) people now deify themselves. Their Facebook account becomes their shrine, their selfies become their Icons. They construe it as a blasphemy if someone offends them. Then we get into the whole ‘victimhood’ thing. So many people want to star in their very own drama, they seem to want to catastrophise their lives. Their success isn’t measured in their achievements but by the ‘unique’ set of invented ‘set-backs’ they’ve overcome.
They think themselves uniquely sensitive to the suffering of themselves and others. Are they guilty that they live comfortable lives that makes them want to find new ways in which they imagine they’re suffering?
It’s a weird thing. It used to be that when people started paying tax & realised that the only money a government has is that which comes from the taxpayer, which in turn only comes from the profit of businesses, they stopped behaving like spoiled 3 year olds but now this sense of needy entitlement seems to be a lifelong affliction.

74445 ▶▶ Bart Simpson, replying to NickR, 9, #639 of 1428 🔗

Well said. And don’t forget that the hand sanitiser becomes their “holy water” and the face masks becomes their talisman (i.e crucifix, rosary, medals, relics) which they believe will protect them from the virus

74853 ▶▶▶ richard riewer, replying to Bart Simpson, #640 of 1428 🔗

It’s homeopathic.

74472 ▶▶ RickH, replying to NickR, 3, #641 of 1428 🔗

Please leave out the religion bit – there’s enough virus superstition around.

74422 annie, replying to annie, 30, #642 of 1428 🔗

The Zombieville Gazette

Masthead: Stay put, question nothing, be very afraid, think second wave

Obituaries

Mrs Prunaprismia Craven-Bedwetter

We regret to announce the death from Covid 19 of Mrs Craven-Bedwetter, aged 51, which occurred on 1 August.

Mrs Craven-Bedwetter was one of our early lockdown heroines, having spent twenty-five weeks in total self-isolation without leaving her one-bedroomed flat. She was in excellent health, but the wise woman knew that you couldn’t be too careful.

Her shopping was done by a neighbour, Mrs Lucy Goodheart, who left the shopping outside Mrs C-B’s door. Mrs C-B never exchanged a single word with Mrs Goodheart, being well aware that the virus can be passed on well within the time it takes to say ‘thank you’. And she always set an example by spraying all her groceries with neat bleach. ‘It makes the fruit and veg taste a bit odd,’ she once tweeted, ‘but it’s worth it to be sure that they are totally safe to eat.’

[Note: Mrs Goodheart, who is 82, has been detected in numerous illicit excursions from her home, and has delivered shopping to many local residents at the risk of spreading the virus. Loyal Zombies will be disturbed to learn that despite this reprehensible behaviour, Mrs Goodheart appears to continue in excellent health and spirits and has been seen several times to sink a pint in the local Wetherspoons. Worse still, she has not paid for any of these drinks because deluded locals have been buying them for ‘our dear, valiant old girl’. We cannot over-emphasise how much loyal Zombies should condemn such dangerous conduct.]

Mrs C-B was a founder member of Zombieville’s celebrated ‘Snitch on your Neighbour’ movement and repeatedly contacted the police to demand drastic action against those whom, from behind those virtuous lace curtains, she had observed criminally behaving like human beings. One example of her righteous anger must suffice. When she realised that Ginny Tearaway (15) was taking 35 minutes’ exercise every day instead of 30, Mrs C-B telephoned the police to insist that they sent a drone to follow Ms Tearaway’s every move, and have her arrested and fined the instant her 30 minutes were up. Mrs C-B’s anger when told that no drones were available, because they had all been sent to spy on walkers in the Pennines, nearly set Twitter on fire! Few can aspire to such a degree of spite. We can only envy and admire her achievements.

Mrs C-B’s end was a sad one. Misled by false, extreme-right-wing propaganda to the effect that it was now acceptable for shielding people to go out, and knowing that face masks are guaranteed to keep you safe, she unfortunately fastened one so tightly round her nose and mouth that at the corner of her street she fainted, fell into the road, and was crushed flat by a lorry. Her death from Covid was certified on her arrival at NoHope hospital, whose valiant and self-sacrificing staff, Tik-Tokking on so bravely in an empty building with no patients, she had never ceased to praise in her tweets.

We salute a true Bedwetter.

74448 ▶▶ Cheezilla, replying to annie, #643 of 1428 🔗

Brilliant!

74855 ▶▶ richard riewer, replying to annie, #644 of 1428 🔗

N. F. Simpson, ‘A Resounding Tinkle’.

74427 Basics, replying to Basics, 2, #645 of 1428 🔗

Being reported in the guardian as a possible measure is blocking london in. Around the M25. As is clear the goverment are attacking the nation pyschologically and so whether this is just a story to destabilise or an actual fact is debateable. That it is even an alleged government concept is of note.
From the guardian:
M25 road block
To stop a major surge in London spreading across the country, ministers are considering advising no travel for Londoners past the M25, effectively isolating the capital city. In practice this would be ialmost impossible to police and highly disruptive for the 9 millon people living in the city. It would have to take the form of guidance rather than an edict and could lead to anger against any Londoners found elsewhere in the country.

74428 ▶▶ annie, replying to Basics, 7, #646 of 1428 🔗

It would lead to anger amidst many Londoners found in London!

74434 ▶▶ Farinances, replying to Basics, 6, #647 of 1428 🔗

I think this would be the riot straw.

74436 ▶▶▶ Carrie, replying to Farinances, 3, #648 of 1428 🔗

Especially if done just before Christmas..

74447 ▶▶▶▶ Martin Spencer, replying to Carrie, 1, #649 of 1428 🔗

Doing it just before Christmas wouldn’t be a problem, surely?

Virtually everybody would have bought their presents and food and drink, and Christmas Day and Boxing Day tend to be quiet.

They’d need to do it 7-10 days before to properly f@ck us.

74519 ▶▶▶▶▶ Carrie, replying to Martin Spencer, 2, #650 of 1428 🔗

Well that was what I meant by ‘just before’!

74856 ▶▶▶▶▶ richard riewer, replying to Martin Spencer, #651 of 1428 🔗

Let us pray that the ghost of Christma Past drops by and knocks on his chamber door.

74492 ▶▶▶ Jay Berger, replying to Farinances, 1, #652 of 1428 🔗

Bring it on!

74437 ▶▶ Ned of the Hills, replying to Basics, 7, #653 of 1428 🔗

Will there come a point when people will begin saying: enough’s enough?

74446 ▶▶▶ Dave #KBF, replying to Ned of the Hills, 5, #654 of 1428 🔗

No sign of it yet.

74466 ▶▶▶ Achilles, replying to Ned of the Hills, 6, #655 of 1428 🔗

Nope, because that point has been and gone. People will take virtually anything now.

74512 ▶▶▶ Azoumi, replying to Ned of the Hills, 1, #656 of 1428 🔗

maybe when they start to tell the over 50’s they have to stay at home and “shield”???

74458 ▶▶ Cheezilla, replying to Basics, 2, #657 of 1428 🔗

Guidance, schmidance.

This was reported in the S.Times article as part of the “war games.”

74465 ▶▶ A. Contrarian, replying to Basics, 2, #658 of 1428 🔗

Will Boris & Co be barricaded in too?

74499 ▶▶▶ Cheezilla, replying to A. Contrarian, 2, #659 of 1428 🔗

They’ll do a Ferguson.

74578 ▶▶ Bella, replying to Basics, 1, #660 of 1428 🔗

Then I suggest anyone who has a car gets in it and drives to M25. A couple of million might do it. And look at the lives they won’t save

74430 JulieR, replying to JulieR, 1, #661 of 1428 🔗

If the schools don’t open properly can I sue the government for denying my child an education?

74435 ▶▶ Carrie, replying to JulieR, 3, #662 of 1428 🔗

Probably not – Simon Dolan argued that schools were closed, under the ‘right to an education’, and the government’s defence was that they did not close (because they were open for key workers’ children) and that closure was only a recommendation. This despite their being video evidence of Boris saying schools would be closed!

74478 ▶▶▶ guy153, replying to Carrie, 1, #663 of 1428 🔗

So in that case can JulieR sue the school?

74517 ▶▶▶▶ Carrie, replying to guy153, #664 of 1428 🔗

I’m no lawyer, maybe Francis Hoar can answer that?

74604 ▶▶▶▶ matt, replying to guy153, #665 of 1428 🔗

Good point. Hmmm.

74580 ▶▶▶ BecJT, replying to Carrie, 2, #666 of 1428 🔗

He’s appealing though, sometimes judges give a decision they know is wrong, as they don’t want it on their watch, and it’s a way of kicking it up to a higher court, might have been what the judge was doing, not fancying going down in history with that on his CV. When’s the appeal ruling?

74440 Bart Simpson, replying to Bart Simpson, 10, #667 of 1428 🔗

Having spoken to some people who are asthmatic and aware of others who should not be wearing muzzles but are still wearing them, it’s depressing to note that they’re not really aware that they are exempt. They have fallen for that old chestnut of wearing muzzles to protect others and are unaware that its more the muzzles that could kill them and not the virus. Something tells me that either they’re being bullied or their GPs have been negligent in telling them that they should not be wearing muzzles and why.

74442 ▶▶ Dave #KBF, replying to Bart Simpson, 9, #668 of 1428 🔗

Hi Bart you are correct, I have seen some many people in shops who clearly should not be reducing their air intake.

These are probably good people doing the right thing but harming themselves.

74462 ▶▶▶ Bart Simpson, replying to Dave #KBF, 8, #669 of 1428 🔗

I see loads of people out and about who should definitely not be wearing them. An old man visited the museum where I worked last week who definitely didn’t look well while wearing a muzzle and he looked so relieved after I told him that he didn’t need to wear it as he went around.

74535 ▶▶▶ MiriamW-sometimes-AlanG, replying to Dave #KBF, 1, #670 of 1428 🔗

The right thing? Wearing masks?

74443 ▶▶ IMoz, replying to Bart Simpson, 7, #671 of 1428 🔗

You’ll be surprised: we’ve got an asthmatic living in our block of flats, he goes way OTT on both gloves and masks, I asked him why he said he’s in the “at risk category”… I asked him if he spoke to his GP about it, he’s adamant that he knows what he’s doing without talking to his GP…

74455 ▶▶▶ Cheezilla, replying to IMoz, 4, #672 of 1428 🔗

Under normal circumstances, not consulting his GP would be sensible of him.

74459 ▶▶▶▶ IMoz, replying to Cheezilla, 2, #673 of 1428 🔗

He’s got signs of a neuro-degenerative disease so him not talking to his GP about this seems strange…

74470 ▶▶▶ Bart Simpson, replying to IMoz, 3, #674 of 1428 🔗

If you want an example of even more OTT behaviour, a few days’ ago, saw a woman both in gloves and mask in the underground but went one step further – used newspapers to cover the seats where she was going to park her bum and bags.

74477 ▶▶▶▶ IMoz, replying to Bart Simpson, 1, #675 of 1428 🔗

I wonder how many others thought it was a good idea and started copying 😉

74479 ▶▶▶▶▶ Bart Simpson, replying to IMoz, 1, #676 of 1428 🔗

😂 😂

74688 ▶▶▶▶ annie, replying to Bart Simpson, 2, #677 of 1428 🔗

Grauniad, I hope.. Best place for it.

74893 ▶▶▶▶▶ Bart Simpson, replying to annie, #678 of 1428 🔗

It was the Metro 🙂

74460 ▶▶ A. Contrarian, replying to Bart Simpson, 4, #679 of 1428 🔗

Not sure GPs are fussed about it either way!

74463 ▶▶▶ Bart Simpson, replying to A. Contrarian, 6, #680 of 1428 🔗

GPs have been useless throughout this crisis methinks.

74473 ▶▶ AllieT, replying to Bart Simpson, 7, #681 of 1428 🔗

It’s NHS England policy that GPS do not provide evidence of exemption :o( have seen the email I work in a surgery. It’s apparently ‘self declaring’ but you don’t have to provide evidence.

74482 ▶▶▶ Bart Simpson, replying to AllieT, 5, #682 of 1428 🔗

I have tried telling people who I think should be exempt to get themselves lanyards however sadly it just falls on deaf ears.

74490 ▶▶▶▶ Jay Berger, replying to Bart Simpson, 1, #683 of 1428 🔗

They are too busy with and valueing most pseudo-science based pseudo-virtue-signalling and ensuring that they aren’t be presumed to act conspicuously.
Therefore, any damage they incur hereby serves them absolutely right.

74494 ▶▶▶▶▶ Bart Simpson, replying to Jay Berger, #684 of 1428 🔗

Unfortunately you’re right and I think some of them could be fervent lockdownistas as well. Others are genuinely scared and have been relying on MSM.

74497 ▶▶▶▶ AllieT, replying to Bart Simpson, 1, #685 of 1428 🔗

That’s awful they should! why are ppl so cowed by the govt. Tbh some of our GPS have been great continuing to see ppl even tho triage phone call first. It’s not the Drs but govt/NHS England that are dictating policy

74498 ▶▶▶▶ Achilles, replying to Bart Simpson, #686 of 1428 🔗

That’s a quality joke. If it was accidental you can have an uptick anyway.

74486 ▶▶ Jay Berger, replying to Bart Simpson, 1, #687 of 1428 🔗

Obscure government policy and GP advise might then be deliberate in those cases.
Saves them the 100£ for the vaccine.
But then, stupidity and the inability or refusal to think for yourself must and will be punished.

74496 ▶▶▶ Bart Simpson, replying to Jay Berger, #688 of 1428 🔗

True. Its not the virus I think that would kill them but rather a hypercapnia or hypoxic attack would.

74516 ▶▶ Carrie, replying to Bart Simpson, 3, #689 of 1428 🔗

My mum is exempt but is wearing one ‘to set a good example’ to the youth to obey the law (!). Told her it is not law but she is still doing it. Her church even had muzzles today even though that regulation doesn’t come into force till 8th August.. I despair..

74518 ▶▶▶ Bart Simpson, replying to Carrie, 2, #690 of 1428 🔗

Indeed. I think your mum is far gone.Funny how some who are supposed to be exempt are the ones who are virtue signalling over this.

Jesus wept.

74571 ▶▶▶ Bella, replying to Carrie, 10, #691 of 1428 🔗

People have a civic duty to break bad laws

74582 ▶▶▶▶ Carrie, replying to Bella, 1, #692 of 1428 🔗

I pointed that out to my mum…

74771 ▶▶▶ Farinances, replying to Carrie, #693 of 1428 🔗

Careful – those youths may discover they can get away with a lot of shoplifting….

74441 Sam Vimes, 6, #694 of 1428 🔗

Space guys are home safe. Good news.

74444 anon, 1, #695 of 1428 🔗

Carl Vernon is on live

74451 Xenophanes, replying to Xenophanes, 17, #696 of 1428 🔗

It appears that since the wearing of masks were mandated in shops last Friday there has been an increase in cases. As the government is following the data so keenly this will surely lead to a reversal of policy?

74461 ▶▶ Sam Vimes, replying to Xenophanes, 12, #697 of 1428 🔗

What was it Confucious said? “Like fuck”.

74509 ▶▶ Moomin, replying to Xenophanes, #699 of 1428 🔗

Good point, but since it is a good point no one in government will take any notice!

74514 ▶▶ Carrie, replying to Xenophanes, #700 of 1428 🔗

They will just say the increase in cases is the beginning of the second wave..

74544 ▶▶▶ DRW, replying to Carrie, 2, #701 of 1428 🔗

Or that it would’ve been worse without them. The Science (TM) is unfalsifiable.

74650 ▶▶▶ OKUK, replying to Carrie, 1, #702 of 1428 🔗

They will say this shows their policy is working, even though it doesn’t.

74652 ▶▶▶▶ Edward Giles, replying to OKUK, 3, #703 of 1428 🔗

They will say the policy is working because there would have been more cases if they hadn’t mandated mask wearing yet some suckers will still accept this.

74533 ▶▶ MiriamW-sometimes-AlanG, replying to Xenophanes, 1, #704 of 1428 🔗

There has not been an increase in cases.

74587 ▶▶▶ Xenophanes, replying to MiriamW-sometimes-AlanG, 1, #705 of 1428 🔗

According to the government’s own data there has been. So on the first day masks were made mandatory (24th July) there were 768 cases; on 31st July there were 880 – and there’s a similar pattern for other dates and a clear rise in the 7 day average. My point is that since small changes in case numbers can be used to justify draconian local lockdowns, bigger changes should be used to justify a reversal in lockdown measures when they have been ‘shown’ to have the opposite to the desired effect. (Although I’m not naive enough to think they will be.)

74598 ▶▶▶▶ Bella, replying to Xenophanes, 3, #706 of 1428 🔗

They are not effing cases. Get a grip. Cases need medical intervention. If I feel ill and go to bed I’m not an effing case unless I call a doctor. Please don’t pander to this newspeak

74611 ▶▶▶▶▶ Xenophanes, replying to Bella, 2, #707 of 1428 🔗

I’m not pandering to anything- fwiw I think the number of cases, given the number of tests being done, is close to meaningless -and as they aren’t leading to increased hospital admissions or fatalities are completely benign anyway. But nonetheless the government’s own figures show an increase in cases coinciding with the introduction of rules mandating mask usage in shops – as good an argument as any for a reversal in the policy and one that turns the government’s own obsession with case numbers against itself.

74671 ▶▶▶▶ Cambridge N, replying to Xenophanes, 2, #708 of 1428 🔗

Smoke and mirrors from the clown cabal. Call me Mr Occam, but surely the only numbers which matter are a) hospitalisations b) deaths.

74770 ▶▶▶▶▶ Farinances, replying to Cambridge N, 2, #709 of 1428 🔗

Just deaths honestly, the hospitals are so frigging empty

74647 ▶▶ OKUK, replying to Xenophanes, 3, #710 of 1428 🔗

The petard is doing some hoisting!

74468 Bella, replying to Bella, 4, #711 of 1428 🔗

So c’mon Toby, after this update you still think there”s no (not so) hidden agenda?

74483 ▶▶ Country Mumkin, replying to Bella, 9, #712 of 1428 🔗

I totally get why you feel that way Bella. I really do. However, I feel it’s not a line anyone can really fight explicitly. We would be derided as conspiracy theorists. And it’s easy to dismiss those types as delusional. And we just don’t know what’s going on. We can only really approach what’s in front of us.

Our options probably are….

  • failure of democratic process [this is Simon Dolan]
  • censorship of press / free speech [I believe Toby is doing this so would be great to have an update]
  • human rights compromised [also Simon Dolan]
  • misleading public in terms of statistics [possibly the Free Speech union too]

I’m sure there’s lots more so others will add to the list, but those are top of my mind.

We can try to open the eyes of others, but the censorship of the press is a major obstacle. For example, if we protest, who will cover it? It needs to be in MSM for that.

I do really understand how you feel though Bella, I really do.

74511 ▶▶▶ Bella, replying to Country Mumkin, 5, #713 of 1428 🔗

Yes, understood. But conspiracy theorist is a pejorative to ridicule a valid point of view. Dolan will lose his case, it’s fixed. And I helped fund it. There has to be a more radical approach. Shutting down places because of positive tests? They are not even cases, they are tests. Those statistics are also fixed

74532 ▶▶▶▶ MiriamW-sometimes-AlanG, replying to Bella, 3, #714 of 1428 🔗

Well said, Bella.

74624 ▶▶▶▶ Lockdown Truth, replying to Bella, 1, #715 of 1428 🔗

We need to activate every sceptic to win over a friend or two. We need our own “R” number to be above one. We give everyone tools and motivation to convince two others that this is all crap. When someone is successful, they tell the rest how they did it and share information and resources.

74644 ▶▶▶▶▶ OKUK, replying to Lockdown Truth, 6, #716 of 1428 🔗

You have to be a bit careful with friends and family. Some people have been terrified by the propaganda. Choose your moment to throw in a fact grenade. Often people have totally misled by MSM propaganda. Someone told me recently that non-lockdown Sweden had the worst Covid death rate in the world whereas it is full on early lockdown Belgium in reality.

74698 ▶▶▶▶▶▶ Carrie, replying to OKUK, #717 of 1428 🔗

You think Sweden locked down? I assure you we did not!

74715 ▶▶▶▶▶▶▶ OKUK, replying to Carrie, 2, #718 of 1428 🔗

Nope – I wrote NON lockdown Sweden. 🙂

74658 ▶▶▶▶▶ DRW, replying to Lockdown Truth, 3, #719 of 1428 🔗

Some just won’t believe you. Most of my public sector colleagues are genuinely incapable of recognising anything from government as a lie and won’t accept the propaganda being challenged. For others its probably the MSM.

74480 Cheezilla, replying to Cheezilla, 11, #720 of 1428 🔗

I live in an area with a high devout Muslim population. We were nominally locked down on Thursday night.

I’d hoped that life would carry on regardless but on Friday, there were only about three piddling firework bangs, around 10pm. Presumably someone doing it for their kids in their back garden.

I thought they might be saving it up for Saturday night. Not even a faint pop.

Goodness knows what they were threatened with if they didn’t comply. Maybe told there would be a full local lockdown, which would have harmed livelihoods.

Reign of terror!

74524 ▶▶ Dave #KBF, replying to Cheezilla, 12, #721 of 1428 🔗

I do not think many non Muslins realise how important Eid is to Muslins and taking that away just shows how pitiful our “leaders” are.

74531 ▶▶▶ Will, replying to Dave #KBF, 2, #722 of 1428 🔗

If I remember correctly 75% of Muslims voted for Corbyn at the last election so I shouldn’t imagine “the Johnson” is too worried that upsetting them will make much difference.

74622 ▶▶▶▶ OKUK, replying to Will, #723 of 1428 🔗

No he’s not otherwise he wouldn’t be suggesting Gandhi on a British note!

74588 ▶▶ Tyneside Tigress, replying to Cheezilla, 7, #724 of 1428 🔗

It was such a thoughtless thing to do, and dangerous. Think, especially, how the youngsters must have felt – it would be like telling little ones Santa wasn’t coming because Christmas was cancelled. Shame on you Boris, Hancock, Priti, Rishi, Whitty, Vallance and Gove.

74594 ▶▶ JohnB, replying to Cheezilla, 2, #725 of 1428 🔗

One has heard suggestions that many folk doing Eid just went somewhere else.

74610 ▶▶▶ Dave #KBF, replying to JohnB, 2, #726 of 1428 🔗

As Cheezilla reports the lack of fireworks is a bit of a giveaway, ordinarily it is a mini New Years eve, not this year.

74827 ▶▶▶ Farinances, replying to JohnB, #727 of 1428 🔗

My friend who I work with from Beeston (like the Asian capital of Leeds) was having Eid celebrations this weekend. He’d invited all of his family….. from Batley 😀

It’s definitely happening. Good for you Muslims. Stick it to those fuckers.

74833 ▶▶▶▶ Kath Andrews, replying to Farinances, #728 of 1428 🔗

Happy for them!!!! 🙂

74502 Bart Simpson, replying to Bart Simpson, 4, #729 of 1428 🔗

Petition here to reinstate Megan Metcalfe and that the bakery should accept cash:

https://www.change.org/p/birds-bakery-cash-to-be-accepted-at-birds-bakery-and-the-reinstatement-of-megan-metcalfe

74597 ▶▶ Ruth Sharpe, replying to Bart Simpson, 2, #730 of 1428 🔗

Quite agree that this lady should be vindicated, but my sister-in-law, who lives in the same village as this lady, says she has already got another job.

74614 ▶▶▶ Bart Simpson, replying to Ruth Sharpe, 1, #731 of 1428 🔗

That’s good news and shows that good people will find something new come what may.

74825 ▶▶▶ Farinances, replying to Ruth Sharpe, #732 of 1428 🔗

I expect a friendly local non-zealoty business swooped in and scooped her up. Good for them.

74503 Binra, replying to Binra, #733 of 1428 🔗

Just a note on the cartoon – that the national hammer has done its job and globally set local institutional regulatory structures will now by pass old normals such as policemen and courts of law. national agency can and will be used as needed but the ‘medical mandate’ operates health and safety as well as national security, ostensibly with our safety as the paramount concern – but specifically as rendered ‘safe’ in terms of a sytemic lockdown of rights and freedoms from which temporary passport status has to be earned by social credit.
The thing about all this is that the core plans for it all are pre drilled and unfolded under our noses and are effective if not fit for purpose.
Systems are rested and revised by shock testing. If the idea is to take all shocks out of the system – under cardiac arrest – well what kind of life is a systemically controlled human laboratory?

74935 ▶▶ Basics, replying to Binra, 1, #734 of 1428 🔗

And a useless queen who actually does have a meangingful role under her coronation oath and position within the structures of state. She behaves as a trinket, has she been advised to remain in post, out of touch and incapable to resist, to honor her oath? Charles certainly has been prepped to be onside for the great reset. The house of Saxe-Coburg-Gotha is lost.

74513 swedenborg, replying to swedenborg, 26, #735 of 1428 🔗

Let us take Haiti, one of the poorest countries in Western hemisphere with a substandard heath system. A 2019 study reported that for a population of more than 11 million, Haiti only has an estimated 124 (ICU) beds and 64 ventilators. You would think the virus would be a disaster. First cases 19th March.12th April gov closed schools and factories.A week later changed as textile factories is 90 % of Haiti’s export so reopened. Heavily criticised by Pan Amer Health Org as dangerous and could result in a diaster.3 months later 7500 cases 165 deaths.
https://twitter.com/Covid19Crusher/status/1289110191741505539/photo/1
“What is the natural course of the COVID-19 disease? A good way to get a sense is to look at what is happening in countries with the weakest healthcare systems. Haiti: a one-month frantic flare up… And then the herd immunity brick wall.”
Indeed, almost a natural experiment. The same pattern in Afghanistan. WHO’s lockdown advice for the poorest countries in the world will probably be judged as the worst public health advice ever.

74679 ▶▶ Tenchy, replying to swedenborg, 1, #736 of 1428 🔗

I just checked the figures for Haiti and Afghanistan. This looks very much to be the case.

74713 ▶▶ guy153, replying to swedenborg, 1, #737 of 1428 🔗

It also “helps” that the life expectancy in poorer countries is about 10 to 15 years younger than the average age of people who die of Covid in the affluent ones.

74931 ▶▶ Lockdown Truth, replying to swedenborg, #738 of 1428 🔗

They couldn’t afford the PR campaign to keep it going…

74522 Martin Byrne, replying to Martin Byrne, 6, #739 of 1428 🔗

This may be a lock down stir crazy theory but here goes.
The figures mean nothing, the planted stories and leaks are what matter, the reason is the mass propaganda campaign to scare the bejeebers out of the population from March was so successful that now the government needs to reverse the scare levels. So it announces a few local lock-downs at regular intervals, this way the masses start to relax more because they will feel that the government is looking out for them and there is less and less need to worry, leading up to the point when the government announces it is totally safe to reopen schools, by which point the masses will feel it must be true. So far the opinion polls show widespread support for government actions on local lock-downs and sudden travel quarantines, By following the polls the government moves at a pace that will reduce the fear factor for the mass population. Simple really

74536 ▶▶ Carrie, replying to Martin Byrne, 8, #740 of 1428 🔗

If only.. but as most other governments are acting in a similar way, I feel this is all too coordinated to just be the UK government messing up..

74591 ▶▶▶ Binra, replying to Carrie, 2, #741 of 1428 🔗

Boris was groomed for the role.

74694 ▶▶▶▶ Carrie, replying to Binra, 1, #742 of 1428 🔗

By who? Rothschilds?

74541 ▶▶ BecJT, replying to Martin Byrne, 1, #743 of 1428 🔗

My Tory Grandee mate tells me this is precisely the plan.

74547 ▶▶▶ Farinances, replying to BecJT, 2, #744 of 1428 🔗

Ooooh. Deets please.

74556 ▶▶▶▶ BecJT, replying to Farinances, 5, #745 of 1428 🔗

All he keeps telling me is, ‘it’s just politics, we’ve got nowhere to go [because of the opposition and the press] and we cannot be seen to the be the nasty party that killed people’. He keeps telling me it’s nothing to do with health, and all to do with politics, and ‘recriminations will only be done in retrospect’. I believe he chats to CCO, and his mate who is Tory mayor of a big city regularly. My pal is a constituency chairman, wealthy, moves in all the right circles.

74560 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to BecJT, 3, #746 of 1428 🔗

Sounds like group-think in action.

74568 ▶▶▶▶▶▶ BecJT, replying to MiriamW-sometimes-AlanG, 5, #747 of 1428 🔗

Definitely yes, I think they think they can still play politics with it (so does Keir to be fair, a pox on both their houses!) but I don’t get the sense that the gravity of what they’ve done has quite hit them yet. I think they know there’s an inquiry coming, and they are playing to that really.

74584 ▶▶▶▶▶▶▶ Bella, replying to BecJT, 3, #748 of 1428 🔗

Would that be a fixed enquiry? Like Iraq?

74606 ▶▶▶▶▶▶▶▶ BecJT, replying to Bella, 4, #749 of 1428 🔗

One assumes, but I guess it depends on when the penny drops on how much harm this has done, furlough ends now, I predict a distinct change in public mood. It also depends on Labour, my guess is they don’t want a rigorous one either.

74737 ▶▶▶▶▶▶▶▶▶ Bella, replying to BecJT, 4, #750 of 1428 🔗

Course not. Speaking as someone who once upon a time inhabited the ‘left’ culture of protecting those worse off I have to be reminded of how authoritarian Labour can be. (I keep on forgetting Blunkett and his i.d. cards after being the doyen of liberty causes for Sheffield Council. Power it seems changes everyone.) But I have no faith that any enquiry is going to get to the truth anymore than Chilcott or even Warren did. They are cosmetic exercises.

74753 ▶▶▶▶▶▶▶▶▶▶ RickH, replying to Bella, 1, #751 of 1428 🔗

I fear that you are correct.

We all know now the truth about Iraq and the disaster that ensued from the spun story.

… but knowing hasn’t altered a single thing in the morass that is the Middle East – largely a result US manipulation with the UK as poodle.

74567 ▶▶▶▶▶ Carrie, replying to BecJT, 3, #752 of 1428 🔗

Interesting…
Is he wanting you to ‘leak’ this, or hoping you will?

74570 ▶▶▶▶▶ OKUK, replying to BecJT, 16, #753 of 1428 🔗

Balls. If sensible policies can be pursued in Sweden they can be followed here. There’s a lack of leadership and focus. The clear priority must be to get the economy moving again and to reopen schools. Returning at intervals to the fear propaganda makes no sense and is seriously damaging.

74575 ▶▶▶▶▶▶ Carrie, replying to OKUK, 12, #754 of 1428 🔗

Yes, the government could have pointed out that Norwegian and Danish schools re-opened in full after their lockdowns, with no subsequent sides…

74577 ▶▶▶▶▶▶ BecJT, replying to OKUK, 12, #755 of 1428 🔗

I agree with you, I’m just telling you what he’s telling me. I very much get the sense that they feel boxed in without an inch wriggle room, I think that the blame needs to fall squarely on Labour too, and the press, as they politicked the living daylights out of herd immunity (that was sage, not the government’s plan) and any government, of any stripe, could have only followed the advice at that point. As my grandee mate says, half a million dead, any gov would have panicked. Like you, I don’t understand why they are STILL clinging to crap models and not paying attention to the data. I can see that they are faced with political bear traps whatever they do, but at this point, I entirely agree it’s about what is morally right, not what is politically expedient. I very much doubt we’re going to get that though.

74581 ▶▶▶▶▶▶▶ Carrie, replying to BecJT, 3, #756 of 1428 🔗

We also know that Boris is in Bill Gates’ pocket, as are Hancock, Whitty and Vallance..

Before he locked his Twitter account, Mason Mills was talking about imminent action re the BBC – that might change things a bit?
Also that in August we would see change re the migrant water taxis..

But the government must be stupid if they think forcing over 50s to isolate is going to go down well, especially as there are so many MPs in that age bracket who will be exempted..

74646 ▶▶▶▶▶▶▶▶ Bugle, replying to Carrie, 1, #757 of 1428 🔗

Not to mention ruining people’s holidays.

74695 ▶▶▶▶▶▶▶▶▶ Carrie, replying to Bugle, 1, #758 of 1428 🔗

—and potentially Christmas too…

74810 ▶▶▶▶▶▶▶▶ Bruno, replying to Carrie, #759 of 1428 🔗

We know nothing of the kind, Boris wouldn’t rate an opinion from Gates who is not Eton and Oxford, however filthy rich he is.
As for the idea Gates is out to take over the world and make a bucket load of money from vaccines, that’s hilarious. That would be the hardest and most controversial way to exploit the situation, much easier and nicer to be the boss of Zoom, Eric Yuan. Something Gates might have done if he’d seen it coming early enough. Bet he’s kicking himself.

74613 ▶▶▶▶▶▶▶ OKUK, replying to BecJT, 4, #760 of 1428 🔗

I’m not sure I am entirely shooting the messenger here since you are giving credence to Ferguson’s fantasising.

The Fergie figure of half a million dead was always absurd. For one thing it assumed no action being taken by the government – completely incredible. For another it seemed to be extrapolated from an outbreak on a cruise ship. If the government fell for that then they don’t deserve to govern.

74641 ▶▶▶▶▶▶▶ Cheezilla, replying to BecJT, 5, #761 of 1428 🔗

It’s the fact that they constantly lie about the stats.

Surely the best way out for them is to admit that the virus is about gone and set about returning us ot old normalcy?

Instead they’ve made it even harder by insisting on elimination and trumpeting second wave.

I think it’s deliberate foot-dragging and not about saving face.

74764 ▶▶▶▶▶▶▶▶ Bella, replying to Cheezilla, 6, #762 of 1428 🔗

Because it’s not about the virus. I notice sometimes how frustrated people got here with zealots they call the ‘bedwetters’ so I’m getting frustrated with some of you guys who think this is about the virus and call us (up the thread a bit) conspiracy theorists, as though we are cute with wild ideas and should just be indulged a little bit as we support ‘the LS cause’. But let’s not use their theories for fear of alienating those whose minds we think we can change. Then I ask you to look at the agenda of people like ‘Masks4all’. Unfortunately tonight I had to sit through a BBC News item (I was waiting in someone’s flat who had it on, I hate the BBC) about holidays in the Lake District with all the interviewees wearing masks and saying they were having a lovely time because they were out of ‘lockdown’ and I think Jesus Wept. Fucking wearing masks and having a lovely time. Obviously the BBC highlighted this with a view to making it seem that it is normal and acceptable but even that makes me want to vomit. Soon people will be expressing gratitude for being allowed to breathe air. See ‘The Ragged Trousered Philanthropists’ where Tressell postulates exactly that, and how grateful the sheep will be. My supposition: there are degrees of sheep-like behaviour and I am constantly surprised how many people here still think this is just a bunch of incompetents making an innocent, if disastrous, mistake. I implore people to wake up and if by the end of August it hasn’t been mooted that the wearing of masks in UK is extended, or Melbourne lockdown has been significantly lifted then I’ll shoot a video of me dancing to ‘Staying Alive’ in my knickers. (Not a pretty sight.)

74701 ▶▶▶▶▶▶▶ guy153, replying to BecJT, 7, #763 of 1428 🔗

They will never admit that they “let” the UK reach herd immunity so as far as they’re concerned it never happened and they won’t look at any data that confirms it.

A good lie requires 100% commitment to sticking to your story, ideally even convincing yourself of it, and these people are some of the best liars in the business.

74742 ▶▶▶▶▶ RickH, replying to BecJT, 2, #764 of 1428 🔗

It’s always seemed obvious to me that Johnson’s role was to win the election with bullshit and bluster after it became obvious that May was a loser. His appeal, across the board, was to the large dimwit constituency that, in an FPTP system, can make a difference, and who would be impressed by the shallow blokey bluster.

The next stage will be to get rid of him. I reckon the skids are underneath and its just a matter of timing.

Another strand is having Starmer in place as Blair MkII. It’s win-win for the establishment interests.

75106 ▶▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to RickH, #765 of 1428 🔗

This is exactly our theory re: the current political situation. Johnson is nearing the end of his sell-by date and we will have effectively if not actually a one-party state with Sir Starmer (he of the Trilateral Commission ) as PM.

74891 ▶▶▶▶▶ Margaret, replying to BecJT, #766 of 1428 🔗

Thanks for posting this BecTJ and Martin. This confirms what I’ve been feeling for ages and tried to get across in my post yesterday. They really don’t know which way to turn so it’s up to us to break all the rules and let them off the hook-until pay back time that is.

74555 ▶▶▶ MiriamW-sometimes-AlanG, replying to BecJT, #767 of 1428 🔗

Are you sure they’re still in the loop?

74558 ▶▶▶▶ BecJT, replying to MiriamW-sometimes-AlanG, 3, #768 of 1428 🔗

I’m not sure of anything, there’s in the loop as in the chatter amongst MPs and their chums at constituency and regional level, and then what’s going on at cabinet level, but he seems pretty unruffled by the whole thing. I’m not sure they’ve yet grasped, truly, what they’ve done.

74649 ▶▶▶▶▶ Bugle, replying to BecJT, 2, #769 of 1428 🔗

Thanks for the info. All grist to the mill.

74710 ▶▶▶▶▶ Farinances, replying to BecJT, 3, #770 of 1428 🔗

Interesting. This does chime with Boris and his “Christ!” reaction to the possible unemployment figures a few weeks back.

74728 ▶▶▶▶▶▶ Carrie, replying to Farinances, 4, #771 of 1428 🔗

And him reportedly laughing over it being easier to take people’s freedoms than to give them back..

74750 ▶▶▶▶▶▶▶ Bugle, replying to Carrie, 5, #772 of 1428 🔗

If Boris had any remorse about brainwashing the public, he would have run the programme down. He hasn’t. The figures are pure disinformation. The masks are reinforcement behaviour. The shock tactics over travel and Eid are calculated to disorientate the public, and create a false assessment of the gravity of the situation. I don’t believe a thing he says.

74754 ▶▶▶▶▶▶▶▶ Farinances, replying to Bugle, 1, #773 of 1428 🔗

Oh no there’s no remorse. He does however find it chuckleworthy.

74758 ▶▶▶▶▶▶▶▶ Carrie, replying to Bugle, 6, #774 of 1428 🔗

Exactly. And ever since I saw that list of techniques for brainwashing, I have seen through every one of their ‘moves’…

Tactics for Psychological Coercion (AKA “Brainwashing”) – Dr Margaret Singer (1921-2003)
1.     EXACT REPETITION
Techniques to increase suggestibility and ‘soften up’ the individual via hypnotic or other suggestibility increasing techniques such as extended audio drills, excessive exact repetition of routine activities.
2.     SOCIAL ISOLATION
Establishment of control over the victim’s social environment, time, and sources of social support through creating social isolation; removing contact with family and friends, as well as persons who do not share group-approved attitudes.
3.     INFORMATION CONTROL
Rejection of alternate information and separate opinions. Rules exist about permissible topics to discuss. Communication is highly controlled. An ‘in-group’ language is usually constructed.
4.     ALTER REALITY PERCEPTION
Make the person re-evaluate the most central aspects of his or her experience of self and prior conduct in negative ways. Efforts are designed to destabilize and undermine reality awareness, world view, and defence mechanisms.
5.     CONFUSE TARGET
Create a sense of powerlessness by subjecting the victim to intense and frequently confusing, conflicting actions and situations which undermine the victim’s self-confidence and judgement.
6.     PUNISHMENT
Creating strong, aversive, emotional arousals in the subject by reactions such as intense humiliation, loss of privilege, social isolation, social status changes, intense guilt, anxiety, and manipulation.
7.     CONFORMITY THREATS
Intimidate with group-sanctioned psychological threats. For example, it may be suggested that failure to adopt the approved behaviour will lead to severe punishment or the reappearance of a prior physical illness.

74849 ▶▶▶▶▶▶▶▶▶ Bugle, replying to Carrie, 1, #775 of 1428 🔗

Wow, excellent post.

74557 ▶▶▶ DressageRider, replying to BecJT, 2, #776 of 1428 🔗

But why not start to give the real stats?

74596 ▶▶▶ HelzBelz, replying to BecJT, #777 of 1428 🔗

Are they that clever though?

74607 ▶▶▶▶ BecJT, replying to HelzBelz, 4, #778 of 1428 🔗

No I don’t believe they are, I think they are bumbling along in silos of group think thinking they can spin their way out of it.

74704 ▶▶▶▶▶ guy153, replying to BecJT, 2, #779 of 1428 🔗

After all that strategy has worked for them in every other career or political situation so far.

74786 ▶▶▶ JohnB, replying to BecJT, 2, #780 of 1428 🔗

They have different explanations, and different means of communicating them, for different groups.

This is the ‘Tory grandee’ explanation.

74790 ▶▶▶▶ Carrie, replying to JohnB, 5, #781 of 1428 🔗

I think only a very small number of Tory MPs are in on the whole plan, otherwise there’d have been more rebellion.. Most likely the others are being placated with half-truths or lies..

74554 ▶▶ OKUK, replying to Martin Byrne, #782 of 1428 🔗

Might be the theory, might be the plan…but not sure it is working in practice. The Grand Old Duke had a similar approach but at least he didn’t ask the poor bloody infantry to go uphill and downhill simultaneously. Those who are led by polls often end up getting beaten by poles held in the hands of voters at election time.

74590 ▶▶ Ruth Sharpe, replying to Martin Byrne, 2, #783 of 1428 🔗

I thought something like this a while ago, but I’ve decided it is sheer incompetence. Mind you, Dan Hodges today, suggesting that Boris is having a mid-life crisis did raise a smile, but then the disillusionment and disgust quickly returned.

74633 ▶▶ Cheezilla, replying to Martin Byrne, 4, #784 of 1428 🔗

I think the local lockdowns are designed to increase the fear – constant threat hanging over us.

74640 ▶▶▶ DRW, replying to Cheezilla, 3, #785 of 1428 🔗

Wasn’t that a deliberate goal according to one SPI-B guy?

74692 ▶▶▶▶ Carrie, replying to DRW, #786 of 1428 🔗

Yes.

74832 ▶▶▶ DavidC, replying to Cheezilla, #787 of 1428 🔗

I agree.

DavidC

74638 ▶▶ Bugle, replying to Martin Byrne, 4, #788 of 1428 🔗

So how do you account for the mask requirement? In the period up to the notice, where I live hardly anyone was wearing one, and even during the notice period around 5% in shops and hardly any in the street. In other words, people were not that fearful. Now that masks are mandatory, most people are masked in the street. Masks have clearly increased the fear level, which tends to work against your theory.

Not being unpleasant or anything and I don’t want to contradict BecJT either, but I still think HMG is trying to ratchet up the perception of danger using sudden measures and bogus figures. Why? And why is this replicated round the world? Most western-style democracies have damaged or wrecked their economies. Where is the funding coming from to carry on? I’ll guarantee it’s the same group that’s requiring the measures.

74678 ▶▶▶ Bruno, replying to Bugle, 8, #789 of 1428 🔗

This government chooses not to publicise the real facts so as to be able to suggest, at the public enquiry, that their actions have prevented catastrophic numbers of deaths. Actually they didn’t, their actions failed to prevent large numbers of deaths in care homes and hospitals. But they certainly have exacerbated those from non- covid causes, plus causing other untold social, educational and economic damage. They will certainly deploy all the means at their disposal to conceal or minimise that damage, but it will be impossible (in my view).

75114 ▶▶▶▶ MiriamW-sometimes-AlanG, replying to Bruno, #790 of 1428 🔗

I would suggest that we put no faith in any public inquiry, even if there is one. It will be rigged with a tame, signed-up chair and it will focus on issues like not locking down early enough, lack of PPE etc. It will, of course, be too late anyway and the Govt knows this. I think we safely assume that fear of an Inquiry does not influence their plans at all.

74689 ▶▶▶ Carrie, replying to Bugle, #791 of 1428 🔗

Look at the Rockefeller Lockstep document…

74729 ▶▶▶▶ Bugle, replying to Carrie, #792 of 1428 🔗

Will read it through tomorrow, ‘cos I’m tired. I am familiar with this to some extent. There is a Gates/Rockefeller connection – I think it involved Gates’ father. Bill Gates is on record as saying whatever areas he entered with his philanthropic missions, he found the Rockerfellers had already been there. As for the Lockstep Document narrative, it has been fact-checked by Snopes and found to be false – so that’s OK then!

74774 ▶▶▶▶▶ Carrie, replying to Bugle, #793 of 1428 🔗

Another interesting chain of connections surrounds the company Moderna who are making a Covid vaccine in the US. Fauci is involved with them. I did not know that Moderna was originally the company IG Farben who made zyklon B (used in the concentration camps) and that it was bought by Soros and renamed. Apparently their biggest shareholder was Jeffrey Epstein…

74768 ▶▶▶ Bella, replying to Bugle, 1, #794 of 1428 🔗

Please keep on saying this. Please, please, please

74826 ▶▶▶ Jonathan Palmer, replying to Bugle, 3, #795 of 1428 🔗

Anyone who still believes this is all down to incompetence is naive in the extreme.The government has had many chances to roll back on its measures and has instead doubled down in tandem with other western governments.It is true that we have no real evidence as to the real reason behind the continued lockdown but we can all agree it’s not to protect us from a deadly pandemic.My bet is global economic reset and the attendant authoritarian measures are to stifle opposition until it is complete and a juicy bone thrown to Gates in the form of mandatory vaccines for all his help.

74850 ▶▶▶▶ Bugle, replying to Jonathan Palmer, 1, #796 of 1428 🔗

There’s more to Gates than vaccines: nano-particles, ID technology, electronic payment systems, de-population, induced sterility. Look it up.

74680 ▶▶ annie, replying to Martin Byrne, 5, #797 of 1428 🔗

The point about local lockdowns us that it stops people questioning lockdowns in principle. They just don’t want it to hit them. Divide and (mis)rule.

74708 ▶▶▶ guy153, replying to annie, 3, #798 of 1428 🔗

It’s also meant to be an excuse for not doing national lockdowns. They’re assuming they have to do something that people will believe is warding away the evil Covids so they go back to work.

74718 ▶▶▶▶ Farinances, replying to guy153, 3, #799 of 1428 🔗

THIS. It’s their get-out clause for another national lockdown which they are convinced the press (and the public) will demand soon.
I think they’re wrong – especially with regards to the public. How the North is reacting to the latest imposition may give them some inkling of this. Hopefully they will take note.
They’re kinda sacrificing who they think they can sacrifice (Northern businesses – so much for the Levelling Up bollocks – FUCK YOU HMG) in order to gauge a reaction and ‘comfort’ the rest of the country without having to go into ruinous total lockdown again.

It does make a twisted kind of sense.
(Plus Handjob and SAGE and PHE get to exercise their megalomania once again)

74705 ▶▶ A. Contrarian, replying to Martin Byrne, 3, #800 of 1428 🔗

But surely all these local lockdowns, states of emergency and second spikes are increasing the fear, not reversing it?

74926 ▶▶▶ Lockdown Truth, replying to A. Contrarian, 2, #801 of 1428 🔗

Exactly. I keep saying… if they wanted to REDUCE fear they would get rid of the hazard signs at press conferences and start seeding positive stories in the press. They’re not doing that so they DON’T want to reduce fear.

74716 ▶▶ Youth_Unheard, replying to Martin Byrne, #802 of 1428 🔗

Oh how I wish that feat levels do start coming down, although I fear the hole is so deep that continuing to dig just isn’t going to work.

74730 ▶▶▶ Farinances, replying to Youth_Unheard, 1, #803 of 1428 🔗

The press kinda won’t let fear levels come down. They’re clamped on like a staffordshire bull terriEr.

Maybe the gvt. needs to fling them some more money to project positive stories now!

74814 ▶▶▶▶ JohnB, replying to Farinances, 1, #804 of 1428 🔗

I think you mean Pit Bulls, and the only way to get them off your arm is to stick your finger up its bum! Maybe that’s the way to shock the press out of the fear mongering

74823 ▶▶▶▶▶ Farinances, replying to JohnB, #805 of 1428 🔗

Do I? Can you tell I’m not a dog person 😉
Omi god, that’s funny 🙂

74530 MiriamW-sometimes-AlanG, replying to MiriamW-sometimes-AlanG, 3, #806 of 1428 🔗

‘Seems that if you protest against lockdown, you’re an antisemitic Neo-Nazi. So we’re all Nazis now (in the eyes of the Times of Israel anyway!)

Police put turnout at around 20,000 — well below the 500,000 organizers had announced as they urged a “day of freedom” from months of virus curbs. The rally, which was supported by neo-Nazi groups and other critics of Germany’s virus police, took its name from a 1935 documentary by Nazi filmmaker Leni Riefenstahl on a party conference by Hitler’s National Socialist German Workers’ Party https://www.timesofisrael.com/neo-nazis-others-hold-massive-berlin-protest-against-virus-restrictions/

74540 ▶▶ Farinances, replying to MiriamW-sometimes-AlanG, 10, #807 of 1428 🔗

I find this absolutely hilarious. The people fighting against fascist laws and policing are the Nazis!

74546 ▶▶▶ MiriamW-sometimes-AlanG, replying to Farinances, 6, #808 of 1428 🔗

I know, could you make it up?

74549 ▶▶ BecJT, replying to MiriamW-sometimes-AlanG, 6, #809 of 1428 🔗

Which tells me that lock down support is ‘woke’, everything and anyone who doesn’t agree with them is a Nazi (they call jews that too, btw, when it suits them).

74553 ▶▶▶ MiriamW-sometimes-AlanG, replying to BecJT, 3, #810 of 1428 🔗

Oh I know, friends of ours have had that thrown at them.. ‘Nazis and vile antisemites’ hurled at Jewish people, FFS, especially in the Labour Party as part of the ‘Get Corbyn’ campaign.

Interestingly jokes about WW2, the Holocaust and using Nazi references are routine in Israel from what we’ve been told by friends.

74563 ▶▶▶▶ BecJT, replying to MiriamW-sometimes-AlanG, 6, #811 of 1428 🔗

I’ve seen some truly disgusting stuff, I don’t know how those people sleep at night. I keep thinking, if this truly was a once in a lifetime pandemic, there’d be no arguing about it at all, let alone politicising it, we’d be too busy digging holes to bury the bodies.

74564 ▶▶▶ Carrie, replying to BecJT, 5, #812 of 1428 🔗

Apparently that lot dressed in black marching today were breaking a Public order law from 1936 regarding political uniforms on the streets… a complaint has been lodged to the police..

74609 ▶▶▶▶ BecJT, replying to Carrie, 3, #813 of 1428 🔗

Ah right, I only saw bits on youtube, it’s hard to know what is true and what isn’t, there’s so much bloomin’ spin. Just for fun, I sometimes read the same story in the right and left wing press in the USA, you’d think two entirely different things happened!

74687 ▶▶▶▶▶ Carrie, replying to BecJT, 1, #814 of 1428 🔗

Wasn’t referring to Berlin – I was referring to the lot in London dressed in black uniforms with ‘FF force’ on…

The Berlin lot were ordinary people, just like us!

74593 ▶▶ Lisa from Toronto, replying to MiriamW-sometimes-AlanG, 15, #815 of 1428 🔗

Hmmm, funny that. I’m Jewish and I’m the biggest lockdown sceptic ever. And I know fascism when I see it and I’m seeing it in my country of Canada. As a person of Jewish descent, I know when to be afraid and I’m really fucking afraid (and not of the virus).

74537 Paul, 2, #816 of 1428 🔗

Revolution?
I’ve always considered myself a pretty moderate person, but this year of lockdowns, masks, idiocy, insanity, and outright deceit and fraud has really worn me down. I’m at the point where I don’t want to discuss anything Covid related with anyone anymore. There is no reasoning with people at all. They take their cues from fools who tell us we should wear goggles.

Another lockdown and I will be far more open to joining an armed resistance, something I never thought possible. But that’s what this insanity has done.

74539 BecJT, replying to BecJT, 8, #817 of 1428 🔗

“Almost all confrontations were related to the wearing of face masks with ‘flashpoints’ occurring when people were asked to follow the guidance and when young consumers were asked to remove masks to check ID when buying alcohol.

A Co-op spokesman told The Grocer magazine: “We’ve seen a marked rise in abuse, threats and even assaults on shop workers during the Covid crisis and believe this could be another flashpoint.”

I feel sorry for the shopworkers, as for Co Op HQ, we told you so.

https://www.telegraph.co.uk/news/2020/08/02/supermarket-workers-facing-torrent-mask-rage-historical-levels/

74542 ▶▶ Farinances, replying to BecJT, 6, #818 of 1428 🔗

I hope they strike.

74548 ▶▶▶ BecJT, replying to Farinances, 7, #819 of 1428 🔗

Me too, our local co op have been fab, cheerful, hardworking, not complaining, dealt with all sorts of crap, and lo, they are still alive. I was in there the other day, and apologised on behalf of my fellow citizens that they were now in masks. ‘Not on my behalf’ I said. They’ve been so good, on shite pay, and now this.

74642 ▶▶ Cicatriz, replying to BecJT, 3, #820 of 1428 🔗

Interesting legal issue – can you be asked to remove a mask by a member of the public?

Overall, cashiers have the worst job. Should be getting paid what the teachers are.

74683 ▶▶▶ Carrie, replying to Cicatriz, 1, #821 of 1428 🔗

No – an ordinary member of the public has no authority over another.. nor the right to demand that person’s health history to see if they have a reason for exemption that would mean they have to take the mask off..

Or were you meaning if a shop worker asks a person to take their mask off to for example determine their age/right to purchase alcohol or similar..?

74709 ▶▶▶▶ Cicatriz, replying to Carrie, 1, #822 of 1428 🔗

“Or were you meaning if a shop worker asks a person to take their mask off to for example determine their age/right to purchase alcohol or similar..?”

Yes, that is what I’m driving at. I guess they retain the right to refuse sale if somebody doesn’t remove a mask. It seems like a curious overlap of rights to me, though.

74875 ▶▶▶▶ annie, replying to Carrie, #823 of 1428 🔗

You csn be told to eff off by a member of the public. I am a member of the public.

74654 ▶▶ Dave #KBF, replying to BecJT, 8, #824 of 1428 🔗

I was in Morrisons yesterday and talking to the young woman on the till staff have to wear masks whenever they are not behind the protective perspex screens.

She said it is awful doing a shift and wearing a mask.

Employers have a duty of care, they should not be enforcing this.

74677 ▶▶▶ Carrie, replying to Dave #KBF, 2, #825 of 1428 🔗

Can shop staff sue their employer over this? For not doing adequate risk assessments or for disability discrimination? It’s a valid exemption to say they make you stressed…

74712 ▶▶▶▶ Youth_Unheard, replying to Carrie, 3, #826 of 1428 🔗

Answered here, but essentially yes the employer has a duty of care and without providing adequate evidence based reasoning for it, and as a result causing harm to the employee, this puts them at fault.
http://laworfiction.com/2020/07/time-to-blow-the-whistle-on-shops/

74656 ▶▶ Tenchy, replying to BecJT, 7, #827 of 1428 🔗

Strange as it may seem, this is a positive development. The more disorderly conduct there is in connection with face nappies, the more it might make the sheeple realise that there’s something wrong with them.

74565 JohnB, replying to JohnB, 13, #828 of 1428 🔗

Major incident declared in Greater Manchester after COVID-19 rise but no figures are being provided to justify this major incident being declared.

We are in full coup mode now.

74573 ▶▶ DRW, replying to JohnB, 6, #829 of 1428 🔗

I’m not from there and I’m still scared. But not of the virus…

74637 ▶▶▶ JohnB, replying to DRW, 6, #830 of 1428 🔗

You’re right, whatever this is, it’s definitely now not about a virus.

74674 ▶▶▶▶ Carrie, replying to JohnB, 5, #831 of 1428 🔗

It’s a coup…

74854 ▶▶▶▶▶ Kate, replying to Carrie, #832 of 1428 🔗

Its 911 all over again. An engineered crisis to remove our freedoms and enrich the elite.

74586 ▶▶ Dave #KBF, replying to JohnB, 4, #833 of 1428 🔗

Should I be scared? if you tell me to be I will be.

74682 ▶▶▶ JohnB, replying to Dave #KBF, #834 of 1428 🔗

Yes, be scared, be very scared!

74595 ▶▶ Dave #KBF, replying to JohnB, 1, #835 of 1428 🔗

I wonder what extra resources can GM now call on? The military? A personal walkabout visit from Boris?

74635 ▶▶▶ JohnB, replying to Dave #KBF, 1, #836 of 1428 🔗

I wouldn’t be surprised to see martial law with the Army on the streets seeing as the Police aren’t doing anything.

74639 ▶▶▶▶ Martin Spencer, replying to JohnB, 2, #837 of 1428 🔗

The British Army is tiny and hasn’t been keen on recruiting tough males for some time.

74685 ▶▶▶▶▶ JohnB, replying to Martin Spencer, #838 of 1428 🔗

Still up to 150,000 of them available

74782 ▶▶▶▶▶▶ JohnB, replying to JohnB, #839 of 1428 🔗

So we only out-number them by 450 to 1 ?

74670 ▶▶ Carrie, replying to JohnB, 1, #840 of 1428 🔗

Is this just this evening? has something else happened?

74686 ▶▶▶ JohnB, replying to Carrie, 1, #841 of 1428 🔗

Announced about a hour ago

74794 ▶▶ PoshPanic, replying to JohnB, 5, #842 of 1428 🔗

A major incident was declared in Bournemouth, but it was just people completely fucked off with it all, trying to have a few minutes of relaxation and fresh air.

The real major incident that has taken place over the last few months, is the collapse of governance

74572 swedenborg, 5, #843 of 1428 🔗

https://twitter.com/Hold2LLC/status/1289687115555577856/photo/1
Arizona. The interesting things in this graph is seeing the late spike in cases (the first wave in Arizona came really in June). In the graph you can see the PCR Tests positivity % going up, cases spike then going down and later antibodies going up now at 15% level. The virus must hit some form of a ceiling and everything points that they will reach 20% serology level soon (In fact update today reached 19.4%) .Cases, hospitalizations, deaths follow exactly. One doesn’t see the numbers of deaths in the graph which is much smaller than in the NYC. This can be better treatment and/or younger patients

74583 richard riewer, replying to richard riewer, 11, #844 of 1428 🔗

Many people have found clues, bits & pieces here and there that tell us that we’ve been duped – now we need to find the smoking gun. The irrefutable, gotcha, you’re busted, hands in the air smoking gun.

74668 ▶▶ Carrie, replying to richard riewer, 1, #845 of 1428 🔗

The thing is, there are lots of pieces to the puzzle – you have to put them all together to see the whole picture..

74756 ▶▶ Carrie, replying to richard riewer, 7, #846 of 1428 🔗

I’d be saying as a starter ‘We were asked to agree to 3 weeks lockdown to squash the sombrero, and now it is masks until there is a vaccine?!’

74821 ▶▶ DavidC, replying to richard riewer, 1, #847 of 1428 🔗

Richard,
If all the data and facts don’t persuade people of the smoking gun, it’s going to take them, themselves, to realise the cognitive dissonance they’re displaying (see my response to major panic above).

DavidC

74608 Smileits1984, #848 of 1428 🔗

Anyone else notice how quiet Neil Ferguson has been lately? Nothing on Twitter since April 25th

74612 Jonathan Castro, 6, #849 of 1428 🔗

Anna Brees’ channel on YouTube is well worth a look. Lots of people sending in their videos talking about the current situation. I put a slightly amusing one up which you might come across :-).
https://www.youtube.com/c/AnnaBrees/videos

74620 JYC, replying to JYC, 8, #850 of 1428 🔗

Encouraging to see the march in Berlin. I’m just on the LS site for the first time today, so this might have been raised already. Are there any plans for similar protests in this country?

74662 ▶▶ Carrie, replying to JYC, 4, #851 of 1428 🔗

There was one in London yesterday, not that you’d have known as the MSM ignored it..

74621 Nobody2020, replying to Nobody2020, 9, #852 of 1428 🔗

There an audio clip in the article of Matt Hancock talking about recent actions to control the virus “I’m the health secretary in the middle of a global pandemic and so you’ll excuse me for being concerned about the health of the British people. And that is absolutely at the front of my mind”.
More people are dying from bowel cancer than coronavirus, figures reveal – as leading medic says Britain has become ‘obsessed’ with Covid deaths
https://www.dailymail.co.uk/news/article-8584377/More-people-dying-bowel-cancer-coronavirus.html

74665 ▶▶ Carrie, replying to Nobody2020, 5, #853 of 1428 🔗

He makes himself out to be some kind of celebrity / saviour – he has definitely gotten too big for his boots…

74672 ▶▶▶ annie, replying to Carrie, 5, #854 of 1428 🔗

So let him save a few victims from cancer.

74699 ▶▶ A. Contrarian, replying to Nobody2020, 7, #855 of 1428 🔗

I’ve just got to say it again:

I LOATHE THAT MAN!!

74725 ▶▶▶ Carrie, replying to A. Contrarian, 3, #856 of 1428 🔗

Remember that Tony Blair poster with the evil eyes? I’m thinking we need similar ones for Boris, Hancock, Whitty and Vallance. Well, in the case of Whitty, his eyes are already weird!

74747 ▶▶▶▶ A. Contrarian, replying to Carrie, #857 of 1428 🔗

If I knew anything about computer stuff, I’d be doing it right now.

74914 ▶▶▶▶ Basics, replying to Carrie, #858 of 1428 🔗

.

74818 ▶▶ Farinances, replying to Nobody2020, 4, #859 of 1428 🔗

Yes, Matt, you’re the health secretary in the middle of a ‘pandemic’ and you killed thousands of people. Well done.

74820 ▶▶ DavidC, replying to Nobody2020, #860 of 1428 🔗

Great stat, thanks for the link.

DavidC

74628 Major Panic, replying to Major Panic, 1, #861 of 1428 🔗

If you were a bedwetting we’r all going to die from covid type of person – what covids not that bad facts would blow your mind?
Very short answers (if any) please

74645 ▶▶ Howie59, replying to Major Panic, 7, #862 of 1428 🔗

Pick from any Major P. It’s faith based like a religion.

I have read a number of comments here where the follow up from many of us has been to say we should spread the information to others. Unfortunately, this is proving near on impossible to do.

It is like reading a book. We, the skeptics, are riveted and engaged in the plot and finish this book in no time. We find other books in the series and start reading those too.

We pass the first book to others. Some may read the prologue, but the twisting storyline is far too complicated for them to digest, so they give it back.

The majority however simply say “A book. Why on earth would I want to read?”

74666 ▶▶▶ Major Panic, replying to Howie59, 1, #863 of 1428 🔗

I was just after more ideas for a leaflet with simple headline facts, that might lead readers to a site like lockdown truths where they can find the whole story.
Already got loads but how does a bedwtter think, what facts would grab their attention the most

74693 ▶▶▶▶ JohnB, replying to Major Panic, 5, #864 of 1428 🔗

Average age covid death = >80
Life expectancy UK = >80

The accurate numbers will be available somewhere.

74828 ▶▶▶▶▶ IMoz, replying to JohnB, 1, #865 of 1428 🔗

Actually, life expectancy of those dying 80 year olds is about 75 or thereabouts (common mistake: “life expectancy” is defined as how long you are expected to live had you been born today, so you need to go back and look for the youngest age one needs to be to be expected to die this year, I did it back when COVID-19 madness started, and it’s about 75 YO).

74717 ▶▶▶▶ Howie59, replying to Major Panic, 8, #866 of 1428 🔗

Sorry. I was being defeatist. But its hard not to be.

I thought I was making progress with my immediate family. My brother is slowly waking but his wife is regimental in following the “laws”. We all know they are not laws, but to the unwoken, it is coming from a voice of authority.

He just wants a quiet life so goes along with it. Many others will be the same. Why jeopardise your marriage for the sake of such silliness. All it takes is a new directive or announcement from the powers that be and yesterday’s “facts” are simply forgotten.

If both partners agree on this then they can make a very powerful stand. Not all of us are so lucky.

FWIW, the direct correlation between average life expectancy and average age of death with/of Cv19 would be my fact.

Edit: This citation from Nobody2020 below is a stark reminder that death never stops and is definitely worth highlighting – https://www.dailymail.co.uk/news/article-8584377/More-people-dying-bowel-cancer-coronavirus.html

74748 ▶▶▶▶▶ Major Panic, replying to Howie59, #867 of 1428 🔗

Thanks, I agree trying to covert the bedwetters is like pissing into a strong wind – but I’ve got to do something or my head will pop

74773 ▶▶▶▶▶ Bruno, replying to Howie59, 5, #868 of 1428 🔗

I tell them that half the deaths with Covid on the death cert (one of (usually) a number of co-existing causes) have been of very elderly residents in care homes; the mean age of covid related deaths in UK is 83. And one in 4 of all those deaths with covid also had dementia. So they can stop worrying about catching it, but even if they tried, they’d have to lick 2000 people before coming across anyone who’d test positive, although they still wouldn’t be able to tell, because 8 out of 10 of those wouldn’t have any symptoms. And since they’d have to seek out either some very old people in care homes, or work in a slaughterhouse, Amazon warehouse, or picking fruit, it’s all a bit unlikely. Unless of course they were proposing to pass through a busy airport a few times in the near future.

Regarding action to take, I do think we ought to set out a very clear objective to which people could aim, in contrast to the knee jerk reactions of this government.

For me, that would be a thoughtfully managed strategy of moving towards herd immunity before the end of October: proper shielding of those in clinical and care home settings, clear advice for the frail and over 65s, giving them informed choice, and using natural human behaviours to ensure a wide spread of the disease among the groups most likely to be able to throw it off, most especially the very young (under 21s). Plus prompt use of the drugs best suited to the stage at which the sick person presents for medical intervention, and advice about promoting a healthy immune system. Easy peasy!

74829 ▶▶▶▶▶▶ Farinances, replying to Bruno, 2, #869 of 1428 🔗

It all sounds so simple when posited by someone with sense, doesn’t it?

74929 ▶▶▶▶▶▶▶ Bruno, replying to Farinances, #870 of 1428 🔗

Gee, thanks! But seriously, how much harder would that be, than what is being done at the moment?

74675 ▶▶ guy153, replying to Major Panic, 6, #871 of 1428 🔗

The number of people under 60 without comorbidities in the UK who have died with Covid is less than 300 out of at least several million infections.

74703 ▶▶▶ Major Panic, replying to guy153, 7, #872 of 1428 🔗

So putting that in laymen’s terms;

People under 60 with no serious health conditions have a 999.99 out if 1000 recovery rate from covid, and are 6 times more likely to die in a car accident.

Does that sound correct?

74961 ▶▶▶▶ guy153, replying to Major Panic, #873 of 1428 🔗

I think it’s better to give the actual number. Most people can see that 300 is not very many, especially when compared to several million.

74721 ▶▶▶ Carrie, replying to guy153, #874 of 1428 🔗

Good point for the leaflet!

74769 ▶▶▶ Farinances, replying to guy153, 2, #875 of 1428 🔗

Is ythere any way of finding out the suicide figures yet?

Because I bet for the same age range, the suicide toll is higher. JUST the suicide toll!

74812 ▶▶▶▶ Kath Andrews, replying to Farinances, 3, #876 of 1428 🔗

I have heard so many anecdotal accounts of people taking their lives and that is in SE Wales, Suicide will far out weigh deaths with covid – happened in Australia, I believe, several weeks ago and the reports from the US, last week, would appear to support this.

74817 ▶▶▶▶▶ Farinances, replying to Kath Andrews, 3, #877 of 1428 🔗

I actually know one person – and this happened in the week lockdown was extended past three weeks. I dread to think how the rate of suicides has probably increased – exponentially ;p – since then.

74873 ▶▶▶▶▶ annie, replying to Kath Andrews, #878 of 1428 🔗

Frankly, life in the bottom circle of Hell, i.e. Melbourne, can’t be worth living anyway.

74690 ▶▶ GLT, replying to Major Panic, #879 of 1428 🔗

Scatter plot of lockdown severity against deaths per million.

74697 ▶▶ A. Contrarian, replying to Major Panic, 4, #880 of 1428 🔗

Not exactly a fact – but asking people what the endpoint is can make them think a bit. If they say vaccine, ask how long they think we should wait, and what level of social and economic destruction is acceptable. If they say that anything is worth it to save one life, and trot out the lives vs economy argument, ask them how they think the NHS is funded…

A brief lesson in the number of deaths in a typical flu season can be good too. Many people don’t have a clue that flu is such a killer, especially amongst younger people. Why don’t those deaths matter at all (we make zero effort to reduce them), yet we must destroy the country to prevent even one death from covid?

74706 ▶▶▶ Youth_Unheard, replying to A. Contrarian, 1, #881 of 1428 🔗

To be honest, even though this is a shocker, I think we need to do some more to prevent what are thousands of deaths each year from the multitude of preventable causes that until now we have just gone so what? As with 99.9% of all lockdown sceptics, we also actually care about people’s lives and I’m not averse to trying, just obviously not at the same of the whole country and economy and society!!

74714 ▶▶▶ HoMojo, replying to A. Contrarian, 5, #882 of 1428 🔗

I keep on saying it, and I will keep on saying it: tell them to stop driving cars. That’ll save more than one life. Oh, lordy, that’s not convenient though. So better to bully people to wear a face nappy so the virtue signallers can feel better

74732 ▶▶▶▶ Bruno, replying to HoMojo, 6, #883 of 1428 🔗

I was thinking more along the lines of making governments all round the world pay for infrastructure to provide free drinkable water to everyone in their homes. Lives saved from cholera and so many other water borne diseases would be many; time spent fetching water would be available for education; and it would even cut down plastic usage, in many parts of the world noone dares drink water from the taps.

74745 ▶▶▶▶ A. Contrarian, replying to HoMojo, #884 of 1428 🔗

Oh yes, forgot that one!

74719 ▶▶▶ Carrie, replying to A. Contrarian, #885 of 1428 🔗

Good ideas..

74746 ▶▶ BTLnewbie, replying to Major Panic, 1, #886 of 1428 🔗

Deaths every day – gov figures (about 100) vs Eng and Wales NHS statistics (about zero).
If you can’t trust government on that- the most basic measure – what can you trust them on?

74874 ▶▶▶ annie, replying to BTLnewbie, 1, #887 of 1428 🔗

Nothing.

74876 ▶▶▶ Biker, replying to BTLnewbie, #888 of 1428 🔗

you can trust them to be pedophiles cultists who drink the blood of babies and harvest the Adrenochrome. However evil you imagine them to be it won’t come close to how evil they actually are.

74759 ▶▶ PoshPanic, replying to Major Panic, 5, #889 of 1428 🔗

Lockdown measures equal..

Genocide of the poor

Millions of patients worldwide, with treatable diseases, being neglected

A growth in suicides and mental health issues

The increase in childhood obesity

Just a few to get started with. We’ve gone through 6 months of arguing about statistics. This shit has to end. Tell people how it is. The cure was way worse than the disease.

74806 ▶▶ JohnB, replying to Major Panic, 2, #890 of 1428 🔗

Things that hit people in the pocket and long term health make them change there minds easily, so:

Projected Unemployment & lack of jobs
Effect on pensions and savings
Increases in prices, shopping, and bills
Damage lack of education is doing to children
Access to medical services and treatment

74819 ▶▶ DavidC, replying to Major Panic, 2, #891 of 1428 🔗

Don’t try to impress them with facts or data, it doesn’t work.

Ask them a question (e.g. what percentage of people have died in the UK, attributed to Covid-19 (it’s around 0.07%)? How many people die in the UK each year?
https://www.statista.com/statistics/281488/number-of-deaths-in-the-united-kingdom-uk/

Ask them if they know what ‘a case’ means (a positive PCR test, NOT a death!). Ask them if they know what increased testing will do (it will increase the numbers of positive results becuse more people are being tested). Ask them if they know how bad this ‘bad’ year is (the Hong Kong flu in 1968-69 killed 80,000 people in the UK with a lower population). Ask them if they know how many people are dying each week in relation to previous years (for the last FIVE weeks, total deaths in the UK are back below the five year average). Get THEM to provide answers which are wrong or incorrect in inference.

DavidC

74899 ▶▶▶ TheBluePill, replying to DavidC, 2, #892 of 1428 🔗

I asked someone this week what he thought the percentage of the UK population that had died was. The answer… 15%
15%! How bad at maths do you have to be to think that. Only out by a factor of 2,000 to 50,000 (depending on how badly you consider the figures to be fiddled).
How can people think things like this without doing any kind of internal sanity check?

74889 ▶▶ Margaret, replying to Major Panic, 3, #893 of 1428 🔗

I ask people if they were frightened/didn’t wear masks/went about their normal lives in February/early March of this year. Infection rates were supposedly at their highest then before deaths peaked on April 9th. Why are they so frightened now.

75147 ▶▶ Nigel Sherratt, replying to Major Panic, 1, #894 of 1428 🔗
  1. Positive test rate now indistinguishable from false positive rate (ONS).
  2. No teacher shown to have been infected by a pupil anywhere in the world.
  3. Japanese 2018/19 ‘flu epedemic despite mask wearing and now CV-19 cases rising in Japan.
74636 swedenborg, replying to swedenborg, 17, #895 of 1428 🔗

https://www.onenews.ph/duterte-wear-face-mask-or-face-arrest-pnp-to-intensify-operations-against-violators-of-covid-19-protocols
“In a text message, PNP deputy chief for operations Lt. Gen. Guillermo Eleazar said they would double their efforts in compliance with President Duterte’s directive to apprehend and detain individuals who are not wearing face masks in public places.”
Philippines is a good example that facemasks are not going to stop the spread of the virus.Despite one of the strictest mask rules in the world and severe punishment the virus does not seem to respect these laws. Philippines has now record numbers despite having masks for months. How on earth can you believe that in a situation with very low Covid-19 incidence mask wearing can protect you against the virus or stop you spreading it?

74657 ▶▶ OKUK, replying to swedenborg, 5, #896 of 1428 🔗

You have to have faith brothers and sisters!! The Church of the Latter Day Scientists and Scoundrels doesn’t operate on the basis of evidence and logic.

74667 ▶▶▶ annie, replying to OKUK, 6, #897 of 1428 🔗

Like the smoker. Health warnings on cigarette packets frightened him so much that he gave up reading.

74777 ▶▶▶▶ JohnB, replying to annie, 1, #898 of 1428 🔗

I always buy the ones that say smoking can harm my unborn child …

74859 ▶▶ richard riewer, replying to swedenborg, 2, #899 of 1428 🔗

President Duterte is a psychopath. Loved and admired by the W.H.O.

74974 ▶▶▶ Bart Simpson, replying to richard riewer, #900 of 1428 🔗

He certainly is. Unfortunately there are enough sheep who believe in him or who follow the rules blindly because of his threats. And the PNP is corrupt as hell, much like the rest of the government.

74655 AngloWelshDragon, replying to AngloWelshDragon, 31, #901 of 1428 🔗

A first for me today as I actually got asked if I had a mask on me at a shop today (Screwfix) I just smiled and said “I’m exempt” and got waved inside. I don’t even bother with my lanyard anymore though I keep it in my bag. I think being a middle aged woman helps as my demographic are among the most Covid compliant in my experience. I think people look at me and just assume I must have a legit excuse. I also make a point of smiling and being polite and chatty. Most mask wearers are so sullen and withdrawn shop workers seem to bend over backwards for me. As one of the only none masked in our Sainsbury I’m now quite the celebrity and get staff calling “hi how are you?” when they see me!

I’ve had no hostility from masked shoppers. A few people do a double take but I just smile and nod. I don’t doubt there are fanatically pro mask kapos out there spoiling for a fight but generally bullies don’t pick on confident people so I walk tall with head held high and look everyone in the eye. It’s always the masked who look sheepish (baaaa)!

74660 ▶▶ Carrie, replying to AngloWelshDragon, 12, #902 of 1428 🔗

Confident body language is essential!

74661 ▶▶ Kath Andrews, replying to AngloWelshDragon, 3, #903 of 1428 🔗

Go you 🙂

74663 ▶▶ Bart Simpson, replying to AngloWelshDragon, 3, #904 of 1428 🔗

Well done!!!

74669 ▶▶ JulieR, replying to AngloWelshDragon, 12, #905 of 1428 🔗

Yes, I am like you, just smile and act confidently. Nobody said anything so far.
On Friday I was in local coop with my teen daughter, both without masks. Everyone else was wearing masks.
After we came out I said to my daughter You see, it is fine not to wear a mask.

74890 ▶▶ LuluJo, replying to AngloWelshDragon, 8, #906 of 1428 🔗

Same here, walk confident, big smile, walk straight past the hand sanitiser and have a long chat with the shop staff at the till. Completely unchallenged so far. If shop staff are masked up, I always ask how they are getting on with them. I’m not putting up with this sh*t any longer. And if BoJo reckons he can lock up the over 50s he’s got another think coming when it comes to this particular over 50!

74720 sarnskeptic, replying to sarnskeptic, 9, #907 of 1428 🔗

Went to Topps Tiles twice in the last week (always buy the correct things first time…). Last Saturday the staff – bar one older lady – were all wearing masks. Yesterday, none of them, including two who were there last week. No challenge either time although other customers looked a bit confused. Served by same older lady and asked her how it was going. “very busy, think people are stocking up so they’re prepared for when it happens again” she said (talking about lockup clearly).

I’m not ‘exempt’ and won’t claim to be. I’m also young and male and fairly well built so don’t expect to be challenged by anyone but the most hardline devotees.

Girl on Morrisons click and collect also mentioned that many people were really uncomfortable with masks although still going shopping. So there is hope…

74781 ▶▶ RickH, replying to sarnskeptic, 10, #908 of 1428 🔗

“I’m not exempt”

You are. Everyone is.

74722 swedenborg, replying to swedenborg, 5, #909 of 1428 🔗

https://www.cebm.net/covid-19/covid-cases-in-england-arent-rising-heres-why/

Sorry if posted before but from Carl Heneghan who seem to be the only person in Public Health talking sense about cases in pillar 1 and 2 .

74778 ▶▶ RickH, replying to swedenborg, 2, #910 of 1428 🔗

No apology needed – the CEBM data is one bit of solid ground in this swamp of misunderstanding, misinformation and fraud :

The potential for false-positives (those people without the disease who test positive) to drive the increase in community (Pillar 2) cases is substantial, particularly because the accuracy of the test and the detection of viable viruses within a community setting is unclear.”

This is typical CEBM understatement (note the difference in comparison with the pseudo-scientist attention seekers from SAGE loudly shooting off their mouths).

But it is actually a massive indictment, behind which lies the highly questionable nature of PCR tests in their search for stray bits of RNA – a factor that isn’t really taken into account in this arleady damning analysis.

74724 The Walrus, replying to The Walrus, 3, #911 of 1428 🔗

Very good guest editorial in the Boston Globe today. Surprised they ran it considering how much they support the pandemic fearmongering.

The dangerous pursuit of safety
https://edition.pagesuite.com/popovers/dynamic_article_popover.aspx?artguid=ccaf3e16-df0e-4e8a-bc69-48fc80353c6f&appid=1165

74767 ▶▶ RickH, replying to The Walrus, 15, #912 of 1428 🔗

A very penetrating article. The ‘mission creep’ is well outlined :

Early in the COVID-19 outbreak, before the nature of the virus was better understood, “lockdowns’’ could be and were justified as a temporary expedient in the face of a deadly threat. But once we “flattened the curve’’ to prevent hospitals from being overwhelmed, something strange happened: As studies began to hint and then to show that the virus was not as deadly as originally feared …..the goals of public health measures like lockdowns and the closures of schools changed. Instead of preventing the overwhelming of hospitals, the focus moved to stopping the “spread of the disease.’’

People have short memories and even shorter intelligence . No wonder those telephone scams reap large rewards!

74775 ▶▶ Lisa from Toronto, replying to The Walrus, 1, #913 of 1428 🔗

Shockingly good piece, particularly from a college professor!

74900 ▶▶ BTLnewbie, replying to The Walrus, 1, #914 of 1428 🔗

Superb article:
“Rational individuals understand that virtually every act entails some kind of risk, and we accept those risks every day of our lives. We don’t live as if we are likely to die at any moment (from cancer or a car accident or a gunshot); we live as if we know that the risks inherent in life and liberty are far outweighed by life’s joys and opportunities.”

74731 swedenborg, replying to swedenborg, 4, #915 of 1428 🔗

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7391050/
Surprising? Pseudoscientific beliefs and psychopathological risks increase after COVID-19 social quarantine
 “Measures taken after quarantine indicate that perceptual disturbances, subclinical psychotic symptoms and beliefs in the pseudoscience have increased.

74872 ▶▶ annie, replying to swedenborg, 3, #916 of 1428 🔗

Well, what a surprise.

74733 Tenchy, replying to Tenchy, 8, #917 of 1428 🔗

Half a million tests a day is the the government target, and this new “quick test” will enable them to do it; whole cities being tested – what, compulsory testing?

https://www.telegraph.co.uk/news/2020/08/02/whole-cities-towns-tested-case-local-covid-outbreak-using-90/

If this happens, the bat flu really is never going to go away. As Autumn and Winter approach, they’ll be carrying out ever more tests, and a “second wave” will be manufactured on the back of the positive tests.

74738 ▶▶ Carrie, replying to Tenchy, 4, #918 of 1428 🔗

Sounds like the latest idea for mass-harvesting of the population’s DNA…

74751 ▶▶▶ Tenchy, replying to Carrie, 2, #919 of 1428 🔗

The question certainly needs to be asked about DNA.

74762 ▶▶▶▶ Carrie, replying to Tenchy, 5, #920 of 1428 🔗

Yes, it does. Ever since the track and trace was declared to contravene GDPR, they have ramped up testing, offering it to anyone who asks. That way you have voluntarily agreed to allow them to take your data..

A question: do they make you sign anything when you go for a test? Or have they sneakily written into the coronavirus law that the pandemic means that human body material/tissue can be retained due to the emergency situation?

74766 ▶▶▶▶▶ Tenchy, replying to Carrie, 6, #921 of 1428 🔗

There are straightforward questions to ask:

1) Is the sample DNA tested as part of the testing protocol?
2) How long is the sample kept?
3) Could the sample be DNA tested later?
4) Do I have any rights to have the sample, and any DNA-related data, destroyed/deleted?

74801 ▶▶▶▶▶ Bruno, replying to Carrie, 2, #922 of 1428 🔗

I sort of get the impression that even if ‘they’ swore to you, scouts’ honour, cross their hearts and hope to die, that it wouldn’t be recorded, and the sample wouldn’t be kept, you wouldn’t believe them?

74815 ▶▶▶▶▶▶ Farinances, replying to Bruno, 3, #923 of 1428 🔗

To be honest, I wouldn’t believe them either.

74808 ▶▶▶▶▶ Kath Andrews, replying to Carrie, 2, #924 of 1428 🔗

At a friend’s house, Gold Radio (f..king hate that radio station, but I’m a guest so can’t complain) – constant adverts about getting back to doing those things that we love….going to the cinema, meeting up with friends, going to museums……………..but – you have to have a test first….

74741 ▶▶ A. Contrarian, replying to Tenchy, 1, #925 of 1428 🔗

Sorry, we must have posted this at the same time!

74755 ▶▶▶ Tenchy, replying to A. Contrarian, 2, #926 of 1428 🔗

No problem. The article needs emphasising anyway.

74763 ▶▶ RickH, replying to Tenchy, #927 of 1428 🔗

What a nice little earner! (If totally pointless)

74735 A. Contrarian, replying to A. Contrarian, 6, #928 of 1428 🔗

https://www.telegraph.co.uk/news/2020/08/02/whole-cities-towns-tested-case-local-covid-outbreak-using-90/

Yet more testing to create second, third and umpteeth waves coming to a town near you this winter.

The tests can detect flu as well as Covid, meaning people who have Covid-like symptoms will know whether they are suffering from the more common illness and can avoid self-isolating.

You what? So if you’ve “just” got flu, you’ve got carte blanche not to isolate or take any precautions at all? Go and give it to granny, if she dies it’s fine because it was just flu, not covid?!

74736 ▶▶ A. Contrarian, replying to A. Contrarian, 1, #929 of 1428 🔗

It also states that the IFR is between 1 and 3.4%!

And hospitalisation rate is 19% of total cases, i.e. 1 in 5. That’s not right, surely?

74749 ▶▶▶ NickR, replying to A. Contrarian, 3, #930 of 1428 🔗

It’s right if you’re 90 with diabetes & high blood pressure.

74836 ▶▶▶ OKUK, replying to A. Contrarian, 1, #931 of 1428 🔗

Sounds like a load of gonads!!

74739 ▶▶ Farinances, replying to A. Contrarian, 6, #932 of 1428 🔗

This is funny. Covid’s not as bad as flu for the majority of people including children, but let’s go around spreading flu like we always do yaaaay.

74761 ▶▶▶ RickH, replying to Farinances, 3, #933 of 1428 🔗

Amazing – but illustrative of the deep, deep ignorance that exists.

74837 ▶▶▶ OKUK, replying to Farinances, 1, #934 of 1428 🔗

Yep it’s like people are going around with “I [heart] the flu” T shirts while wearing face masks.

74861 ▶▶▶▶ richard riewer, replying to OKUK, #935 of 1428 🔗

Not a bad idea. A ‘I heart the flu’ t-shirt.

74787 ▶▶ Barney McGrew, replying to A. Contrarian, #936 of 1428 🔗

That is such a great quote. It really illustrates the problem, here.

74740 swedenborg, 7, #937 of 1428 🔗

https://twitter.com/justin_hart/status/1290036047804379136/photo/1
 Japan’s turn. There is no hiding from the virus. Even with 100% mask compliance.

74743 wendyk, replying to wendyk, 24, #938 of 1428 🔗

Went for a much needed walk with a friend today, who told me how irresponsible her former son-in-law was: he’s an anti-masker.

Admittedly, he has caused endless trouble for my pal’s daughter : disputes about access to the 2 children, constant aggravation etc, but, when I said that in this instance I agreed with him, being an opponent of all forms of gagging, she asked whether I thought I knew more than the experts.

I listed the names of the many experts who have shown that masks and bits of cloth are a waste of time, that the overreaction and loss of normal freedoms are a worrying and sinister trend and that thousands of lives are being blighted by the lockdown and control creep.

Did the every year the flu hits, we’ve got to learn to live with this, as we’ve been doing since human time began, the economy is in free fall etc, the poor are bearing the brunt of the mounting hardship and why is everyone so frightened bit, but it’s not making much headway.

She did listen and we’re still friends thankfully, but, I’m the only bare faced rebel in my area; everyone else has signed to the gagging diktat and many are in thrall to Nicola.

74785 ▶▶ Achilles, replying to wendyk, 18, #939 of 1428 🔗

The simple fact is there is not a scientific consensus on masks a political and media one. The masks were a line in the sand for me as even if you thought lockdowns were wrong there was at least a genuine scientific argument that could be made for lockdown and reducing the R number. Policy was being led by (some) science. With masks that is clearly not the case. There was no genuine scientific evidence for their efficacy and the WHO grudgingly said it might possibly, maybe, perhaps make a bit of difference only after massive political pressure from their paymasters. Policy was no longer following science it was science following policy. Make no mistake masks aren’t mandatory here to save peoples lives they’re to save Boris’s career. Boris has used emergency powers in a health crisis for political purposes. That is the route to totalitarianism.

74744 JohnB, replying to JohnB, 2, #940 of 1428 🔗

After the Cat with COVID-19 story a few days ago, the animal to human transmission story is being pushed again, which I believe will be ramped up over the next couple of weeks to establish a link.

https://www.washingtonpost.com/world/europe/scientists-study-coronavirus-outbreaks-among-minks-in-europe/2020/08/02/1cbe001c-d48e-11ea-826b-cc394d824e35_story.html

74802 ▶▶ Kath Andrews, replying to JohnB, 1, #941 of 1428 🔗

I have fears regarding this – they will take away our freedoms, liberties and so on and then take away what we love. I had no choice but to walk away from my ex at the end of 2018, he’s a hard left BBC fanatic and the kind of person who would have the cats that I had no choice in leaving in his care with him – euthanised – I f@@king despair 🙁

74760 Kate, replying to Kate, 30, #942 of 1428 🔗

I was sorry to read a dispiriting comment yesterday about the standupX demo in London on the 1st August. I was there and felt that although if did admittedly attract some people with concerns that seemed strange to me I have to realise that my perceptions have moved dramatically in the last few days and ideas I would have dismissed just a short time ago, as conspiracy theories and very far fetched, I now have some credence for.

The most useful thing about that demonstration was that we walked through Oxford Street shouting “Take off your masks” and provided a public example that it could be done. This is very important.

74765 ▶▶ Farinances, replying to Kate, 6, #943 of 1428 🔗

i think so too 🙂 I would happily go out and protest about this with people I vehemently disagree with on other issues.

74780 Paul Collits, #944 of 1428 🔗

To our Melbourne friend, see my articles on covid madness at The Freedoms Project, bastion of freedom.

74789 nfw, replying to nfw, 9, #945 of 1428 🔗

What I love about the face nappy mandate is all the money is flowing to dirty, filthy, lying, corrupt, racist, fascist China. A great business case: create a climate of fear by creating a new flu then have your lackeys in The WHO and national gummints mandate face nappy (diaper for Americans) use. Talk about a win-win situation.

74813 ▶▶ OKUK, replying to nfw, 6, #946 of 1428 🔗

I think this is the great question of our time … how far do you go down the conspiratorial road?

For instance, we know as absolute facts that the Chinese Communist government conspires to:

– Steal IP from other countries.

– Imprison and brainwash a whole ethnic population (the Uighurs) while pretending they don’t.

– Buy influence through university endowments.

– Illegally transport laboratory p pathogens across borders from democratic countries to China.

That’s just a few of their nefarious activities, all completely backed up by evidence and documentation. So it’s not crazy to think they are conspiratorial. I am sure they have been engaged in lots of other conspiracies but what exactly? It’s rational to believe they are engaged in conspiracies but there is no rational means to determine with absolute certainty what they might be.

74947 ▶▶▶ mjr, replying to OKUK, 3, #947 of 1428 🔗

Dont forget

  • Impose debt dependency and servitude on third world countries via BRI (Belt and Road Initiative)
  • Make illegal territorial expeditions and take over international waters and other state property (eg South China Sea )
  • Currently threatening to reincorporate Taiwan
  • Removal of civil rights in Hong Kong granted under treaty
  • Using high tech surveillance on their own population
  • Ignoring any “climate change” initiatives (100+ new coal power stations this year)
  • Wholesale ignoring of any animal/biological rules (interesting article in MoS yesterday about chinese commercial fishing (estimated 100 million shark a year) ).

I could go on but this is just off the top of my head

74793 RickH, replying to RickH, 7, #948 of 1428 🔗

Just a warning about the ‘Spiked’ article listed above.

It’s only a partially good read, and is right about herd immunity – but it still contains essential knicker-wetting stuff about older people, which neglects *actual* risk analysis and a sense of proportion now that there is no epidemic – and doesn’t analyse the impracticality of a vaccine.

It still promotes the fallacious idea that this virus is somehow exceptional.

74805 ▶▶ OKUK, replying to RickH, 1, #949 of 1428 🔗

You mean whether you die in June or July is really neither here nor there when you reach the end of the road?

74843 ▶▶▶ RickH, replying to OKUK, 2, #950 of 1428 🔗

No – I didn’t mean that. But it’s a point.

More important – if the end of your road is a choice between an existence in a desiccated, miserable society and a ‘normal’ life, which would you choose.

There’s no point from any cost-benefit analysis in this ‘false safety’ existence in exchange for real life.

Of course, I’m an awkward and contrary bastard. Cancer and dodging its bullets tends to give you a bit of a sense of proportion and risk.

74871 ▶▶▶ annie, replying to OKUK, 2, #951 of 1428 🔗

What kind of plaint have I
Who perish in July?
I might have had to die
Perchance, in June.

W. S. Gilbert

74880 ▶▶ Sally, replying to RickH, 1, #952 of 1428 🔗

It also promotes the idea of locking older people up apparently without any say at all on their part.

75212 ▶▶▶ JohnB, replying to Sally, #953 of 1428 🔗

Nah, we get a say.

“Fuck off !”

74807 Barney McGrew, replying to Barney McGrew, 14, #954 of 1428 🔗

I had an interesting discussion with a family friend who is a fully compliant Covid believer.

She told me that she won’t be going back to the shops until masks are no longer ‘needed’ because she finds them so unpleasant. I asked her how long she thought that was going to be, and she replied ‘Quite a few weeks’.

I asked her what her limits were; how long can she tolerate the Covid restrictions? ‘Well, weeks’. And what if they go on for months, until next year, or even longer? This is where it gets weird: you can’t get people to acknowledge the possibility or answer the question. I suspect that (a) they don’t think it is under human control; (b) they don’t want to think about it.

74809 ▶▶ Achilles, replying to Barney McGrew, 7, #955 of 1428 🔗

It’s the same when I hear people say they won’t send their kids back to school until it’s safe whatever the government says. Well how on earth are you going to decide when it’s safe then?!

74822 ▶▶▶ OKUK, replying to Achilles, 9, #956 of 1428 🔗

All kids in schools exchange pathogens all the time. It’s called life! If living in pathogen-free environments was actually healthy we would all put our children in plastic bubble tents and never have direct contact with them ever again. Do we want to do that? Of course we dont! But our UK (U Krazies) government encourages this deadly “plastic bubble” mentality.

74937 ▶▶▶▶ wendy, replying to OKUK, 4, #957 of 1428 🔗

I think people have lost sight of the fact that we have evolved a working immune system. It evolved to help us when we encounter viruses and bacteria. The world seems to be acting like human beings haven’t encountered these things for ever and it’s natural to do so.

74869 ▶▶▶ annie, replying to Achilles, 7, #958 of 1428 🔗

The word ‘safe’ has become effectively meaningless when used by zombies.Like a duck quacking, or a baby going waaah waaah.

74885 ▶▶▶▶ Bella Donna, replying to annie, 8, #959 of 1428 🔗

I find that the word ‘safe’ triggers me and not in a good way! 😠

74811 ▶▶ Farinances, replying to Barney McGrew, 6, #960 of 1428 🔗

A wonderful demo of the short-sightedness of zealots. (Of any stripe, not just the covysterics)

74824 ▶▶ OKUK, replying to Barney McGrew, 4, #961 of 1428 🔗

Sadly some people – including close relatives – don’t think. They just think they’re thinking!

74834 ▶▶▶ IMoz, replying to OKUK, 8, #962 of 1428 🔗

You give “them” too much credit: I was talking to someone and said: “just think about it…” when they interrupted and said “I don’t need to think, the government tells me what is safe”

How do you ever converse with that level of intellect?!

74840 ▶▶▶▶ OKUK, replying to IMoz, 9, #963 of 1428 🔗

You say “Thalidomide” and if that fails you say “Asbestos”, also considered safe by government back in the day.

74845 ▶▶▶▶▶ IMoz, replying to OKUK, 4, #964 of 1428 🔗

“They know much more now than they did back then” 😉 not my first rodeo with such “kind” 😉

See, the problem is, you and I actually are capable of cognitive process, those people are on autopilot

74887 ▶▶▶▶▶ Bella Donna, replying to OKUK, #965 of 1428 🔗

You make a good point there.!

74870 ▶▶▶▶ annie, replying to IMoz, #966 of 1428 🔗

😱

75179 ▶▶▶▶▶ IMoz, replying to annie, 1, #967 of 1428 🔗

Don’t see why you’re shocked: how many people shut up as soon as they get a “it’s health and safety” response 😉

74886 ▶▶▶▶ Bella Donna, replying to IMoz, 2, #968 of 1428 🔗

People can be such a disappointment.

74830 ▶▶ Achilles, replying to Barney McGrew, 14, #969 of 1428 🔗

I can’t wait for the cold and flu season on public transport. If you sneeze are you supposed to do it in to the mask, snot running down your face in to your mouth? If you have a cough will people start to move away from you like you’re some kind of suicide bomber? Will you get sent home from work if you have a sore throat? The covid phobics will probably pull the emergency cord and throw you off the train.

74835 ▶▶▶ OKUK, replying to Achilles, 4, #970 of 1428 🔗

I’ve always moved away from coughers, snorters and sneezers on the tube in London, just like you move away from crazies on the bus. Sensible precautions. You don’t stand there and get coughed upon.

74842 ▶▶▶▶ RickH, replying to OKUK, 1, #971 of 1428 🔗

… and how many people normally actually cough/sneeze without covering?

74841 ▶▶▶ Farinances, replying to Achilles, 2, #972 of 1428 🔗

I have already seen multiple people pull their mask down to sneeze.

74883 ▶▶ GLT, replying to Barney McGrew, 4, #973 of 1428 🔗

The irony lost on these people is that the research increasingly points to the fact that it is our constant sharing of pathogens that is the primary reason that this has turned out to not be a deadly ‘novel’ virus.

74912 ▶▶ Lili, replying to Barney McGrew, 3, #974 of 1428 🔗

My partner is the same. He’s also convinced it’s just for a couple of months. When I tell him the muzzling legislation is in place for a year he just says nothing. When I ask him why he thinks the government will announce no more wearing of muzzles when the weather gets colder and the flu season starts he just says ‘It won’t happen’. I’ve told him that rather than have us remove them, this evil bunch will announce that we have to wear them outside from October, throughout the winter months.

74839 IMoz, replying to IMoz, 8, #975 of 1428 🔗

At the risk of sounding like a conspiracy theorist, what if the whole “swab” testing drive (aka qPCR) is really just a disguised attempt to collect population DNA?

74909 ▶▶ Lili, replying to IMoz, 1, #976 of 1428 🔗

You’re not the first person to suggest that. Steer well clear. I’m not even registered with an NHS doctor anymore. I sensed something rotten would be coming down the tracks when the whole ‘patient database’ thing began. I opted out and then, when I moved, I just didn’t join a surgery.

74847 richard riewer, replying to richard riewer, 2, #977 of 1428 🔗

I was in the U.S. Army in 1968, destination Vietnam. We were given lots of shots to protect us from who knows what diseases with a metal gun type vaccination machine that punched out a needle at high speed. Just this morning I began to wonder if any of the diseases that we were being vaccinated against had any family resemblance to this year’s coronavirus or similar virus strains mainly circulated in Asian countries. How would I find out. Vietnam, China, Asia. Hmm?

74879 ▶▶ Jane in France, replying to richard riewer, #978 of 1428 🔗

There are those who say that the vaccinations American soldiers were given in 1918 before they left for Europe were what gave rise to the “Spanish” flu (which seems to have been bacterial pneumonia).

74857 Cristi.Neagu, replying to Cristi.Neagu, 5, #979 of 1428 🔗

These people are insane… I propose fines for people proposing fines without any demonstrable reason.
https://www.businessinsider.com/fines-needed-people-dont-wear-masks-covid-19-coronavirus-2020-7?r=US&IR=T

74860 ▶▶ ColoradoGirl, replying to Cristi.Neagu, 3, #980 of 1428 🔗

What a horrendous article.

74906 ▶▶▶ Lili, replying to ColoradoGirl, 1, #981 of 1428 🔗

Kathi Valeii’s journalism and essays focus on parenting, identity, and justice issues, and often the intersection of those topics.’
She’s yet another left wing fascist. They just cannot leave people alone.

75207 ▶▶▶▶ JohnB, replying to Lili, #982 of 1428 🔗

Do we think she ever smiles at her children ? One of the gloomiest googleimages searches I’ve done for quite a while.

74862 richard riewer, replying to richard riewer, 3, #983 of 1428 🔗

The anti-obesity crusande will most likely increase the number of snitchers in UK society.

75075 ▶▶ Nick Rose, replying to richard riewer, #984 of 1428 🔗

I think it must be self-evident who’s letting the side down when it comes to shedding pounds!

74864 Doodle, replying to Doodle, 24, #985 of 1428 🔗

It’s 4 o’clock in the morning and I’ve imbibed two bottles of heavy weight red wine. You know what I think? Fuck them all. That’s it.

I’m in the last stages of a relationship breakdown with a person who refuses to engage in any rational discussion on this subject. I no longer have any friends who are capable of any rational thought, so no friends at all. I’m essentially alone in this dystopian nightmare.

I’ve assessed my options and they appear to be 1) Accept everything and become a sheep. 2) Go ‘man of the forest’ and live in a cave. 3) Go ‘postal’ and kill everyone subscribing to this farce that I happen across. 4) Get a sniper rifle and take out every politician that I can. 5) Commit suicide and be done with it.

I don’t know where I go from here. As it stands I’m incapable of any empathy toward my fellow man/woman considering them to be both incredibly stupid and incredibly even more stupid.

I have an ongoing need to visit my GP surgery but I refuse to wear a mask so I’m not able to actually attend. I have a number of genetic health issues that result in the necessity of taking 100 tablets a week to keep me functioning but the only appointment I can get with the hospital is by phone. I’ve waited five months for an appointment only to be informed that it will be a telephone consultation. I have to be monitored on a regular basis but that has all gone by the board. I’m in danger of succumbing to a number of life threatening conditions but no-one gives a fuck.

It’s a wonder, in light of this, that I’m still a rational, thinking individual. But at any moment I’m liable to go absolutely berserk. I’m no longer allowed outside of the house because I can’t control myself when presented with a myriad of masked twats and I inevitably go off on one.

I am abandoned and alone and I hate every human that has embraced this soul sucking, perverse lifestyle. I hate every one that has ever given their consent to being corralled, railroaded or nudged into a pen of unthinking, stupid acceptance. I hate every idiotic farcebook and twatter inhabitant. I hate every politician, every corporation and every public body that has accepted that this is the new normal.

Other than that, I’m doing fine.

74866 ▶▶ RyanM, replying to Doodle, 2, #986 of 1428 🔗

What about moving to Sweden?

74877 ▶▶ DeepBlueYonder, replying to Doodle, 1, #987 of 1428 🔗

If you need support, it is there for you. Tel: 116 123. https://www.samaritans.org/

74882 ▶▶ GLT, replying to Doodle, 6, #988 of 1428 🔗

Hang in there. I think for most of us on here it’s been like landing on an alien planet and many of us have lost or are questioning friendships. It will end…there is only so far you can go with data that all says the same thing. People will wake up. We may all feel huge resentment towards them but I hope it will pass.

74884 ▶▶ Bella Donna, replying to Doodle, 7, #989 of 1428 🔗

You are not alone, just remember that. But it’s important to share your thoughts so have a rant with us whenever you feel the need. I’m very much pissed off with my fellowmen too and it’s just as well as we don’t own guns because I’m sure I’d be using it.

75202 ▶▶▶ JohnB, replying to Bella Donna, 1, #990 of 1428 🔗

It is never ‘just as well we don’t own guns’, Bella. This is another meme from the bad guys.

People, on the whole, cope with owning a car yet not drink driving. It’s only the state boogeywoman ( 🙂 ) that tells us we are incapable/incompetent/untrustworthy.

74892 ▶▶ BTLnewbie, replying to Doodle, 9, #991 of 1428 🔗

“I no longer have any friends who are capable of any rational thought, so no friends at all”.
Doodle, you do have friends, allies, supporters, and they’re right here with you – the hugs are only virtual but you should be able to feel them nonetheless.
Hang on in there. “This too shall pass”. The dam will break. We will be vindicated.

74903 ▶▶ Lili, replying to Doodle, 8, #992 of 1428 🔗

Doodle, I don’t know what area you live in but if you have a Keep Britain Free or any sceptic group then do go along to be with people who get it. I would also recommend looking into the Slow movement. It’s about taking your life right back to getting enjoyment out of the simple things. I say this as someone who was in a bit of a bad way a few years ago and I found peace and sanity in getting my hands in the soil and gardening – growing a bit of my own food (huge satisfaction from growing just a few handfuls of runner beans), walking or cycling, cooking and reading. For me, the madness fades away when I’m pottering at home or in the garden. As for your partner – try not to be angry. My partner thinks the government is doing its best, even though he disagrees with pretty much everything they’re doing – how’s that for cognitive dissonance? Remember that the government has used shock and awe tactics and many people just cannot believe that we could be governed by such evil. I find that letting people slowly unravel things themselves is best, otherwise they dig their heels in. No one wants to appear stupid or gullible by believing in this crap. God bless. I hope things get better for you.

74915 ▶▶ Mark, replying to Doodle, 4, #993 of 1428 🔗

I recommend option 6:

6) Recognise that you are a dissident in a society dangerously intolerant of dissent, and structure your life appropriately. The disadvantage is that you have to live more carefully and to adopt a rather different attitude to the wider populace and their institutions. The advantage is that you are right and they are wrong. Objectively so, in this case.

There are fellows out there. you just have to look a bit harder and more carefully.

75205 ▶▶▶ JohnB, replying to Mark, #994 of 1428 🔗

Leaving aside Fishbook, Twatter, and the like, I haven’t seen much dangerous intolerance. What have you experienced, Mark ?

74928 ▶▶ wendy, replying to Doodle, 3, #995 of 1428 🔗

Hold on in there, think a lot of us feel like that at the moment. We have Carl Heneghan on our side he gets listened to. Thinking of you

74865 richard riewer, replying to richard riewer, 7, #996 of 1428 🔗

Susan Bradford was on the Richie Allen several weeks ago. She just published a book in May 2020:

UNMASKED: THE CORONAVIRUS STORY

The Nauseating Truth Behind the Global Quest to Bring the World to Heel, Destroy Nationalism, and Undermine the Trump Presidency through Fake Scandals, Simulated Pandemics, Junk Science, Political Puppets, Brazen Extortion, and Rapacious Money Grabs

Available on Amazon!

Kindle version now available.

Note: Amazon will not allow “Coronavirus” to appear in the title of e-books, due to WHO guidelines .

75071 ▶▶ Nick Rose, replying to richard riewer, 1, #997 of 1428 🔗

Just called “The Story” then?

74867 Eddie, replying to Eddie, 8, #998 of 1428 🔗

Uhoh! Went on a date tonight and the big subject came up and I tried to keep a lid on it. Said somewthing like “there’s a lot more going on here” and things got a bit quiet. I may be the first skeptic to not get another date cause I went there with my views just a tiny bit.

Or it could very well be my unsightly, chewed-up fingernails that turned her off (most likely)

74868 ▶▶ annie, replying to Eddie, #999 of 1428 🔗

Remember Woody Appllen’s childhood matches: the nail biters against the bedwetters?

74898 ▶▶ anon, replying to Eddie, #1000 of 1428 🔗

stick to your guns brother!

after years of biting I recently discovered large kitchen scissors do a good job. 3 or 4 cuts per nail moving the scissors between cuts

74917 ▶▶ Major Panic, replying to Eddie, -1, #1001 of 1428 🔗

“my views just a tiny bit.”

You mean you bored the shit out of her….

74934 ▶▶ Mr Dee, replying to Eddie, 2, #1002 of 1428 🔗

I hope you both kept 10 metres apart and wore full-body condoms.

75070 ▶▶▶ Nick Rose, replying to Mr Dee, 1, #1003 of 1428 🔗

Sounds to me like the next generation is going to be a scarce one.

74878 Steve Martindale, replying to Steve Martindale, 14, #1004 of 1428 🔗

You have probably seen on the news that there is talk of a new rapid Covid test, https://www.bbc.co.uk/news/uk-53632043 worringly the news report included the comment ‘No data on the accuracy of these tests has been made publicly available yet but those behind them say there are controls in place to check for false negatives.’
The news reports all indicate that this is good news but the cynic and the sceptic in me urges caution.
Q1 Is the Government trying to eradicate this disease (too costly) or contain it?

Q2 What does this test; test for? can it distinguish between active live infections and the debris from infections that have been zapped?

Q3 Are the results just advisory for the person are are they going to form part of the public record.

Q4 If they are to form part of the public record what are they going to do if they find lots of positive results? This test might find it everywhere, then what do they do?

There is also great joy in the news that this test will identify common flu, what is the point of that? as Dylan sang ‘ you don’t need a weatherman to know which way the wind blows’. I know when I have the flu – a shivery sweaty night wrapped in lots of blankets and then its gone, what do I need a test for? Testing opens a large can of worms, there needs to be a widespread debate on this and a bit of scepticism.

74881 ▶▶ Bella Donna, replying to Steve Martindale, 22, #1005 of 1428 🔗

If you are ill you go to bed and sweat it out. The government has lost its collective mind. I wish we’d never heard of Boris Johnson and Dominic Cummings.

74888 ▶▶ GLT, replying to Steve Martindale, 2, #1006 of 1428 🔗

On the positive side, at least flu cases won’t be falsely ascribed to Covid.

74894 ▶▶ Fed up, replying to Steve Martindale, #1007 of 1428 🔗

Has any data been released about how much all this testing is costing?

74965 ▶▶▶ JustMe, replying to Fed up, 1, #1008 of 1428 🔗

Those who are tested for the ONS study receive vouchers (although many of those volunteers would probably say that they would do it for free). If a family of 4 volunteer for the 12 month study then the family will receive £1,700 of Amazon / Sainsbury / Whatever vouchers.
Then there is the cost of those going around collecting the swabs.
Plus the cost of the couriers.
And the fuel.
And then there is the cost of however much the laboratories are charging.
My best guess is that it will be costing us, we the people, around £120 to £150 per test.

74896 ▶▶ Cecil B, replying to Steve Martindale, #1009 of 1428 🔗

But what about asymptomatic flu? Which is the same as asymptomatic covid…. it doesn’t exist

74966 ▶▶ Bruno, replying to Steve Martindale, 1, #1010 of 1428 🔗

Re your Q4, I’d certainly like to think the tests would find it everywhere! that would be an immensely encouraging sign that herd immunity was not far off.

74897 Barney McGrew, replying to Barney McGrew, 38, #1011 of 1428 🔗

So thanks to this debacle, I am now aware that society at large thinks that my views on Covid make me an armchair epidemiologist, conspiracy theorist, freedom nut, granny killer, ‘far right’, Covid denier, etc. etc.

And yet… we have all the real evidence on our side. Not the lurid predictions of spikes and second waves that are currently occupying the media and government, but the things that have actually, already occurred.

Starting with our prediction that Neil Ferguson’s model would be completely wrong. It was. I remember just after ‘lockdown’ meeting a friend (Oxbridge degree-level physicist) while out in my allotted hour of ‘exercise’ and him telling me that the hospitals would be overrun in days. I told him “No they won’t” and my reasons for thinking this. Another Oxbridge-educated friend heard about this and was amused at my “expounding” opinions on something so far outside my field.

From the off, we predicted the T-Cell immunity idea which is now mainstream (although never acknowledged by the government and its helpers, or the epidemiologists and modellers) – the general idea that the immune system produces ‘community immunity’ without necessarily the production of antibodies. And more significantly, that the virus doesn’t have an ‘R0’ – a fixed figure is impossible if the immune system is adapting to the slightest whiff of SARS-Cov-2 and any other similar coronaviruses.

We predicted that Sweden’s approach wouldn’t produce a catastrophe. It didn’t.

We predicted that the lockdown wouldn’t be just for three weeks; that measures would drag on indefinitely – the lockdown was a self-justifying tactic that can never logically be lifted.

We predicted mission creep.

We predicted economic catastrophe; the death of the high street, the hospitality industry, the entertainment industry.

We predicted that ‘Super Saturday’ wouldn’t produce a spike in Covid – it didn’t.

We predicted that the authorities would fiddle the deaths figures. They did.

Just before the inception of this web site, however, I think ‘we’ did make a failed prediction. People of our persuasion predicted that excess deaths would not exceed those of a strong flu season. We were tempted to think that although the authorities would assign Covid to non-covid deaths (they did, and how), they couldn’t hide the fact that deaths from all causes would not rise. This was wrong: seemingly there was a remarkable spike in excess deaths. It looked like an open and shut case: Covid was the exceptional killer they said it was all along.

Our mistake was to view ‘Covid’ in isolation, without factoring in the collateral effects of the lockdown and other factors such as nosocomial transmission and the subsequent emptying of hospitals of frail old people, suspending their treatments indefinitely. We failed to spot that the previous couple of years were low in deaths, so a rich harvest was inevitable, whatever the cause. We even failed to spot that the timing of the ‘epidemic’ in Spring would exaggerate the size of any spike from whatever causes.

One very unfortunate thing is that it is impossible to convey the idea that a spike in excess deaths does not even mean that so many lives have been ‘wasted’ or ‘sacrificed’; that excess deaths may be back to below average in weeks; that the deaths making up the ‘spike’ may have just been brought forward by a month or two.

Ironically, the incompetent, inappropriate response to the virus and the frailty of old people at the edge of death already has provided the government with its biggest get-out-of-jail-free card: the historic spike in excess deaths.

74907 ▶▶ OKUK, replying to Barney McGrew, 6, #1012 of 1428 🔗

What a great post Barney! Toby should highlight that above.

The only I would add is that we predicted the lockdown itself would cause deaths. But it’s v difficult to quantify those deaths eg how many aged people put down as dying “from” Covid are in reality deaths from demoralisation, being denied any contact with loving family members? We certainly know that many cancer experts and paediatricians now say the lockdown will cause deaths. This certainly muddies the waters when it comes to “excess deaths”.

74916 ▶▶▶ wendy, replying to OKUK, 4, #1013 of 1428 🔗

There are also the current extra deaths at home, Carl Heneghan says around 766 last week I think, even though deaths from all causes are below 5 year average

74940 ▶▶▶ Barney McGrew, replying to OKUK, 2, #1014 of 1428 🔗

Cheers, OKUK. I’ve thought of another prediction we made: that the focus would shift from deaths to “cases”, and that the definition of a “case” would shift to merely a positive PCR test.

75093 ▶▶▶▶ JohnB, replying to Barney McGrew, 1, #1015 of 1428 🔗

with the ‘R number’ in the middle somewhere …

74913 ▶▶ wendy, replying to Barney McGrew, 6, #1016 of 1428 🔗

Just the post I need this morning as here in the northern restriction zone greater Manchester has declared an major incident, I know it is about resources but it continues to up and up the fear. I notice Carl Heneghan’s look at the stats doesn’t make the bbc as it doesn’t fit in with the fear message.

And I am still livid that the government can make it illegal to have another person visit me home or garden. FFS!

74971 ▶▶▶ Sam Vimes, replying to wendy, 3, #1017 of 1428 🔗

Ignore it. It’s not law yet, and when it is, a policeman would have to come into your home/garden and prove your household/bubble status. Have they got time for that? I completely agree with you on the principle, of course.
If you are really worried about a police visit, simply ring them now and say you have a burglary going on. You will never see them!

75095 ▶▶▶▶ JohnB, replying to Sam Vimes, #1018 of 1428 🔗

Good point. But to be fair, a burglary in progress would get a response. After the fact, yep, nothing.

74919 ▶▶ Dan Clarke, replying to Barney McGrew, 5, #1019 of 1428 🔗

Is it far fetched to think that people are actually being coerced to keep up the hysteria

74922 ▶▶▶ wendy, replying to Dan Clarke, 2, #1020 of 1428 🔗

It seems they are but why?

74941 ▶▶▶▶ Dan Clarke, replying to wendy, #1021 of 1428 🔗

Got to start at Control

74927 ▶▶ Fiat, replying to Barney McGrew, #1022 of 1428 🔗

Thanks, Barney. Nailed it.

75055 ▶▶ Nick Rose, replying to Barney McGrew, #1023 of 1428 🔗

Regarding excess deaths, I think we have to wait until the end of the year before we call that one, either way it’s called!!

75312 ▶▶ Farinances, replying to Barney McGrew, 1, #1024 of 1428 🔗

My Dad just said to me “Well either you’re psychic or you’re right”.

People are coming round, believe me.

74902 Tom Blackburn, replying to Tom Blackburn, 3, #1025 of 1428 🔗

Daily Mail: Fight breaks out on KLM plane to Ibiza after two passengers refused to wear face masks.
https://www.dailymail.co.uk/news/article-8585439/Fight-breaks-KLM-plane-Ibiza-two-passengers-refused-wear-face-masks.html

74910 ▶▶ Barney McGrew, replying to Tom Blackburn, 9, #1026 of 1428 🔗

Interesting restraint technique. Even though there’s loads of them, they feel that kneeling on the bloke’s back is the only way to hold him down. I wonder if he said “I can’t breathe” at any point.

But the obvious issue is that the other passengers can’t bear a non-compliant person. They’re obviously prepared to ramp up ‘transmission’ (as they imagine it to be) by a factor of a thousand in order to put two non-compliant people in their place. They’re all potential plague carriers standing right next to each other, screaming with their masks askew, perpetrating violence that spreads blood around the place. But when there are ‘deniers’ to punish, they’re suddenly not scared of the virus.

74932 ▶▶▶ Mr Dee, replying to Barney McGrew, 7, #1027 of 1428 🔗

The interesting thing, from a propaganda point of view, is how they’re associating those of us who do not wear masks as uncaring, violent thugs.

It’s why I think it’s so important to treat those in our society who’ve bought into the Lie with kindness and compassion, and give them a smile and a kind word in return to their hostility and fear. Difficult I know, but I think essential.

I’ve a feeling that the real issue for the passengers was not so much with these thugs’ non-compliance of mask-wearing, but more to do with their drunken violent behaviour, which is terrifying on a plane (or any mode of transport) regardless of the circumstances. It’s just the paper has probably put the slant on their mask-wearing for propaganda purposes.

74951 ▶▶▶▶ Margaret, replying to Mr Dee, 4, #1028 of 1428 🔗

Agree absolutely. We didn’t wear masks on the journey to and from Spain last week and had no trouble at all. Because of a change of plane, there was a mix up over seats, so a chap wearing a mask had to sit next to me. There were two free seats in front and even though I suggested that he did a swap around, he said he wasn’t bothered. He took his mask off to eat and drink anyway and chatted to me quite freely. He was more concerned about having to give up ten days of holiday to quarantine.

74952 ▶▶▶▶ Barney McGrew, replying to Mr Dee, 7, #1029 of 1428 🔗

You are right, of course. Nevertheless, yesterday when driving, I found myself not letting another driver out of a side road (which I would normally do) because I saw he was wearing a mask…

75025 ▶▶▶▶▶ Nick Rose, replying to Barney McGrew, 1, #1030 of 1428 🔗

Best let them out and keep them in sight in front of you. Just in case they fall asleep at the wheel, thanks to the mask. My driving instructor (one of a kind, and probably not allowed to say these things any more) always told me to keep an idiot driver in front, where you could keep a close eye on what they were doing.

75029 ▶▶▶▶ Nick Rose, replying to Mr Dee, 1, #1031 of 1428 🔗

After all, those who’ve bought into the Lie are victims too.

74972 ▶▶▶ peter, replying to Barney McGrew, 3, #1032 of 1428 🔗

I wouldn’t be surprised this KLM incident is a scripted psyop like the George Floyd ‘murder’.

74911 DocRC, replying to DocRC, 34, #1033 of 1428 🔗

Mrs DocRC and I have followed Boris and Richi’s lead and war gamed another scenario over our morning cup of tea. The bullet points:

-no evidence for a real increase in cases
-hospital admissions for Covid continue to fall
-ICU patients with Covid ditto
-Covid deaths virtually zero
-epidemic over
-herd immunity achieved
-sack all Gov scientific advisors
-appoint Prof Heneghan as new (sole) Chief Scientific Advisor
-all Covid regulations to end from 8am today
-elderly and vulnerable given estimated individual risk so they make own decision about social distancing etc.

Panic over!

74920 ▶▶ wendy, replying to DocRC, 6, #1034 of 1428 🔗

That fits nicely with me and I can confirm latest info from my critical care doctor friend no one on critical care and only a minimal Covid admissions at the major hospital in our northern prison

75161 ▶▶▶ Richard, replying to wendy, 1, #1035 of 1428 🔗

And fits exactly with what’s happening in Norfolk and Suffolk – local regional newspaper today confirming average new infection of around 2 per 100,000 last week – some areas 0. But obviously headline was that infection rates had gone up in places ! Was trying to do maths – even if everyone was over 90 them they would still need something say 20 infections at a 5% mortality rate which for context is entire population of each county roughly. so at currents rate of infection up here it’s going to take weeks before there are enough people infected to generate a death on average.
Yet still people running around outside with muzzles and shops barricading customers with hand sanitizer!!

74923 ▶▶ Barney McGrew, replying to DocRC, #1036 of 1428 🔗

Brilliant!

74969 ▶▶ IMoz, replying to DocRC, #1037 of 1428 🔗

Ain’t gonna happen—so far as I can tell, they are naively seeking eradication—patently nobody who advises them understands that a spillover followed by adaptation followed by pandemic means that humans are now a natural reservoir.

75000 ▶▶ A. Contrarian, replying to DocRC, 1, #1038 of 1428 🔗

Yes yes yes!

74918 Hoppity, replying to Hoppity, 12, #1039 of 1428 🔗

I think I’ve come round to the idea that the government is up to one of three (or four?) things: either trying to rid society of anyone over 50 and disenfranchise them completely, because we are ‘difficult’, and in order to make way for the younger generations,i.e. those who have been taught to the National Curriculum, and never lhow to think for themselves, question, etc.; or this is some sort of exercise in figuring out how best to respond to some sort biological weapons attack — establishing what will work, and what won’t; or they’re having an extreme clear-out of an economy that doesn’t ‘work for them’. Please feel free to tell me I’m talking rubbish. I didn’t sleep again last night. And I’m off to work again in a minute (when I really need to retire).

74921 ▶▶ Dan Clarke, replying to Hoppity, 13, #1040 of 1428 🔗

Well its not about a virus, that’s for sure.

74924 ▶▶ mjr, replying to Hoppity, 3, #1041 of 1428 🔗

Its a remake of Logan’s Run .

74925 ▶▶ kh1485, replying to Hoppity, 10, #1042 of 1428 🔗

I was wondering this the other day, if this is why the education system has been dumbed down to such an extent.

This over 50 thing is really troubling me. Only know as much as a friend has just outlined to me as I don’t watch tv or listen to the radio anymore. And my blasted internet provider has cut me off so I don’t have access to the internet at home, only at work (current provider in a snit because I want to change and despite paying what I owe, threatening legal action/Ofcom they have, without notice, just cut my phone line – nice).

I am really getting to the end of my rag with all this now. But I just don’t know what to do. I am wearing a rather provocative t shirt with the name ‘Randle McMurphy’ on it, because that is how I feel. It won’t be too much longer before I totally lose it. I am at work now, working longer hours and thoroughly hating the blind compliance I am witnessing. When will people rise up and see this crap for what it is ….?

P.S. Lockdown Truth, just registered on your website. Is it OK if I use your posters in my shop?

74933 ▶▶▶ Hoppity, replying to kh1485, 4, #1043 of 1428 🔗

Just before I go to work: the 50 and over thing happened to me in 2008. Made redundant, eventually ended up in Hell (on the dole, with A4E kindly looking after me). Somehow my life just hasn’t been right since then.

74939 ▶▶▶▶ kh1485, replying to Hoppity, 5, #1044 of 1428 🔗

I’m sorry to read that. I wouldn’t mind, but it’s probably the over 50s that keep this wretched country going. Don’t get me wrong, I really like the bunch of youngsters who are my Saturday staff, but they can’t add up for toffee. And I’m dismayed at how little knowledge/intelligence gets you into university these days. When I took my ‘A’ levels, I knew only two others who went on to university. The rest of us just went out and got jobs.

74945 ▶▶▶▶▶ JohnB, replying to kh1485, 4, #1045 of 1428 🔗

Most of the Science departments in Universities have been closed now because there is no demand from students wanting to take these degrees, this is true for the Uni I attended. It’s now Psychology and Lifestyle degrees that all students are taking.

74964 ▶▶▶▶▶▶ Tyneside Tigress, replying to JohnB, 1, #1046 of 1428 🔗

It’s the growth in Business & Management degrees that has sustained the university system, and the salaries of the VCs and their bureaucracy bubble. In my view, Business & Management should only be a Masters degree, preferably after a minimum of 3 years working in the real world – the original premise of the MBA. Few students will get a graduate level job with a Business & Management undergraduate degree from pretty much any university from the middle of the Russell Group downwards.

74984 ▶▶▶▶▶ Sam Vimes, replying to kh1485, 4, #1047 of 1428 🔗

Note to sadistic self. Visit Cafe KH on a Saturday and order something for £3.59; proffer £5 note and 9 pence to youngster, sit back and watch meltdown. Bliss.

74991 ▶▶▶▶▶▶ kh1485, replying to Sam Vimes, 3, #1048 of 1428 🔗

Cheeky bugger!

75013 ▶▶▶▶▶▶ Lms23, replying to Sam Vimes, 4, #1049 of 1428 🔗

But all those youngsters passed their A-levels with such high grades because they’re so much smarter and hardworking than we were. Our political masters told us so.

75017 ▶▶▶▶▶▶▶ Sam Vimes, replying to Lms23, 2, #1050 of 1428 🔗

Damn, you’re right. The statistics prove their grades, and our masters certainly wouldn’t lie to us. I feel such a fool now…

75193 ▶▶▶▶▶ Bella, replying to kh1485, 2, #1051 of 1428 🔗

I’ve taught at several universities as a VL over the last 20 years. You’re not wrong there.

74950 ▶▶▶ Sam Vimes, replying to kh1485, 7, #1052 of 1428 🔗

The ‘Over 50’ thing is (of course) in the headline, but the body of the item tells a different story, the quote is something like “ the risk starts at 50, gently at first, but then starts to rise, getting steeper at 70 “.

So, first, it’s the usual ‘panic headline’ thing – which is all the sheep see – but secondly it’s the age old “ announce it a lot worse than it will be, so that it seems not so bad when we do it ” trick.

They’ve done it with tax changes etc., for ages. I don’t think there would be a big impact for those in their 50s. Having said that, anything is possible with these twats, but it would take a lot of policing. I’m 60, and there’s no way I’ll stand for it.

Your next T shirt needs to have a picture of Twatcock morphed into nurse Ratched.

74956 ▶▶▶▶ kh1485, replying to Sam Vimes, 1, #1053 of 1428 🔗

T- shirt – ace idea!

With the over-50 thing, a friend (my only LS one!) alerted me to it, so wasn’t sure about the details so thanks for the heads-up.

75130 ▶▶▶▶ RickH, replying to Sam Vimes, 2, #1054 of 1428 🔗

Of course, as anyone with a brain might realise – all f.ing risks start to steepen markedly at 70!

Doh!

74957 ▶▶▶ Barney McGrew, replying to kh1485, #1055 of 1428 🔗

kh, could I ask if your internet provider starts with ‘V’ and ends in ‘n’?

74959 ▶▶▶▶ kh1485, replying to Barney McGrew, 2, #1056 of 1428 🔗

No, but I know someone who has major isssues with the one you mention. Mine’s a business one – starts with an X and ends with an N.

75027 ▶▶▶▶▶ Lms23, replying to kh1485, 1, #1057 of 1428 🔗

https://www.broadband.co.uk/broadband/providers/xln-telecom/reviews/

2 star reviews. Most say this provider should be avoided at all costs.
I’ve never heard of a provider cutting someone’s phone line off.

We had trouble years ago with TalkTalk, when they wanted to charge us for a year’s contract after we’d cancelled. We went through the credit card company – we provided the paperwork to back up our side, TT didn’t, so we go our money back. We were undercut off.
As long as you have all the emails or paperwork to back up your case, they shouldn’t be able to do anything, despite their threats.
Have you contacted a new provider yet?

75059 ▶▶▶▶▶▶ kh1485, replying to Lms23, #1058 of 1428 🔗

Thanks for this Lms2.

Yes, I gave my old provider plenty of notice and contacted a new supplier. XLN put a ‘cease’ on the line so new provider couldn’t take over. When I mentioned this to them, they said they would reverse it, but they didn’t. It’s now six weeks later and my new provider’s attempts to take over are rejected time after time. XLN then tried to bill me for another month so I told them to “sod off” Written to CEO, only got a response when I wrote a true account of what had happened on Trust Pilot. Asked them for a ‘Deadlock Letter’, still nothing. Threatened legal action and Ofcom and got cut off with absolutely no notice. Yes, got every single e-mail (I’m a stickler for all that so they don’t have a leg to stand on).

Thanks for the link.

75190 ▶▶▶ Bella, replying to kh1485, 4, #1059 of 1428 🔗

I thought of you KH when I was having an email debate with a very good (once highly intelligent, first at Cambridge etc) friend, though he’s now hit his eighties so maybe he’s losing it, (but there’s a lot of people 80 + of sound mind.) Anyway, we lived in the same house back when ‘One Flew Over the Cuckoo’s Nest’ was released and debated one night the piece’s metaphor because he wouldn’t accept that we willingly live in a police state. I emailed him to say how does he feel now 44 or so years later. He wrote back saying we still don’t live in a police sate because we vote etc etc. So I upped the ante a bit saying, amongst other things, that we’d never in our history quarantined healthy people (amongst other things) to which his reply was that we as a nation agreed to certain rules and we obeyed them, such as driving on the same side of the road (!?). I wrote back saying to my knowledge they drove on the same side of the road in the Third Reich, Stalin’s Soviet Union, Pinochet’s Chile and Vileda’s Argentina. Not heard from him since. But this is the kind of nonsense debate I am getting now. I don’t know why I am still astounded but I am.

75206 ▶▶▶▶ kh1485, replying to Bella, 1, #1060 of 1428 🔗

I saw that film back in the late 70s (our village picture house was a bit behind with new releases!) and it really struck a chord with me. Further, when it became real life for me when psychiatrists got their filthy mits on my mother’s health, it became all too real. I haven’t been able to watch it since, it’s too painful.

You know what, not one bugger has asked me about the t shirt. They’re just blithely going along with the bollocks. Makes me ashamed to be British.

75395 ▶▶▶▶▶ Bella, replying to kh1485, 1, #1061 of 1428 🔗

They probably don’t get it. Even for my generation it was a radical film. Most people wouldn’t know who McMurphy referred to.

74930 ▶▶ BecJT, replying to Hoppity, 18, #1062 of 1428 🔗

I don’t know what to think, I tend to think nobody’s that clever, and for the scenarios you posit to be correct, hundreds of thousands of people would have to keep a secret, seeing as most humans can’t keep a surprise birthday party secret, not sure that’s a goer.

I think it’s group think, and silos of group think, and confirmation bias, departments not talking to each other. I think it’s arrogance (these are, including the scientists, posh men who’ve been hot-housed from prep school, to public school, to Oxbridge, to SPAD, to safe seat, to ministry, floating on a sea of money, with virtually nobody ever telling them ‘no’).

It’s a bit like Yes Minister, with civil servants who do know what the F is going on, being squeezed out by the obsequious ones, this is Boris creating a little empire of power, so he’s now surrounded by accolytes who aren’t telling him ‘no’.

It’s also a media class who are supposed to be objective and impartial but are in fact their contemporaries. Those who should be speaking truth to power are in the same set. These people are married to, having sex with, playing five a side footie with, are godparents to the children of, each other. The ‘press’ have dinner parties, ski with, socialise with, drink with, have affairs with, send their kids to the same school as, the very people they are supposed to be holding to account.

I do think there are whopping corporate interests in play now, you don’t need to be an ‘anti-vaxxer’ to know that there’s billions to be made from a vaccine, and to get the public to want it, they need to be sufficiently scared. Or that the banks love a good crisis. But I suspect the reality of our ruling class is they aren’t as smart as they think they are (very few people are).

74936 ▶▶▶ Dan Clarke, replying to BecJT, 2, #1063 of 1428 🔗

I agree, its obviously been a PLANdemic, because of the speed it happened, maybe Boris has been coerced after his alleged intro to the virus, scientists are often wired differently and then if there are billions to be had to fund it all………

74949 ▶▶▶▶ BecJT, replying to Dan Clarke, 9, #1064 of 1428 🔗

I just keep thinking about Bush and Blair’s war on terror, and finding out after the fact that the USA invaded Iraq on a ten year old copy of the ‘Lonely Planet’ guidebook. There are lots of slick spy movies, but I think reality is perhaps far more prosaic.

And yes, boffins and medics, especially greasy pole climbing career boffins can be incredibly arrogant (and my experience of boffins, I’m generalising, is they might be very ‘booksmart’ in one very narrow area of expertise, they tend to be thick as too short planks when it comes to humans, or even emotional intelligence and empathy). They don’t want to be wrong either. Those dudes have been planning for a pandemic their entire career, I suspect they shot their load in excitement.

Like lots of things in life, when people do something they shouldn’t, they often don’t have an exit plan, and then start doing increasingly bizarre and out of character things. Whether it’s having an affair with a dangerous and unsuitable but terribly arousing partner, and risking everything they ever worked for and risking losing the people they love most. People do all kinds of bizarre and baffling things to try and cover up a mistake, including chopping up a body and putting it in a suitcase and chucking it off a pier in the dead of night. And up until that point, they were an ordinary person who’d never done anything remotely dastardly.

I often think about the child abuse scandal in the Catholic church, I’ve read and watched a lot about that, think of the film Spotlight as one example, or the Magadelen Laundries or Philomena as another, it still shocks me that when faced with an endemic and evil wholesale child rape problem, the response, repeatedly, was to protect the institution, if I had to bet money, I’d say this is the same thing.

74953 ▶▶▶▶▶ Dan Clarke, replying to BecJT, 5, #1065 of 1428 🔗

Agree, they all sound OCD now and Hancock and Boris look manic. Information overload on mediocre brains. Yes the scientist mind is often theory full and common sense empty. And data scientists, even worse, if they already have in mind what they want to see, it becomes Lies, Damned Lies and statistics.

74958 ▶▶▶▶▶▶ BecJT, replying to Dan Clarke, 1, #1066 of 1428 🔗

Yup. Tragically, I think just like Iraq, it’ll be several years before we are able to talk rationally about it. And even now, despite no love lost for Blair, we’ve rewritten history, Short and Cook took a stand, everyone else was as eager to get in there as Blair. They all supported it, even brushed aside poor old David Kelly.

I’ve said several times that I think this is a posh panic, trouble is the posh are in charge of most things that should be the brake on this, including the opposition. You can’t tell me Keir Starmer hasn’t worked this out yet!

74963 ▶▶▶▶▶▶▶ Dan Clarke, replying to BecJT, 5, #1067 of 1428 🔗

Conservative Home write that Johnson’s approval ratings on Covid slip down Again.

74990 ▶▶▶▶▶▶ A. Contrarian, replying to Dan Clarke, 4, #1068 of 1428 🔗

Hancock looks manic, Boris looks literally petrified.

75042 ▶▶▶▶▶ JohnB, replying to BecJT, 1, #1069 of 1428 🔗

One hundred and forty countries. 140 ! Does it for me, I fear. 🙂

75168 ▶▶▶▶▶ DressageRider, replying to BecJT, #1070 of 1428 🔗

Excellent post! Thank you Bec.

74973 ▶▶▶ Rick, replying to BecJT, 6, #1071 of 1428 🔗

Whilst I have been, for the first time, tempted to consider some kind of joined up global theory because it is so insane. I actually think that the simple truth is that groupthink has caused the majority of Gov’s into such a mess that to admit the grave error now would lead to retribution on a massive scale. Just imagine BOJO fronting the camera and admitting that the chaos, deaths and ongoing misery was caused by poor decisions and lack of transparency etc. Not only would they be personally and politically finished the likely unrest here and around the world would be colossal. They deserve to be punished for this and I suspect it will happen eventually but for now they are battling for their lives and don’t give a shit about anyone else. Think Hitler in the bunker, he did’t suddenly admit his guilt he raged on to the bitter end regardless of the cost. Could do with a good Downfall parody on this topic!
https://youtu.be/YhiSPGZ3PEY

74979 ▶▶▶▶ BecJT, replying to Rick, 4, #1072 of 1428 🔗

Exactly, what I won’t forgive them for is they are setting up the conditions – depression, economic crisis, inflationary spiral, mass unemployment, run on the currency, international discord, recrimination, wanting someone to blame – that makes another Hitler possible. My main concern with all this is what comes next, particularly now we have the full measure of how easily suggestible most of the public are, and quite how willing the media are to sell their integrity.

They are frightened, entitled, cocky little posh boys with their shorts pulled down. Thus, they are very, very dangerous.

What I don’t get is where are the actual conservatives? Surely within the government and the party there must be pressure to wrestle their hands off the tiller?

74996 ▶▶▶▶▶ Nick Rose, replying to BecJT, 1, #1073 of 1428 🔗

In the face of economic collapse, a strongman (or strongwoman, which is what we got last time. Hint:not Theresa May) will always appear. I’d think a Putin rather than a Hitler though.

74997 ▶▶▶▶▶ A. Contrarian, replying to BecJT, 3, #1074 of 1428 🔗

I read something yesterday, telegraph or Daily Fail I think, claiming that Gove is distancing himself from all the authoritarian claptrap (e.g the masks issue and Pret photo) and is out “courting” for a leadership bid with the backing of several senior Tory MPs. No idea how true that is however.

75001 ▶▶▶▶▶▶ Nick Rose, replying to A. Contrarian, 3, #1075 of 1428 🔗

I have to say that although I don’t like him very much, Gove can always smell blood in the water.

75011 ▶▶▶▶▶▶▶ BecJT, replying to Nick Rose, 4, #1076 of 1428 🔗

He just looks like a weasel, he gives me the creeps. God help us if he’s our big hope.

75171 ▶▶▶▶▶▶ DressageRider, replying to A. Contrarian, 1, #1077 of 1428 🔗

Shame it has to be Gove, otherwise good news.

74993 ▶▶▶▶ Nick Rose, replying to Rick, 1, #1078 of 1428 🔗

Unfortunately for them, this is exactly what will happen. I don’t know when or what will trigger it, but people will wake up. A year or so from now, and you’d think the majority were with us from the very beginning.

I have no intention of disabusing people of this belief, when it finally comes. It suits us :o))

75081 ▶▶▶▶▶ JohnB, replying to Nick Rose, 2, #1079 of 1428 🔗

Our task then will be to stop people torching their own neighbourhoods, and to focus on repair rather than recriminations.

74987 ▶▶▶ Nick Rose, replying to BecJT, 3, #1080 of 1428 🔗

“I think it’s group think, and silos of group think, and confirmation bias, departments not talking to each other. I think it’s arrogance (these are, including the scientists, posh men who’ve been hot-housed from prep school, to public school, to Oxbridge, to SPAD, to safe seat, to ministry, floating on a sea of money, with virtually nobody ever telling them ‘no’).”

Spot on. Even worse, from the point of view of the majority, is that these people have never struggled. They believe that people can set their lives aside and then pick them up again later, carrying on as if nothing had happened. A sort of gap year if you will.

Few of them even know the cost of a litre of milk, or a standard loaf of bread.

75003 ▶▶▶▶ BecJT, replying to Nick Rose, 5, #1081 of 1428 🔗

Yep precisely, I’ve said over and over this is a posh panic, the lack of imagination and empathy for how most people live is just shocking. Even middle class lefties are doing it, I saw something the other day about Manchester and ‘ordinary people’ not being able to sit in their gardens, but (boo hiss dastardly capitalists) can go to a pub or restaurant to ‘spend money’.

I asked, ‘are people who run a pub or a restaurant not ‘ordinary people’ then?’ and my “friend” went absolutely beserk.

As I pointed out, if this truly was a once in a lifetime pandemic, none of us would have the monstrous luxury of politicking the living daylights out of it, as we’d be too busy digging mass graves for the bodies! Lefties in particular really hate it if you point out the harm it’s doing, I keep saying, ‘but five minutes ago, with Brexit, all labour could talk about was jobs and the economy, why does mentioning that now make me a Trump supporting, Alt Right monster?’

And I totally agree about never struggled, this obsession with ‘safe’ is just the height of entitlement, as is the undisciplined indulging of fear. Lack of safety and fear is some people’s daily companion, they are dogged by it.

Only a cossetted twat would say, ‘what do kids learn at school anyway? Mine are really loving the nature walks, and Joe Wick’s morning PE’. I’ve started to feel like I hate those people!

75047 ▶▶▶▶▶ Lms23, replying to BecJT, 1, #1082 of 1428 🔗

I know what you mean. I have a good friend who I’ve known for years. She and her partner come to stay with us over some part of the Xmas holidays most years, but politically we are poles apart, and that’s only become apparent in recent years, since the whole Brexit debate. According to her, the reason we didn’t have enough PPE in the uk was because of Brexit, for example.

75014 ▶▶▶ Jonathan Palmer, replying to BecJT, 5, #1083 of 1428 🔗

For starters there are about a million NHS workers complicit in the lie that they are all selfless heroes,when the truth is that the majority have sat on their arses for the last few months.
It doesn’t take many to be in on the lie just the prime movers.I doubt Hancock even knows what is really going on he is that dim.

75024 ▶▶▶▶ BecJT, replying to Jonathan Palmer, 10, #1084 of 1428 🔗

I really upset an NHS nurse the other day, bleating about their terrible pay rise. I’m afraid I said what I thought, and did point out she was soon to be one of the few people in her wage bracket able to pay their mortgage. I said, 10m are waiting for care, 3.3m missed their cancer check, we’ve got a massive spike in non covid excess deaths, the NHS is way below capacity, A&E is 60% down, the NHS was never overwhelmed, staff have been furloughed on full pay, the NHS booted out 25k elderly causing mass death, and the NHS have been merrily kidnapping people’s relatives, denying visits (that happened to my family, two elderly relatives ‘missing’ for five weeks, they were moved so often, we didn’t even know where they were, they died alone and scared of non-covid disease), what’s the pay rise for?

I know that NHS medics have been threatened if they speak out, however any ethical whistleblower would have done it anyway, you can’t tell me there isn’t one with enough clout to risk it.

75026 ▶▶▶▶▶ BecJT, replying to BecJT, 6, #1085 of 1428 🔗

ie it really annoys me that NHS staff take a bow as heroes of ‘our NHS’ and when you point out the frankly disgusting things the NHS has done, they then want you to differentiate, because they are not ‘that NHS’.

75035 ▶▶▶▶▶▶ JohnB, replying to BecJT, #1086 of 1428 🔗

Did see yesterday (on Anna Breese ?) that 2 cancer surgeons had been struck off, with no right of appeal, for speaking out. Anyone know more ?

75044 ▶▶▶▶▶▶▶ BecJT, replying to JohnB, 1, #1087 of 1428 🔗

Really, that’s interesting. Shocking if true.

75038 ▶▶▶▶▶▶ kh1485, replying to BecJT, 4, #1088 of 1428 🔗

Well, it’s not ‘my’ NHS, never has been. Just a useless behemoth of a government department that made my mother’s last years on this planet absolute hell and then compounded that with their lies and obfuscation.

We were asked if we offered discounts for NHS staff the other day. You can imagine our response.

75043 ▶▶▶▶▶▶▶ BecJT, replying to kh1485, 2, #1089 of 1428 🔗

Yep I agree, sorry about your mum, but I’ve seen personally, and heard more times than I can count, stories like yours. They are like the mafia.

75046 ▶▶▶▶▶▶▶▶ kh1485, replying to BecJT, 3, #1090 of 1428 🔗

Thanks. I hope, and sorry if this sounds vengeful, there is a special place in hell for some of those who provided ‘care’ for her in those final hours.

75039 ▶▶▶▶▶ Lms23, replying to BecJT, 3, #1091 of 1428 🔗

Karol Sikora has spoken out, along with a few others, but the media will barely give them any airtime.
I think its as much about groupthink as anything. Too many in the media are in agreement with each other. The BBC is another prime example.

75030 ▶▶▶ JohnB, replying to BecJT, 1, #1092 of 1428 🔗

So politicians, the media, and big corporations are all involved, but there is no plan ? There certainly appears to me to be a coordinated roadmap.

There is no need to keep absolute secrets – tell the local authorities virus coming, emergency powers, keep everyone safe; tell the media virus coming, public interest, censor opposing views; tell the financial kids – crash, unemployment, do your best.

75037 ▶▶▶▶ BecJT, replying to JohnB, 3, #1093 of 1428 🔗

Well I don’t know obviously, but having had dealings through my career with think tanks, MPs, big corporate cheeses, boffins etc, they strike me as not being all that clever. And I do think there’s a level of coordination, but of the arse covering, saving their own skins variety.

75442 ▶▶▶▶▶ JohnB, replying to BecJT, 1, #1094 of 1428 🔗

Absolutely. 🙂

I would suggest those doing the coordinating remain well outside the public arena. For them, arse-coverers – which I totally accept exist – just help to muddy the waters.

75032 ▶▶▶ Lms23, replying to BecJT, 2, #1095 of 1428 🔗

They’re all of a like mind. Doesn’t have to be a secret conspiracy.

75034 ▶▶▶▶ BecJT, replying to Lms23, 1, #1096 of 1428 🔗

Exactly, you don’t need a conspiracy, it’s just how power works.

74942 ▶▶ JohnB, replying to Hoppity, 5, #1097 of 1428 🔗

If the Tories get rid of anyone over 50 then they will have no supporters, but as has been proven during this farce the two main parties are the same, differences between them are just an illusion to make you think we have democracy.

74944 ▶▶▶ Dan Clarke, replying to JohnB, 3, #1098 of 1428 🔗

This is cross party but as most of them are over 50 its not looking good for Parliament and even worse for the Lords, unless they have a different batch for them

75010 ▶▶▶ Sam Vimes, replying to JohnB, 1, #1099 of 1428 🔗

I really think that Con and Lab get together secretly from time to time and say “you have a go next, then we’ll have a turn or maybe two, then you can come back” sort of thing.

75018 ▶▶▶ Nick Rose, replying to JohnB, 2, #1100 of 1428 🔗

Trouble is, all three mainstream parties are jostling for position with the same group of voters, what Tony Blair called “occupying the middle”. This means all three parties tend to be bland with vague, wishy-washy policies and few, if any, firmly held beliefs. Only two governments since the Second World War have made any real difference to life in this country. Not necessarily for the better, depending on your view, but those people had beliefs, and the conviction to follow those beliefs.

We do not have such people in politics today. If we do, they are kept on the fringes.

75072 ▶▶▶▶ JohnB, replying to Nick Rose, #1101 of 1428 🔗

Thing is Starmer should be on this now, putting the Government to task, and should be miles ahead in the opinion Polls. Instead he’s pictured kneeling to Marxists and is completely slient on excess deaths and potential excess deaths caused by the lockdown, and the devastating effect the economy is going to have on peoples lives, which surely are huge game changers in making the Gov look bad.

Corbyn was the same, weakest and worst Conservative Government with Theresa “No Personaility” May at the helm, all he needed to do was keep his mouth shut but was so inept he couldn’t do this and never make any inroads.

74943 ▶▶ wendy, replying to Hoppity, 2, #1102 of 1428 🔗

Well it would be very odd for a conservative government to want to get rid of the over 50s, they are their voters

74948 ▶▶▶ JohnB, replying to wendy, 4, #1103 of 1428 🔗

This isn’t a conservative government though, as their behaviour during this lockdown has proven.

74968 ▶▶▶▶ peter, replying to JohnB, 1, #1104 of 1428 🔗

It’s a Common Purpose government riddled with ghouls.

74946 ▶▶ Tyneside Tigress, replying to Hoppity, 4, #1105 of 1428 🔗

My view on your suggestions:

One – no
Two – possible, because they, like us, know this is a ‘manufactured’ virus, albeit not released deliberately from the Wuhan lab
Three – almost certain, being driven by those for whom it ‘doesn’t work for them’, but as we are now finding, the ‘them’ is a larger group of people than we previously thought and includes a supposed ‘Tory’ government

I have nights when I don’t sleep too, largely because I think about what this is going to do for my kids (18 and 20) and their futures.

Hang on in there, the wheels are coming off this bandwagon!

75008 ▶▶ Lms23, replying to Hoppity, 1, #1106 of 1428 🔗

Global economic reset. It’s a practice run and preparation for the Carbon Zero economy, i.e. stop travel, get everyone using bikes instead of cars, etc, plus transfer of wealth from rich nations to poor ones, for “equality.” Mostly, it’s transferred wealth from the middle classes to the user rich. Jeff Bezos (Amazon) has done particularly well financially, with people ordering from Amazon instead of shopping on the high street….

75143 ▶▶▶ Basics, replying to Lms23, 1, #1107 of 1428 🔗

The Lockdown and continuing opression would not have been possible without the internet. This virus has only appeared when the intenet means of communication and shopping have been established. Lucky that.

Online shopping 10 years ago?
Skype/zoom meetings 5 years ago?
School lesson plans 3 years ago?
Youtube streamed fitness classes how many years ago?

Imagine lockdown without the first three. The governments actions could not have been so wild. Even 24 hour news is modern and necessary for the controlling of the population. News as infrequent as 6pm or 10pm, cannot brainwash a natiin like that.

All in all it is lucky indeed this virus chose to cross species when it did. Sarcasm.

75036 ▶▶ Bella Donna, replying to Hoppity, 1, #1108 of 1428 🔗

I’m with you on your first point. Definitely over 50s are now 2nd class citizens but excluding public servants of course. I’m resigned to having no more access to the NHS, not that I’d trust them with my health any more. From now on it’s Us v. Them, I am withdrawing all cooperation from now on.

74938 JohnB, replying to JohnB, 8, #1109 of 1428 🔗

So DNA is being analysed in the COVID-19 testing. This is from the report on Sky about the new tests:

“A new DNA test will also be rolled out with 5,000 Nudgebox machines given to hospitals across the UK from September. Eight London hospitals are already using the machines which analyse DNA in nose swabs to detect the virus.”

Global DNA database not looking so much like a conspiracy theory now.

74955 ▶▶ wendy, replying to JohnB, 2, #1110 of 1428 🔗

But what would they do with a global dna database? How could it be an advantage to anyone?

74960 ▶▶▶ thedarkhorse, replying to wendy, 4, #1111 of 1428 🔗

I read something, a long time ago, about DNA being capable of showing your weaknesses, eg pre-disposition to certain illnesses. Insurance companies could have a field day with that sort of information. DNA is a highly sensitive thing…it is your personal blueprint…it IS you, in fact. And in the wrong hands it can be used against you.
However, collecting a database could have been started years ago…any sample you give to a doctor or hospital will have your DNA in it…blood, urine, etc. They’ve probably already de-coded it.

74975 ▶▶▶▶ JohnB, replying to thedarkhorse, 3, #1112 of 1428 🔗

If they’re doing 500,000 tests a day, then they’ve potentially accumulated the entire DNA database for the UK in 134 days.

75369 ▶▶▶▶▶ Carrie, replying to JohnB, 1, #1113 of 1428 🔗

which is why they’re doing it. Investigate Peter Thiel, Palantir…

74977 ▶▶▶▶ PoshPanic, replying to thedarkhorse, 1, #1114 of 1428 🔗

Gattaca!

74988 ▶▶▶▶▶ Poppy, replying to PoshPanic, 1, #1115 of 1428 🔗

Was just going to mention this! Fantastic film.

74998 ▶▶▶▶ Lms23, replying to thedarkhorse, 3, #1116 of 1428 🔗

“However, collecting a database could have been started years ago…any sample you give to a doctor or hospital will have your DNA in it…blood, urine, etc. They’ve probably already de-coded it.”

I worked in a pathology lab for decades. To the best of my knowledge, that’s not happened.

75006 ▶▶▶▶▶ Jonathan Palmer, replying to Lms23, 5, #1117 of 1428 🔗

For the last few years anyone who has been arrested has their DNA taken.Even if they are not convicted the DNA sample is not destroyed.

75012 ▶▶▶▶ JohnB, replying to thedarkhorse, 1, #1118 of 1428 🔗

Not disagreeing with most of this, tdh, but to suggest our dna is us is utter bollocks. It is our physical bodies maybe, but you’d need something special to convince me Mozart’s music (for example) was apparent from his dna.

75022 ▶▶▶▶▶ JohnB, replying to JohnB, 4, #1119 of 1428 🔗

You’re using logic in this John, but as we know from decision made on masks governments don’t work on logic or evidence.The masks case sets a dangerous precedent for this kind of thing. So, one iffy report is produced on what constitutes a dangerous DNA profile, government scientists jump on to this, it’s then put in the media and all over social media, people get scared, and to protect the public people with this DNA profile are locked up for their safety.

75439 ▶▶▶▶▶▶ JohnB, replying to JohnB, 1, #1120 of 1428 🔗

Sadly too possible … 🙁

75367 ▶▶▶▶ Carrie, replying to thedarkhorse, 1, #1121 of 1428 🔗

Indeed. I took part in a study (submitted blood) looking for possible DNA links/susceptibility to the development of an illness I have. Interestingly they found 2 genes linked to it.

I have however *not* agreed to a gene test to see if I have inherited my mother’s heart condition, because I *know* that would have many consequences, one of which is the potential cost of travel insurance..

74989 ▶▶▶ Basics, replying to wendy, 1, #1122 of 1428 🔗

A global dataset can be used to develop genetic interventions.

75371 ▶▶▶▶ Carrie, replying to Basics, 1, #1123 of 1428 🔗

and to target viruses at particular groups..

74999 ▶▶▶ JohnB, replying to wendy, 4, #1124 of 1428 🔗

It’s worth trillions of pounds to companies. It would affect things like Mortgages as it would determine whether you’re likely to be able to pay it off, life insurance, travel insurance, anything where you obtain credit, employers evaluating you based on potential health issues, sinister things such as being fitted up for crimes, cloning you, and suppose it could be analysed to see if your DNS matches the profiles for those that conform.

75007 ▶▶▶ IMoz, replying to wendy, 4, #1125 of 1428 🔗

Well, let’s suppose you develop some cancer in, say, fourties, and your DNA shows you have a predisposiiton to, say, Parkinsons, it’s entirely possible that you might be deemed unworthy of cancer treatment because you’re likely to soon develop Parkinsons, so you might end up being assigned palliative care only…

75364 ▶▶▶ Carrie, replying to wendy, 1, #1126 of 1428 🔗

Your travel insurance will be hiked if you can be shown to have risk factors

You can use such information to tailor medicines and vaccines to the individual – which can be bad – they will know what will kill you from knowing your weaknesses

They will know stuff you may not even know yourself – it is estimated that a lot of men are bringing up children that they do not know that they are not the father of..

Just a couple of things..

75368 ▶▶▶ Carrie, replying to wendy, #1127 of 1428 🔗

Look up CRISPR..

74978 ▶▶ stefarm, replying to JohnB, #1128 of 1428 🔗

There is one theory re the Madeline McCann case which was seized upon by then pm Gordon brown to build a DNA database. McCann’s were the middle class, educated doctor’s who were seen as the poster children. DNA database to find suspected paedophiles.

The argument of why worry about such databases if you have nothing to hide. Not a valid reason IMO, my information is my own

75009 ▶▶▶ JohnB, replying to stefarm, 5, #1129 of 1428 🔗

I worked with a guy and he was having all his family’s DNA tested with 23andMe. I said to him “why on earth would you give private information about your health away, that could be used against you in the future”, he said “we’ve nothing to hide, we’re not criminals”. Then a few weeks later GalxoSmithKline brought a huge share in 23andMe which allows them to use the genetic data.

75372 ▶▶▶▶ Carrie, replying to JohnB, #1130 of 1428 🔗

Ancestry.com plays on people’s curiosity about their genealogical roots – wonder how much DNA they have acquired?

75376 ▶▶▶ Carrie, replying to stefarm, #1131 of 1428 🔗

This guy’s channel is fascinating – he has done acres of research about the McCann case, more than possibly anyone else: https://www.richplanet.net/richp_genre.php?ref=185&part=1&gen=1

Lots of other interesting videos on other pay-ops too..

75173 ▶▶ Bella, replying to JohnB, #1132 of 1428 🔗

I don’t know why this is a big deal. Anyone who has ever had a blood test can have their DNA ‘banked’ into a database. Anyone who’s been arrested too. I know police are supposed to bin DNA data after six months from people not convicted but I doubt that they do. So if ‘they’ want a DNA database (global or national) there are plenty of ways to build it.

75361 ▶▶ Carrie, replying to JohnB, 1, #1133 of 1428 🔗

Hmm, so I wasn’t wide of the mark when I posted about this last night then?!

They’ve worked out that Track n Trace is a no go, so they’ve changed tack a a bit…Now they get your DNA *and* your contact details, because you’ll have to give them your mobile number so they can text your Covid-test result to you, won’t you?

74954 Bugle, replying to Bugle, 15, #1134 of 1428 🔗

Two good pieces in MSM today: Trevor Kavanagh in the Sun and Karol Sikora in the DM. This is a propaganda war, so pushback from these sources is welcome.

75040 ▶▶ Barney McGrew, replying to Bugle, 4, #1135 of 1428 🔗

Interesting looking at the upvotes and downvotes. For Kavanagh about 10:1 in favour; for Sikora 5:1..?

Sikora disappoints me slightly in that he credits the Northern ‘surges’ and ‘spikes’ as being real. I don’t. When we are talking 59 positives in 116,000 tests, and it’s a test with a non-zero false positive rate (the government found it to be median of 2.3% in one of their own studies) and they talk about ‘cleaning’ data, a process that will have some strong subjective element to it, it seems to me that any idea of a ‘surge’ is a statistical joke.

75058 ▶▶▶ Julian, replying to Barney McGrew, 4, #1136 of 1428 🔗

Sikora has been pretty sound on the whole but yes agree he’s a bit soft on certain things. He may actually believe it, or he may be being careful so he doesn’t lose his platform as a voice of reason and moderation.

75062 ▶▶▶▶ PoshPanic, replying to Julian, 1, #1137 of 1428 🔗

I’ve met Sikora a couple of times ( I work behind the camera ). He’s definitely an impressive expert, who can clearly communicate difficult concepts and part of that is his diplomacy

75306 ▶▶▶▶ Drawde927, replying to Julian, #1138 of 1428 🔗

That’s the impression I get… a lot of his articles and tweets have a slightly bet-hedging, “be cautious”, “as long as we’re careful” etc. tone to them.
I suspect he’s doing his best to avoid being seen as too sceptical and dismissive in order to make his message more acceptable to a wider audience – which to be honest isn’t a bad idea – it might convince or sow doubt in the minds of people who would be switched off by blunter scepticism.

75223 ▶▶ Steve, replying to Bugle, #1139 of 1428 🔗

Good piece of the northern lockdown in today’s Telegraph too. Very sceptical about the science and talks about the increased amount if testing and when you take that into account there is no actual increase.

74970 Margaret, replying to Margaret, 32, #1140 of 1428 🔗

What has annoyed me constantly throughout all of this debacle is the fact that governments throughout the world (Sweden excepted), regard us as ALL as being stupid, gullible fools. I’ve pointed this out to my MP several times. There are considerable numbers of us who can read graphs, statistics, maps, even some scientific papers and make sense of them. We can do our own research on the internet. Then there are a whole load of scientists, statisticians etc who have given us alternative viewpoints to consider throughout all of this:Levitt, Bhakdi, Heneghan, Gupta, the list goes on. Of course, governments have used the MSM as their main propaganda tool and most people will simply respond to the click bait by accepting the party line as they have done already, but for the rest of us, it’s insulting.

74982 ▶▶ Basics, replying to Margaret, 6, #1141 of 1428 🔗

MPs simply don’t know how to converse with well founded intellectual debate without seeing it as a threat. Is their one MP who represents their contituents humbly as a servant? All I see is ego pretending to be ‘leaders’ of community, a position they are explicitly unsuited to.

74992 ▶▶ Barney McGrew, replying to Margaret, 7, #1142 of 1428 🔗

There are considerable numbers of us who can read graphs, statistics, maps, even some scientific papers and make sense of them.

Indeed, I am fascinated by writers and cultural commentators who, nevertheless, understand science and its wider implications better than professional scientists. People like Toby himself, Matthew Parris, Peter Hitchens and (a new one) Janet Street Porter. They’re mainly of a certain age and had those old-fashioned educations that equipped them for critical thinking and an ability to make sense of varied pieces of information.

75076 ▶▶▶ Margaret, replying to Barney McGrew, 7, #1143 of 1428 🔗

The problem for me Barney is that my two closest friends, both like me, grammar school and university educated, have not really questioned any of this.

One has refused to read anything that I have sent her in case it frightens her and will only believe stuff which has been told to her by someone she knows eg.so and so’s son was in hospital with it- he had pleurisy and tested positive!

The other has actually looked at the numbers churned out by the government and told me the other week that there was a spike near to where I live. It was about 7 extra positive tests and they were in the post code of where the very large general hospital is located.

In the case of my first friend, the same thing happened over Brexit. We happened to be on different sides of the divide and had lots of debate about it. She ended up by saying that I was the only person she knew that actually knew something about it and had a stack of data to back up my argument.

It’s because I looked into it for myself and made a decision based on the evidence which I had (from both sides) and not simply on hearsay.

75126 ▶▶▶▶ RickH, replying to Margaret, 2, #1144 of 1428 🔗

As you indicate – I’m afraid there’s no comfort in riding sectarian hobby-horses over this and imagining some age- or background-related wisdom that gives immunity : the lack of critical and rational thinking is widespread.

75002 ▶▶ JohnB, replying to Margaret, 6, #1145 of 1428 🔗

and Belarus. Not sure why Belarus doesn’t usually get the same credit as Sweden.

75063 ▶▶▶ Mark, replying to JohnB, 4, #1146 of 1428 🔗

Because it’s much easier to dismiss and ignore Belarus than it is Sweden. Smaller country, much less integrated into global economy and society, not politically in step with the US sphere norms.

75438 ▶▶▶▶ JohnB, replying to Mark, 1, #1147 of 1428 🔗

This is all true. I like to think their dictator’s statements ‘Wodka and saunas will defeat it” and ” Anyone putting a mask on a child will answer to me personally” show good attitude, and are useful in conversations with the majority here.

75069 ▶▶▶ Jay Berger, replying to JohnB, 4, #1148 of 1428 🔗

Sweden proves that lockdowns are useless and harmful.
Belarus also proves that social distancing is useless and harmful.
None of that info can be allowed to spread and take hold.

75064 ▶▶ Strange Days, replying to Margaret, 4, #1149 of 1428 🔗

Perhaps you could, cautiously, add the Dutch government? Their refusal to implement forced masking is a hopeful sign

74976 PD, replying to PD, 6, #1150 of 1428 🔗

Having read Douglas Murray on Saturday it reinforced in my mind how much influence we have allowed the social media and big tech firms to wield.

Are we at the nexus of the culture war?
Is fear of the ‘rona being used by the tech platforms to deliberately crash the US and thus the world’s economy?
Are tech firms simply providing platforms for conformist, woke views or are they peddling them hard?
(They are certainly doing their level
Best to remove dissenting voices.)
Are left wing enablers in devolved regional administrations – see Manchester, Seattle. Melbourne, Scotland abetting this economic derailment?

Just to clarify I’m not a crypto-fascist as all Sceptics are being portrayed as now!
I write this as a remain and Labour voting at the last election (holding my nose re Corbyn as I like my MP).

74994 ▶▶ Lms23, replying to PD, 2, #1151 of 1428 🔗

“Are left wing enablers in devolved regional administrations – see Manchester, Seattle. Melbourne, Scotland abetting this economic derailment?”

That could be described as a wild conspiracy theory, but let’s face it, all the signs point to it, except we have Boris and co merrily joining in. Not sure what it makes them.

75051 ▶▶ JohnB, replying to PD, 12, #1152 of 1428 🔗

Social media has gained too much power. The growth of social media came at the same time austerity closed all the public toilets, so those that used to write messages on toilet doors and walls moved to Twitter, and now these lunatics opinions are taken as gospel!

75054 ▶▶▶ PD, replying to JohnB, 1, #1153 of 1428 🔗

🤣 🤣 🤣 🍾

75217 ▶▶▶ Steve, replying to JohnB, #1154 of 1428 🔗

I think that’s the best description of Twitter I’ve ever seen

75067 ▶▶ Mark, replying to PD, 1, #1155 of 1428 🔗

Is fear of the ‘rona being used by the tech platforms to deliberately crash the US and thus the world’s economy?

Crashing the world economy is a bit of a reach – to see how they would benefit you’d have to suppose a pretty dramatically far reaching conspiracy or coordinated confluence of interests (which amounts to the same thing).

It’s not hard to suspect that big tech and big media currently see crashing the US economy for the next few months as beneficial in terms of defeating Trump, though.

75085 ▶▶▶ PD, replying to Mark, 1, #1156 of 1428 🔗

They unanimously hate Trump, they hate the proletariat and they are seeking to regain their lost four years after Cambridge Analytica used their own data against them.

75086 ▶▶▶ Dan Clarke, replying to Mark, 1, #1157 of 1428 🔗

Or crashing the US economy, along with a few bystanders?

74980 Dan Clarke, replying to Dan Clarke, 3, #1158 of 1428 🔗

If you eat or drink while food shopping, are masks exempt?

74981 ▶▶ anon, replying to Dan Clarke, #1159 of 1428 🔗

no!

74983 ▶▶▶ Dan Clarke, replying to anon, 1, #1160 of 1428 🔗

Why, and if the pubs sell food is it ok not to wear a mask while food shopping, in the pub

74985 ▶▶ kh1485, replying to Dan Clarke, 3, #1161 of 1428 🔗

I’m waiting for some enterprising bod to come up with a coffee/tea impregnated mask!

75096 ▶▶ Hubes, replying to Dan Clarke, 1, #1162 of 1428 🔗

Yes. The law states. You have reasonable excuse to not wear a mask if :

It is reasonably necessary for P (person) to eat or drink, P removes their face covering to eat or drink

74986 PD, 4, #1163 of 1428 🔗

“Office Trolley” posted this on the DT Comments – this should be the new LDS t-shirt Tobes!
It certainly made me chuckle.

“Imagine, if you will, a virus so deadly that you have to be tested to know if you’ve had it……..”

https://www.telegraph.co.uk/news/2020/07/31/herd-immunity-long-term-solution-covid-19-has-become-taboo-says/#comment

75004 Humanity First, replying to Humanity First, 16, #1164 of 1428 🔗

Seems like there will be a worldwide push for vaccinating 100% of the people for a virus that has serious consequences for less than 1%. If governments/politicians were genuinely concerned about ‘saving lives’ and improving the lot of their citizens, wouldn’t their time and energy be better spent on tackling real problems which do affect the majority of people, e.g., provision of clean water, adequate housing, relief from crushing debts, removal of toxins from food and the environment etc.?

Once upon a time there used to be handful of MPs who would speak up for the downtrodden and those denied justice. What happened to them?

75015 ▶▶ Bella Donna, replying to Humanity First, 10, #1165 of 1428 🔗

There is no one to speak up for us. No one! That shows they are all the same. I detest them all!

75019 ▶▶▶ T. Prince, replying to Bella Donna, 4, #1166 of 1428 🔗

That is the most disappointing thing for me. What’s to become of ‘politics’ once this charade is over?

75057 ▶▶▶▶ Humanity First, replying to T. Prince, 2, #1167 of 1428 🔗

These past few months have lifted the veil from politics and politicians and shown the ugly reality that lay hidden behind- even in an ‘advanced democratic’ nation such as ours. Wherever the solution lies, it is certainly futile to look at the current crop of politicians to provide it.

75049 ▶▶ James, replying to Humanity First, 5, #1168 of 1428 🔗

Hi,

I am tending to agree with you on the vaccination thing. I have not paid much attention to the anti vaccination movement until recently. Robert Jennedy Jr has been collating evidence on this for the past 15 years or so. He participated in a public debate with Alan Dershowitz recently. You can ( or could ) watch it on Valuetainment. I find it very convincing. I am not convinced that big Pharma are solely behind this but I am increasingly convinced they
are one of the main players. It appears to be an almost entirely corrupt cartel of drug pushers and their links to Alphabet and Gatesand Fauci are particularly disturbing. Del Bigtree , who they are trying to censor out of existence is also very convincing on this. We have all been asleep. The future of our civilisation is apparently at stake.

James

75108 ▶▶▶ Humanity First, replying to James, 4, #1169 of 1428 🔗

Thanks, James. Somebody forwarded a link to that debate to me a few days ago and I did watch it. It really wasn’t much of a debate as Dershowitz didn’t put up much of a fight and I thought he was quite strangely meek and deferential to Kennedy throughout.

Yes, people should certainly research the issue for themselves as I think too many of us have up to now just accepted on faith what “Science” and our doctors have told us.

A point for people to consider is that would they buy a car from a manufacturer who has no liability if anything bad were to happen to you when driving it? What interest would such a manufacturer have in thoroughly testing the car for safety before taking your money for it?

Similarly would you happily inject something into your body from a similar no-liability manufacturer ? In fact ultimately you as a taxpayer are paying both for the purchase of the vaccine and the costs of any damages resulting from it (through the government indemnity).

75016 T. Prince, #1170 of 1428 🔗

Very useful, short clip on the situation in some US states…more blatant lies

https://www.youtube.com/watch?v=vS5Gfbu0lWQ

75020 DressageRider, replying to DressageRider, 4, #1171 of 1428 🔗

For those of us worried about moves to a cashless society, this article by Howard Davies is a measured view and if you read that, the next suggested article is a counterpoint against cash by Kenneth Roggoff written in 2016

https://www.project-syndicate.org/commentary/will-covid19-kill-cash-by-howard-davies-2020-07

https://www.project-syndicate.org/commentary/dangers-of-paper-currency-by-kenneth-rogoff-2016-09

Dont down vote me, it is good to get a variety of views in order to make up one’s own mind!

75031 ▶▶ Cicatriz, replying to DressageRider, 5, #1172 of 1428 🔗

In principle (like so many things) there is nothing wrong with cashless systems.

The problem is all the strings that will be attached

  • Social credit (you posted something unpleasant on the internet, no luxuries for you)
  • Warrentless access to spending behaviour
  • Arbitrarily imposed limitiations (you’ve already had your days fill of fat/alcohol)
75065 ▶▶▶ Jay Berger, replying to Cicatriz, 3, #1173 of 1428 🔗

They also want to clamp down and erase the shadow economy, workers or benefit recipients making a bit on the side, craftsmen or PTs, golfpros etc. taking cash without invoicing etc..
Of course, the real criminals, from the Mafia to the Multinationals, have been and will continue to be provided with the government endorsed cryptocurrencies and with the similarly endorsed tax
evasion opportunities to ensure that they can continue to do their business.

75021 Tim Bidie, replying to Tim Bidie, 3, #1174 of 1428 🔗

More evidence on efficacy of BCG tuberculosis vaccination against covid 19. This is important because, if BCG vaccination trials now in phase 3 trials confirm these findings, most of British citizens will not require a covid 19 vaccination. It would also explain why minority communities have suffered disproportionately since many may very well not have been BCG vaccinated.

Our analysis suggests that mandated BCG vaccination can be effective in the fight against COVID-19.’

https://advances.sciencemag.org/content/early/2020/07/30/sciadv.abc1463

Of course all the usual caveats apply but, to me at least, this seems to offer the fastest way out of the government lunacy that surrounds us.

75028 ▶▶ A. Contrarian, replying to Tim Bidie, #1175 of 1428 🔗

Not sure about it being mandated however!

75041 ▶▶▶ IMoz, replying to A. Contrarian, 1, #1176 of 1428 🔗

This is one of the diseases you do want a vaccination for: http://www.tbonline.info/posts/2016/3/31/how-tb-infects-body-tubercle-1/

75068 ▶▶▶▶ A. Contrarian, replying to IMoz, 3, #1177 of 1428 🔗

Yes, and I’ve had the TB vaccine myself, but I still don’t agree with it being forced on everyone else under penalty of… what? Prison? Why is it OK to mandate it for TB but not for covid? Mandating of any vaccine or medical treatment would be the start of a very long and very steep slippery slope.

75074 ▶▶▶▶▶ IMoz, replying to A. Contrarian, 3, #1178 of 1428 🔗

because pathophysiology of TB is far far far far worse than that of a disease that (a) requires a constant propaganda; and (b) presence of which can only, in most cases, be determined by a test…

75159 ▶▶▶▶▶▶ A. Contrarian, replying to IMoz, 1, #1179 of 1428 🔗

Regardless, it sets a precedent that I’m uncomfortable with. I’m surprised anyone on here would be for compulsory vax, but I genuinely think it’s good that we have people with different viewpoints.

75080 ▶▶▶▶▶ PoshPanic, replying to A. Contrarian, 3, #1180 of 1428 🔗

Well I don’t remember having much choice on having the much feared jab at school!

I’ll take any vaccine, if I think the side affect risk is far outweighed by the benefit

75155 ▶▶▶▶▶▶ A. Contrarian, replying to PoshPanic, 1, #1181 of 1428 🔗

I think your parents had the choice. We had a few decline at school.

75157 ▶▶▶▶▶▶ A. Contrarian, replying to PoshPanic, 1, #1182 of 1428 🔗

Yes – if you think it’s outweighed, not if the govt tell you it is.

75123 ▶▶▶ Tim Bidie, replying to A. Contrarian, #1183 of 1428 🔗

There are about three different BCG vaccine trials ongoing related to covid 19, I think, but the Murdoch one is designed for healthcare workers, not as a vaccine for the general population.

‘BCG vaccination is not going to be a silver bullet that provides perfect protection against COVID-19 or any other pandemic illness. However, we may find it provides some level of protection. If so, it will be a readily available to bridge the gap and protect health-care workers and other vulnerable individuals until a specific COVID-19 vaccine is developed.’

https://medicalxpress.com/news/2020-07-vaccine-covid-.html

‘Murdoch Children’s Research Institute has organized BRACE, a Phase 3, two-group, multicenter, open-label, randomized, controlled trial of up to 4170 health care workers in Australian hospitals to determine if BCG vaccination reduces the incidence and severity of COVID-19 during the 2020 pandemic’

https://www.lifespan.io/road-maps/the-covid-19-roadmap/murdoch-childrens-research-institute-bcg-vaccine

Difficult to mandate it, in any case, since so many have had a BCG vaccination already….and you know the NHS will not have a clue as to who has already had that vaccination……

But if preliminary phase 3 results due this October confirm that BCG vaccination provides good protection against covid 19, and I will be astonished if that is not demonstrated, then we know that the bulk of the British population is already well protected (I think we may have got the hang of that already, except for those total no hopers in government) and the government will come under a great deal more widespread pressure to let us get on with the rest of our lives.

75033 ▶▶ IMoz, replying to Tim Bidie, 3, #1184 of 1428 🔗

It might be a factor, but there might be a confounder in that in a lot of countries where BCG is currently mandated HCQ is also used to treat COVID-19 😉

75141 ▶▶▶ Tim Bidie, replying to IMoz, 1, #1185 of 1428 🔗

Immigrant communities appear to be particularly vulnerable, all over the world.

I think that is due to them not having had BCG vaccination.

‘In a number of EU/EEA Member States, subgroups of migrant populations are disproportionately affected by infectious diseases such as tuberculosis, HIV, and hepatitis B and C.’

https://www.ecdc.europa.eu/sites/default/files/documents/Public%20health%20guidance%20on%20screening%20and%20vaccination%20of%20migrants%20in%20the%20EU%20EEA.pdf

COVID-19 cases are reported very much less in the countries with universal BCG vaccination policies such as India, Afghanistan, Nepal, Bhutan, Bangladesh, Israel, Japan, etc. as compared to without BCG implemented countries such as the USA, Italy, Spain, Canada, UK, etc. BCG vaccine provides protection for 50–60 years of immunization’

https://www.sciencedirect.com/science/article/pii/S0301054620301063

I’ve used HCQ as an antimalarial. I know its safe and there is every chance that it is also effective against covid 19, but BCG means most of us are protected and can lobby the government a great deal harder to stop all this nonsense, but not, unfortunately, before October this year when the BCG trial phase 3 preliminary results are published.

75169 ▶▶▶▶ IMoz, replying to Tim Bidie, #1186 of 1428 🔗

I’ve read too many studies to not be sceptical of a single-factor “solution,” but BCG as either PrEP or PEP seems a bit far stretched given it takes time to get an immune response to any vaccine…

75317 ▶▶▶▶▶ Tim Bidie, replying to IMoz, #1187 of 1428 🔗

This is a site for sceptics, so you are in the right place……but, too late, BCG vaccination already provided the solution in Japan, Vietnam, Greece and so on.

‘The current evidence about BCG vaccination and prevention of acute respiratory infections is of high quality, as it is supported by results from 2 systematic reviews (one including meta-analysis) and 4 RCTs, which provide high level of evidence for prevention studies’

https://www.cebm.net/covid-19/does-bcg-vaccination-protect-against-acute-respiratory-infections-and-covid-19-a-rapid-review-of-current-evidence/

It also provided the solution here but, since 2000 we had circa 12 million new citizens come onboard, many of whom will not have been vaccinated.

‘Here, we compared countries that mandated BCG vaccination at least until 2000 with countries that did not. To minimize any systematic effects of reporting biases, we analyzed the rate of the day-by-day increase in both confirmed cases (135 countries) and deaths (134 countries) in the first 30-day period of country-wise outbreaks. The 30-day window was adjusted to begin at the country-wise onset of the pandemic. Linear mixed models revealed a significant effect of mandated BCG policies on the growth rate of both cases and deaths after controlling for median age, gross domestic product per capita, population density, population size, net migration rate, and various cultural dimensions (e.g., individualism).Our analysis suggests that mandated BCG vaccination can be effective in the fight against COVID-19.’

https://advances.sciencemag.org/content/early/2020/07/30/sciadv.abc1463

Uncontrolled immigration since 1997 (implemented as a deliberate policy by the Blair government in Britain) is the elephant in the room not just for Britain but for Merkel, Macron etc.

The panic and consequent massive economic damage is their legacy.

The demo in Berlin shows that at least some populations are waking up to that.

‘In a number of EU/EEA Member States, subgroups of migrant populations are disproportionately affected by infectious diseases such as tuberculosis, HIV, and hepatitis B and C. Consequently, screening and vaccination programmes may be of benefit for newly arrived migrants, i.e. those who have arrived in the EU/EEA within the past five years1. The European health policy framework ‘Health 2020’ aims to ‘significantly improve the health and well-being of populations, reduce health inequalities, strengthen public health and ensure people-centred health systems that are universal, equitable, sustainable and of high quality’. ECDC has sought to support this aim in migrant health by developing evidence-based guidance on the prevention of infectious diseases among newly arrived migrants in the EU/EEA.’

Europa.eu

Too little……too late…….

75358 ▶▶▶▶▶▶ Carrie, replying to Tim Bidie, 1, #1188 of 1428 🔗

Well said. Didn’t we stop doing BCG vaccinations because TB was no longer present in the UK – well until the mass immigration started..? Is it offered to children again now?

75398 ▶▶▶▶▶▶▶ Tim Bidie, replying to Carrie, #1189 of 1428 🔗
75077 ▶▶ T. Prince, replying to Tim Bidie, 2, #1190 of 1428 🔗

“Don’t be thick, take the prick”
“Don’t be a pest, take the test”
“Make me happy, wear a face nappy”

75359 ▶▶▶ Carrie, replying to T. Prince, 1, #1191 of 1428 🔗

Don’t give Boris ideas!

75088 ▶▶ JohnB, replying to Tim Bidie, 2, #1192 of 1428 🔗

As the TB jab was stopped in 2005, shouldn’t we be seeing a lot of infection in those under 25-26 years of age who haven’t had the jab?

75098 ▶▶▶ IMoz, replying to JohnB, 1, #1193 of 1428 🔗

Not necessarily, the immune system at that age is pretty good, well, I suppose you could suppress it, but it would bounce back

75148 ▶▶▶ Tim Bidie, replying to JohnB, 1, #1194 of 1428 🔗

In Australia where they stopped BCG in 1976 that is more of a problem, but in Britain, under 26s just shrug off a common cold coronavirus, rhinovirus or whatever unless their immune system is suppressed for one reason or another. So covid 19 is really only a big deal for the immunosuppressed, or those without BCG vaccination in their later years, or obese or with other multiple life threatening underlying conditions etc.

There are a lot of healthcare workers from minority communities which may account for quite a lot of the panic……

75023 Mark B, replying to Mark B, 4, #1195 of 1428 🔗

One of the best comments I’ve read. On Anna Brees channel. A University Lecturer in her mid 50’s speaks out..

https://www.youtube.com/post/UgzRjuhJu4I_LdaoEAh4AaABCQ

75100 ▶▶ Cbird, replying to Mark B, #1196 of 1428 🔗

Link doesn’t work Mark?

75156 ▶▶▶ Bella, replying to Cbird, 1, #1197 of 1428 🔗

Worked for me

75174 ▶▶▶▶ watashi, replying to Bella, #1198 of 1428 🔗

me too. Thank you Mark

75045 Bruno, replying to Bruno, 10, #1199 of 1428 🔗

Professor Bhopal (Edinburgh) told the Daily Telegraph: “Why don’t we like herd immunity? Discussion on this has been closed because people equate it to letting the pandemic tear a population apart without any control.

“I’m completely against that, that would be insane. I am not advocating giving up all control measures, we still have to wash our hands, keep our distance and do whatever we are told.

“The bottom line is that older people have a lot to gain from lockdowns and a lot to lose from infection. Young people have a lot to lose from lockdowns and not much to lose from infection.”

Strikes me that us oldies, who all contracted wild virus measles, mumps, whooping cough, chicken pox before the age of 11, no vaccinations then, who were brought up in a world before the polio vaccine (1955), or the BCG vaccine for TB, which I had at school in about 1960, are relaxed about the under 21s catching and recovering from CV19. On polio, children were drilled to wash hands religiously after using loo, before meals, reinforced every summer ” do you want to end up like that little boy with a limp”? It is the right thing to do, no idea why it is regarded as so unpalatable?

75053 ▶▶ Julian, replying to Bruno, 18, #1200 of 1428 🔗

Older people have a lot to lose from lockdowns. That’s something that is rarely mentioned. They are often invoked as the reason we’re doing all of this and a demonstration of how virtuous they are, but I know there are plenty of older people who think all of this is nonsense and do not want to be “saved” if this is what it supposedly takes to do so.

75066 ▶▶▶ A. Contrarian, replying to Julian, 10, #1201 of 1428 🔗

My first thought exactly. Not many would want to be isolated away from their family and friends all winter just to be “saved”. Even if they did, surely being confined to barracks for months on end with no exercise or social interaction is going to hugely increase morbidity and mortality in the future?

Oh I forgot, as long as they don’t die of covid, that’s OK.

75073 ▶▶▶▶ Julian, replying to A. Contrarian, 13, #1202 of 1428 🔗

My 80 year old Mother in law is furious that her grandchildrens’ lives are being ruined supposedly for her benefit. She’s apolitical, didn’t make it to secondary school, but knows very well when she is being sold a line of bullshit.

75115 ▶▶▶ RickH, replying to Julian, 3, #1203 of 1428 🔗

Indeed. Count me in. The idea of general extended Lockdowns is nonsense on steroids.

What f.ing gain? Continuing miserable servitude at the behest of 10th rate politicians who can’t find their arse with both hands? A raddled country that is a sad memory of civilised life, peopled by fearful robots?

Beam me up, Scottie.

75116 ▶▶▶ Bella Donna, replying to Julian, 4, #1204 of 1428 🔗

I’ve always been philosophical about death. We all have an end date and what will be will be, there’s no point dwelling on something you have no control over. Why spend time worrying about it. These mask wearers really get up my nose!

75119 ▶▶▶▶ IMoz, replying to Bella Donna, #1205 of 1428 🔗

Did you hear that anecdote about a philosopher who was pondering the meaning of life and the inevitablity of death… while crossing a road… only to be run over by a lorry? 😉

75345 ▶▶▶ Bruno, replying to Julian, #1206 of 1428 🔗

Indeed, I and others of my generation ignore all this as and when we feel like it, kiss friends and family, socialise, go out, because we know we’ve lived more dangerously in the past than now.

75090 ▶▶ stefarm, replying to Bruno, 11, #1207 of 1428 🔗

The problem is none of us are going to get this time back, our lives have been paused for what???

Fuck all!

75118 ▶▶▶ RickH, replying to stefarm, 1, #1208 of 1428 🔗

Yes – it’s organised fraud, theft and rape all in one. We used to jail people for these crimes if we could identify them.

75091 ▶▶ Basics, replying to Bruno, 5, #1209 of 1428 🔗

Are you allowed to say boy with a limp on a poster these days? Young people become triggered by ‘boy’ nevermind one with a limp! It’s an epic no, no. Yet, how did it come to be.

It’s unpalatable to the ‘inclusivity’ that is brought in with ‘diversity’. Specially inverted words now meaning including all who ‘we’ choose to be included and diversity of people ‘we’ choose to be diverse.

No one left behind! This bold, caring sentiment greets us from on high. It simply means you can choose to stay behind and then we will force you to come along.

Testing is voluntary until the point you refuse and then we have given ourselves the power to remove you to secure location where a test will be administered.

We have social engineers working against social norms to corrupt, twist and manipulate society. Think tanks, Big Society and common purpose, Fusion doctrine and United Nation agendas becoming real in our local area and our own lives.

The Futures Institute at Edinburgh University boldly dispayed a billboard announcing they were going to be “Reshaping the Fabric of Society”. Data driven algorithmic change of life. Happliy Corona lock down measures have dealt heavy blows to Edinburgh University, it truly will be a hell hole for the foreseeable future because of the financial impact on an overstretched organisation. Consequences of their own social engineering.

75048 stefarm, replying to stefarm, 47, #1210 of 1428 🔗

Observations from today, I had to pop into the office to cover some admin work for a colleague (huge government building now like the Mary Celeste)

Jumped on my bike and whizzed in via the bike track that almost drops me outside the office.

Fat people wearing lycra shamed into getting some exercise by fat layabout Boris, makes me want to puke.
Masks left in the gutter or thrown in the bushes, makes me want puke.
People wearing masks, makes me want to puke.
Sanctimonious wankers wearing masks, makes me want to puke.

Was chatting to a colleague who I work fairly closely with. He was covering his boss and moaning about working from home. In the next breath wetting his knickers about going to Cornwall on holiday because of spikes and infection, 2nd wave, just look at Australia blah fucking blah. Can’t wait for a vaccine, makes me want to puke.

How will we work with social distancing, whinge, whinge, I was sitting on his desk virtually on his lap!!!

Told him no need for a vaccine for a virus with a 99.9% survival rate that hasn’t killed police, fireman, supermarket workers, postman and knows when I’m shopping or in the pub. No response, head down back to work, makes me want to puke.

Got home, OH said ‘have you ever woken up and felt anxious and just on edge’

‘yes, every day’

‘not good is it?’

‘no’

We are never going back to normal.

I fucking hate Boris, sturgeon, fauci, gates and everybody else who is profiting from our misery.

75050 ▶▶ Barney McGrew, replying to stefarm, 5, #1211 of 1428 🔗

No response, head down back to work

That’s it! You seem to have in front of you a person with a strong opinion that opposes yours. You think you can persuade, provoke, goad them into having a discussion if not an argument, but they go quiet. I find it weird, infuriating.

75052 ▶▶ Barney McGrew, replying to stefarm, 6, #1212 of 1428 🔗

No response, head down back to work

That’s it! You think you have in front of you a person with a strong opinion that opposes yours. You think you can persuade, provoke, goad them into having a discussion if not an argument, but they go quiet. I find it weird, infuriating.

It’s as though they don’t really have an opinion at all. The stuff they were telling you earlier was a regurgitation, not a thought-through opinion.

75105 ▶▶▶ Mark, replying to Barney McGrew, 5, #1213 of 1428 🔗

I think they hear you and they can’t answer your points, but they aren’t prepared to go rogue on the basis of one person’s points however hard to deal with. So they go quiet. They might still be thinking it over and might move in time, but they are overwhelmingly likely to quickly encounter repetitious pro-panic propaganda or arguments from panic-pushers that will push them back in the other direction, because that is basically everywhere.

So it’s hard to get any purchase.

And it’s especially so because we also face systematically and quite cleverly crafted “behavioural insight” propaganda (which we ourselves are funding through our taxes) that is tailored to defeat arguments that tend to have traction. All for the Greater Good, of course.

75109 ▶▶ RickH, replying to stefarm, 3, #1214 of 1428 🔗

That’s a pretty good representation of a general situation.

75083 ▶▶ GrowYourOwn, replying to smileymiley, 9, #1216 of 1428 🔗

So 15 years ago Fauci was proclaiming HCQ as the wonder drug against SARS coronavirus. Now he’s saying it should be banned… unbelievable. Do these people not remember what they’ve said in the past? Or do they take the population to be idiots. The answer is probably yes to that one.

75107 ▶▶▶ RickH, replying to GrowYourOwn, 6, #1217 of 1428 🔗

Fauci has a track record – connected to the pharmacalogical industry.

75133 ▶▶▶ Sarigan, replying to Nick Rose, 3, #1219 of 1428 🔗

Surely we should be sending to MSM (in the vain hope one is brave enough to publish) and every investigative journalist also?

75060 swedenborg, replying to swedenborg, 8, #1220 of 1428 🔗

The complicated world of staying absolute virus free in this long report (New Zealand)
“New Zealand health authorities say they cannot rule out a Kiwi traveller who tested positive for Covid-19 and now in hospital in South Korea was infected in New Zealand.The Ministry of Health today said they cannot rule out the man became infected in New Zealand before travelling to South Korea last week.The ministry was now in close contact with South Korea and expecting further information from the authorities later today New Zealand time.Korean language newspapers are reporting the international traveller in his 20s arrived from New Zealand on July 22 and tested positive on July 23.Today the Ministry of Health said the traveller left New Zealand six days ago on July 21 and arrived in South Korea on July 22 after transiting through Singapore.The traveller had no symptoms but returned a positive test on arrival.South Korean authorities have informed us that based on their initial investigations they suspect the traveller was infected during the transit in Singapore airport. However other causes, including infection in New Zealand, can’t be ruled out at this stage, said the ministry.”

But the corona warrior Saint Jessica has it under her radar

“We had one similar case before and that turned out to be a false positive,” Prime Minister Jacinda Ardern told Newstalk ZB’s Mike Hosking today. “In this case I will be checking in with our health officials but given of course the chance or likelihood that someone could have picked this up in transit or travel, or a number of other factors, it’s not something health officials have raised alarm bells with me at this stage, but I will be following up on it this morning.”

But the virus has difficulty to follow the script a few days later

“A New Zealand woman says she has tested positive for Covid-19 after flying from Auckland to Sydney just over a week ago. The woman – who didn’t want to be named – took off on July 20 aboard Air NZ flight NZ103 and went straight into quarantine in Sydney. Australian authorities tested her on her second day in quarantine. Her results came back positive for Covid-19 on July 26.Her positive result comes after another passenger  late last night revealed she had tested positive to Covid-19 after flying from Auckland to Sydney on July 6(Paragraph below).Passengers on board that flight seated in rows 22 to 26 were being contacted by health officials here and across the Tasman.In Auckland, the regional public health service was following up with household contacts and other contacts as appropriate, Stuff reported. There was a suspicion the person might have been a previously unconfirmed case from March, and that was responsible for the positive test result. The woman said she assumed Australian authorities would have automatically alerted New Zealand health officials to her positive test.”

“A person who flew from Auckland to Sydney this month has tested positive for Covid-19.Air New Zealand flight NZ103 touched down in the Australian city on July 6 and has since been reported by New South Wales health officials as having a confirmed case of coronavirus on board.The NSW Health website lists several seat rows as being close contacts of the confirmed case.The case had led New Zealand health officials to now test household and other contacts of the passenger here in Auckland.A ministry spokeswoman said health officials in New Zealand had also made contact with the passenger, media outlet Stuff reported.”At this point, it appears the person may have been a previously unconfirmed case from March and this is responsible for the positive test result,” she said “We will continue to fully investigate the circumstances of this positive result, including travel history.
This just illustrates how difficult it is to isolate a country. The possibility of an air corridor with Australia was impossible and with an epidemic in Australia I suppose Saint Jessica has to curtail all travel.

According today’s figure a new confirmed case from North Corea (supposedly virus free!) with arrival date 20th July in NZ and picked up the diagnosis whilst in quarantine)

https://www.health.govt.nz/our-work/diseases-and-conditions/covid-19-novel-coronavirus/covid-19-current-situation/covid-19-current-cases/covid-19-current-cases-details

https://www.nzherald.co.nz/nz/news/article.cfm?c_id=1&objectid=12351244
https://www.nzherald.co.nz/nz/news/article.cfm?c_id=1&objectid=12351103
https://www.nzherald.co.nz/nz/news/article.cfm?c_id=1&objectid=123527

75082 ▶▶ guy153, replying to swedenborg, 10, #1221 of 1428 🔗

It’s an extremely difficult game to play. Well done to them for keeping it up as long as they have.

The problem with epidemics is they have a tipping point. It’s a lot like starting a fire. At the beginning it can seem to get going but go out again easily. But once it hits its stride nothing can stop it.

There probably are a few people in NZ with Covid-19 but they’re very hard to find and too few of them for it to get going. But by the time you start noticing it there are more than you think.

A small outbreak can be put out with a short and very strict lockdown. But all a lockdown does is reduce R, by quite a lot, but never to zero. It’s like you have a chance to put the fire out near the start but you only have one small bucket of water. Beyond a certain point it just won’t do it.

75094 ▶▶▶ Mark, replying to guy153, 1, #1222 of 1428 🔗

Struggling to understand why two people (at least) downvoted that comment. Seems pretty sensible commentary to me….

75136 ▶▶▶▶ guy153, replying to Mark, 3, #1223 of 1428 🔗

Probably because I didn’t say that it’s futile to try 🙂

It depends how they’re doing it. If you can keep Covid out of your country without lockdowns or too much collateral damage I think it’s worth a shot, especially now that a couple of sketchy vaccines might be available soon.

But as with Australia it’s going to be politically impossible to ever admit they failed so if/when it does break out they’re just going to keep locking down harder and harder and the virus is going to be the least of their worries.

75103 ▶▶▶ RickH, replying to guy153, 5, #1224 of 1428 🔗

Meanwhile – immunity is plummeting and vulnerability is rising, as is ancillary damage.

Great strategy!

75120 ▶▶▶▶ Nick Rose, replying to RickH, 4, #1225 of 1428 🔗

It’s almost like they just cannot or will not look at the full picture. Sars-Cov2 is not the only baddie out there. Crazy, crazy.

75153 ▶▶▶▶ Jay Berger, replying to RickH, 1, #1226 of 1428 🔗

Unless there is a super-effective vaccine, they will have to make a decision at some point whether they will then take it on the chin, or want to live like the Sentinelese for good.

And you are of course right that in each case, their immune system will be weaker than that of the people in all other countries, their susceptibility to Covid 20, 21, 22ff&co will likely be much higher, and the suppression/vaccine/Sentinelese problem will of course repeat for all those upcoming viruses.

I think that Sainthood was bestowed on her a bit prematurely, if not erroneously.

75137 ▶▶▶ swedenborg, replying to guy153, 2, #1227 of 1428 🔗

But Kiwis don’t seem too keen to be tested

“The ministry said results from a recent survey of GPs showed “half of the 800 GPs surveyed had seen patients who declined a Covid test and that the proportion of patients that declined was on average 25 per cent”.
Dr Bloomfield encouraged all people who were offered a test to have it done.”

https://www.nzherald.co.nz/nz/news/article.cfm?c_id=1&objectid=12353327

75354 ▶▶▶▶ Carrie, replying to swedenborg, 1, #1228 of 1428 🔗

The Kiwis are not stupid!

75089 ▶▶ IMoz, replying to swedenborg, 4, #1229 of 1428 🔗

Let me guess, everyone on that flight wore masks?..

75297 ▶▶ Farinances, replying to swedenborg, #1230 of 1428 🔗

I actually think this is the dumbest thing any country could possibly have done. Good luck having a functioning economy ever again, NZ.

75061 Julian, replying to Julian, 13, #1231 of 1428 🔗

I’ve written to my MP to ask for her assurance that she will never vote to make covid vaccination compulsory. If we all do this we might cover a substantial proportion of UK MPs. We could try to get the results of this publicised – name and shame, and frighten neutrals into realising what’s afoot.

75117 ▶▶ Cheezilla, replying to Julian, 4, #1232 of 1428 🔗

Mine has already assured me that the vaccine will be voluntary – but what does he know? Just takes an SI and it’s fait accompli.

75131 ▶▶▶ Mark, replying to Cheezilla, 3, #1233 of 1428 🔗

But of course there’s a difference between voluntary and “voluntary” – the latter meaning you are free to refuse provided you re prepared to do without things like access to education, shops, government services, travel etc etc.

75336 ▶▶▶▶ Alec in France, replying to Mark, 1, #1234 of 1428 🔗

and food?

75353 ▶▶▶▶ Carrie, replying to Mark, #1235 of 1428 🔗

Exactly!

75146 ▶▶ Jay Berger, replying to Humanity First, 1, #1237 of 1428 🔗

Person2Person = breeding ground for dissent.

75079 swedenborg, replying to swedenborg, 2, #1238 of 1428 🔗

https://www.zerohedge.com/markets/one-first-ships-resume-cruising-having-covid-outbreak

Bad luck for Norway which has had very low numbers and bad news for the cruising buisness

75121 ▶▶ Sarigan, replying to swedenborg, 1, #1239 of 1428 🔗

Interesting line though:

All four of the hospitalized crew members had been sick for several days while on board the vessel, and all four had been placed in isolation. But the line said their symptoms weren’t consistent with COVID-19. They only tested positive for the illness after the ship docked in Tromsø early Friday.

It’s unclear if the crew members are seriously ill, or if they only are being hospitalized as a way to keep them isolated.

75292 ▶▶▶ Farinances, replying to Sarigan, #1240 of 1428 🔗

We really need these People to film themselves in hospital with no symptoms.

75087 Nick Rose, replying to Nick Rose, 17, #1242 of 1428 🔗

Liverpool’s Mayor Joe Anderson doing his best to destroy his city’s economy:

https://www.liverpoolecho.co.uk/news/liverpool-news/mayor-joe-calls-no-mask-18690717

No mask = No Service

Well done lad, keep it up. Customers lost from the High Street to online don’t usually return. Really well done.

75092 ▶▶ Dan Clarke, replying to Nick Rose, 12, #1243 of 1428 🔗

So what is he getting out of it? Destroying business, destroys council income

75102 ▶▶▶ Nick Rose, replying to Dan Clarke, 13, #1244 of 1428 🔗

Just another idiot. The political class is full of them.

75170 ▶▶▶ Toby Pierides, replying to Dan Clarke, 2, #1245 of 1428 🔗

Depends, doesn’t it? “Short term pain for maximum gain”. Who knows what these various characters have been promised for taking the blame for supposedly coming up with these idiotic policies themselves? Something financial? More power? A seat in the Ark?!

75104 ▶▶ Sam Vimes, replying to Nick Rose, 18, #1246 of 1428 🔗

“I think we need to work with our partners to look at how this is enforced and whether in shops we can say ‘no masks, no service.”

No you can’t, Mr. Mayor. The law, which is bigger than you, says there are exemptions. Then there is Disability Discrimination, and Equalities law. But if you can’t even do simple sense, they’ll be lost on you…

75112 ▶▶▶ Cheezilla, replying to Sam Vimes, 2, #1247 of 1428 🔗

….. with exceptions for those unable to wear them.

He said it himself!

To be fair, he’s probbaly looked at Manchester and is desperate not to have that happen on his patch.

Some solidarity might not go amiss instead. Talk about divide and rule!

75138 ▶▶ Telpin, replying to Nick Rose, 4, #1248 of 1428 🔗

The obvious answer to this is that such an approach is Discriminatory and therefore unlawful under the Equality Act. Does the Mayor and good people of Liverpool really want to deny access to asthmatics and there with respiratory conditions, the mentally ill and the deaf for example. Since when did their rights not matter?

75167 ▶▶▶ Roadrash, replying to Telpin, 4, #1249 of 1428 🔗

Unfortunately judging by the comments beneath the article most people agree with him. Fellow sceptics on here have made the effort to look into this whole fiasco in depth and educate themselves on matters relating to Covid and the lockdown. Most people haven’t and will comply with whatever rubbish new rules or guidelines are introduced. Many won’t even know that there are exemptions to face mask wearing. Most wont distinguish between guidelines and law.

Both the Mayor and Liverpool’s Director of Public Health will pump out the same Government message because they either lack the intelligence to do their own research or they love the power they now have. Frankly the last two people I would be taking health advice from would be the obese mayor and the equally over weight Director of PH.

75335 ▶▶ Alec in France, replying to Nick Rose, 1, #1250 of 1428 🔗

How long before

No vaccination = No service?

75097 Nick Rose, replying to Nick Rose, 11, #1251 of 1428 🔗

https://twitter.com/simondolan/status/1290219976406654976

Publican asking why Police resources are being used to harass businesses trying to survive.

75110 ▶▶ Bella Donna, replying to Nick Rose, 11, #1252 of 1428 🔗

I really feel for people trying to make a living with this sociopathic government in charge. Businesses should get together and start harassing this government! Companies in my town are struggling as they are everywhere else.

75111 ▶▶▶ IMoz, replying to Bella Donna, 3, #1253 of 1428 🔗

If they were truly sociopathic, they’d let the virus run the course (apathy = indiffernece), instead, they appear to be megalomaniac.

75129 ▶▶▶▶ Mark, replying to IMoz, 1, #1254 of 1428 🔗

Sociopath/psychopath derived via German from Greek pathos (illness, suffering), not from apatheia (apathy), also derived from pathos.

75139 ▶▶▶▶▶ IMoz, replying to Mark, #1255 of 1428 🔗

You’re right! Don’t know what I was thinking…

75346 ▶▶▶▶ Cheezilla, replying to IMoz, #1256 of 1428 🔗

Sociopaths are also narcissists, so can’t afford to lose face. Allowing the austerity-related problems of the NHS to be revealed in all their glory isn’t a good look.

Unfortunately, lies beget more lies ad infinitum. Once they backed themselves into that corner, they were easy prey for powerful interests.

75113 ▶▶▶ Nick Rose, replying to Bella Donna, 6, #1257 of 1428 🔗

Worse, who would bother even trying to start a business? What’s the point, if some government gets scared of a virus and snatches it away? It’s why this nonsense has got to stop. :o))

75122 Basics, 6, #1258 of 1428 🔗

Saul Alinsky Rules for Radicals. From wiki page:

The use of common enemy against a community was another theme of Rules for Radicals, as a uniting element in communities.

Alinsky would find an external antagonist to turn into a “common enemy” for the community within which he was operating. Often, this would be a local politician or agency that had some involvement with activity concerning the community. Once the enemy was established, the community would come together in opposition of it. This management of conflict heightened awareness within the community as to the similarities its members shared as well as what differentiated them from those outside of their organization.[4] The use of conflict also allowed for the goal of the group to be clearly defined. With an established external antagonist, the community’s goal would be to defeat that enemy.

If you are a Lockdown sceptic you are that enemy. This is the battle they are waging. Personally, for all the bumps and grinds I don’t really think the government have achieved the full brainwash that sceptics are the enemy – and I can explain why. The government are clearly the biggest enemy here, clearly. The government get in the way of their own messaging.

As someone below said, it’s important to keep in mind humility and politeness. Making a smile and a cheerful greeting is the way to effect others by respect. Keep at it!

75125 Harry hopkins, replying to Harry hopkins, 21, #1259 of 1428 🔗

The government IS THE VIRUS and the media IS THE SPREADER.

Therefore to protect yourself from ‘infection’ under no circumstances listen, watch, or read mainstream news and current affairs. If friends, neighbours or family try to talk about the latest Covid scares just listen, nod and sympathise and let it all go over your head. Ignorance really is bliss.
If you don’t tune into the Covid narrative and try simply to act normally, whilst you may wake each morning with a degree of anxiety it will be no where near the degree of fear and dread that the disciples of Covid are feeling.

This method works. My wife and I have never watched or absorbed MSM for some years now. Since March when this whole fiasco began I have developed a severe allergic reaction to it. As far as I am concerned the media is the spreader and I will go nowhere near it.

75128 ▶▶ IanE, replying to Harry hopkins, 1, #1260 of 1428 🔗

Personally, I believe that burying one’s head in the sand is the wrong approach, but chacun a son gout.

75132 ▶▶▶ Harry hopkins, replying to IanE, 11, #1261 of 1428 🔗

No burying my head in the sand! I consider myself to be exceptionally well informed but none of this information is obtained from MSM!

75135 ▶▶ Mr Dee, replying to Harry hopkins, 9, #1262 of 1428 🔗

The blurb from the book recently published by Dr Gad Saad (The Gadfather!) – and written last year, before the Coronavirus panic hit:

“The West’s commitment to freedom, reason, and true liberalism have become endangered by a series of viral forces in our society today. Dr. Gad Saad exposes how an epidemic of idea pathogens are spreading like a virus and killing common sense in the West.”

I’m beginning to think that the ‘idea pathogens’ Dr Saad is talking about have now gone mainstream – and have infected Western politicians and ‘health experts’, as well as the general public. What’s happening in the Woke world is linked with the Coronavirus panic.

An interesting question – why are we immune? What can we do to ‘immunize’ the infected population?

Check out Gad’s podcasts – he does some great interviews.

75140 ▶▶ Mr Dee, replying to Harry hopkins, 9, #1263 of 1428 🔗

And yes, I have to be careful where I get my news from at the moment, or I’ll descend into a pit of madness and manic stress. The psychological hammer blows they’re raining down on us is incessant and extremely dangerous.

If I need to get a grip on life these days, I sometimes have to physically remove myself from current society. A long walk in the hills or woods is more grounded and real than the unreality and illusions of towns and cities.

75145 ▶▶▶ Nick Rose, replying to Mr Dee, 6, #1264 of 1428 🔗

That’s my escape too. Get out early (or late) and keep putting one foot in front of the other. Best head-straightener ever.

75224 ▶▶ TheBluePill, replying to Harry hopkins, 3, #1265 of 1428 🔗

No need. For some reason yet to be revealed, certain people have immunity to this infection. It’s possible that they have achieved cross-immunity from some similar sickness, such as the Brexit propaganda.

Having said that, even those with immunity, when subjected to excessive viral load may develop temporary symptoms such as dangerously elevated blood pressure.

75338 ▶▶▶ Cheezilla, replying to TheBluePill, #1266 of 1428 🔗

That’s why I’m exempt from wearing a mask. 😉

75245 ▶▶ Mark, replying to Harry hopkins, 3, #1267 of 1428 🔗

Exactly this. It’s relatively safe to consume MSM in very small doses for recreational and social purposes if you are alert to the constant indoctrination, and therefore on your guard against it.

But it’s atill not entirely safe. and you will still be absorbing all the indoctrination on the topics for which you are not alert to it.

Just say no, is safest and best.

75261 ▶▶▶ Margaret, replying to Mark, 3, #1268 of 1428 🔗

I look at the Sky news website page and the BBC website page to see what the headlines are. Then I go off to research the truth!

75340 ▶▶▶▶ Cheezilla, replying to Margaret, 2, #1269 of 1428 🔗

Me too. Skim Grad and DT to see what’s being fed to the sheeple today and how they are reacting.

75134 Kev, replying to Kev, 15, #1270 of 1428 🔗

Only just started on this site fully today, so not sure of what has gone before.

I can’t find any reference to the fact that on 19th March (three days before lockdown) the UK government downgraded Covid-19 from the highest classification of a Highly Contagious Infectious Disease (HCID).

This is no conspiracy theory, it’s there on the gov.uk website:

https://www.gov.uk/guidance/high-consequence-infectious-diseases-hcid#status-of-covid-19

This was in full agreement of all four UK nations as explained on the link. Scroll down from the link to find further information about HCID’s.

Apologies if this is already well known.

75197 ▶▶ Nick Rose, replying to Kev, #1271 of 1428 🔗

Does make you wonder…

75331 ▶▶▶ Bruno, replying to Nick Rose, 2, #1272 of 1428 🔗

Don’t worry, we all had to Google it…
It’s because if designated an HCID sufferers would have to be transferred to and isolated in one of two designated hospitals, from memory, St Thomas’ in London and another in Newcastle, also one each Wales, Scotland, NI.
Neither necessary nor practical for CV19.

75379 ▶▶ Bella, replying to Kev, #1273 of 1428 🔗

It is here, but absolutely no harm in reposting it.

75160 ▶▶ Jenny, replying to Nick Rose, 9, #1275 of 1428 🔗

Heneghan is always good! Serious question – what has happened to the “urgent review” of the reporting of Covid-19 deaths by PHE which Hancock ordered two weeks ago due to Heneghan’s work? Is it ongoing or was the sense of urgency lost when the “powers that be” realised that the accurate figures (especially now) would be insufficiently alarming? As I understand it nothing has changed on reporting and I cannot find any update on the review.

75172 ▶▶▶ Sam Vimes, replying to Jenny, 3, #1276 of 1428 🔗

It will be forgotten. Because it would show them up. Surely a sample, say one weeks worth of figures, ‘old way’ vs ‘correct way’ could be produced quickly?

75192 ▶▶▶ Nick Rose, replying to Jenny, 3, #1277 of 1428 🔗

No longer in the news, so handbrake on with it is my guess. God, I’m getting too cynical!! :o))

75163 ▶▶ Jay Berger, replying to Nick Rose, 5, #1278 of 1428 🔗

Same in the US, heavily compromised pillar 2 resting drove and drives the increase in positive test results.
And same as in LUX, CH, Austria&Germany: the number of new positives equals the false positive rate of the PCR test, which is why testing is extended, made free and made mandatory in more and more cases and federal states there.
They found and use this tool to keep US suppressed for good.

75195 ▶▶▶ Nick Rose, replying to Jay Berger, 2, #1279 of 1428 🔗

Until people wake up.

75350 ▶▶ Carrie, replying to Nick Rose, 1, #1280 of 1428 🔗

Pity you have to pay to read their articles – think you can only read a couple without a subscription…

75150 tonyspurs, replying to tonyspurs, 12, #1281 of 1428 🔗

I can’t get my head around what are people so afraid of?,when I ask they say the virus when I ask why they don’t even know just say if you got it you’d know …but that’s the point most people get it and don’t even know ..blank expression followed by well why are so many people dying then! FFS we’re never gonna get through!

75186 ▶▶ Olive, replying to tonyspurs, 18, #1282 of 1428 🔗

I just had a complete falling down moment at Sainsburys when I asked why there were now no shopping dividers on the conveyor belt and was told that ‘they help spread the virus’. I ripped off my mask and went, well berserk, stating that clearly there was no virus in that sterile humourless shop to spread on anything. Suffice to say I can’t go back there and am genuinely questioning my own sanity and ability to cope with the world anymore.

75194 ▶▶▶ Nick Rose, replying to Olive, 7, #1283 of 1428 🔗

Best way is to laugh at it instead.

75333 ▶▶▶▶ Cheezilla, replying to Nick Rose, 1, #1284 of 1428 🔗

And shop at Aldi.

75201 ▶▶▶ Sam Vimes, replying to Olive, 6, #1285 of 1428 🔗

It’s because people touch them. Like the baskets, trolleys, all the goods on sale, your money, the card machine, the conveyor belt itself… oh and the snot soaked rags they keep fumbling with, before touching all the above. So, I applaud them really, oh yeah.

75221 ▶▶▶ JohnB, replying to Olive, 4, #1286 of 1428 🔗

The Universe is punishing you for wearing a mask …

75151 stefarm, replying to stefarm, 4, #1287 of 1428 🔗

This is a goodun Anna Brees

https://youtu.be/krNOunUV-Tk

75178 ▶▶ RickH, replying to stefarm, 2, #1288 of 1428 🔗

An excellent appeal to sense.

75162 Sarigan, replying to Sarigan, 1, #1289 of 1428 🔗
75166 ▶▶ Nick Rose, replying to Sarigan, 1, #1290 of 1428 🔗

To judge from the population density, I think that is down TO 15 million. This is a war gaming site?

75184 ▶▶▶ Jay Berger, replying to Nick Rose, 1, #1291 of 1428 🔗

The GDP figures are even wilder…
This seems to be post a WW3 that ended in 2025 (5years!) stuff, a bit extreme if you ask me….

75185 ▶▶▶ Sarigan, replying to Nick Rose, #1292 of 1428 🔗

Yes, you are correct, down to! Seems somewhat extreme.

Don’t know if this helps explain – https://www.algora.com/Algora_blog/2020/04/10/deagel-makes-mysterious-changes-to-2025-population-forecast-for-america-as-bill-gates-launches-gran-d-challenge-the-holy-grail-of-influenza-research-and-b

Possibly a bit too tinfoil and down the rabbit hole?

75189 ▶▶▶▶ Nick Rose, replying to Sarigan, 1, #1293 of 1428 🔗

Strikes me as a bit sudden.

75348 ▶▶▶▶▶ Carrie, replying to Nick Rose, #1294 of 1428 🔗

Side effects of vaccine???

75165 Major Panic, replying to Major Panic, 13, #1295 of 1428 🔗

Re – the leaflet – thanks for all your feedback.
I’ve kept it simple stuff becuase people have short attention spans, me included – just short headlines with easy to understand facts – at Cheezy’s great suggestion I’ve avouded %’s and death numbers. We know that 300 out of millions is tiny but people with no common sense may not – the judge at Dolan’s court case was shocked that as many as 2 children have died out of 15 million.

Anyway I welcome your feed back – these are only my suggestions
If anyone wants to get involved please send your email add to lockdowntruths who has kindly offered to pass on, and will hopefully also get involved alongside their own excellent campaigns…

Important COVID-19 Facts

1. On average 11,000 people die naturally of old age every week in the UK (600,000 a year) – most of the 46,000 who have died with (not from) covid were very old and frail and would probably have passed away in 2020 without covid.

2. Of the 46,000 people who have died with (not from) covid nearly 44,000 already suffered from life threatening health conditions.

3. The average life expectancy in the UK is 80 years – the average age of people dying with (not from) covid is over 80.

4. People under 60 with no serious health conditions have a 999.97 out if 1000 recovery rate from covid, and are SIX times more likely to die in a car accident than from covid – the vast majority don’t even know they have the virus.

5. The vast majority of people who died with (not from) covid caught the virus in nursing homes and hospitals.

6. A surge in covid testing will show a surge in covid cases – the vast majority of people that test ‘positive’ do not know they have the virus. Because of the inaccuracies of testing 100,000 tests can show 1000 ‘false positives’ for people who do not have covid.

7. The healthy population with extremely low vulnerability to covid were told to lockdown in their homes but the vulnerable people in nursing homes were not protected – elderly people with covid were forced back into nursing homes, infecting the other frail residents.
8. It is estimated that over 20,000 people have already died as a result of the lockdown experiment (not covid) – people are not getting hospital treatment for heart disease, cancer screening, etc.

9. The Government’s own research suggests that as many as 200,000 people will lose their lives as an unintended consequence of the lockdown experiment.

10. Sweden did not try the lockdown experiment and now believes it has achieved community immunity with less deaths by size of population than the UK and many other countries.

11. Sweden’s schools did not close down and no children or teachers died of covid.

12. Sweden’s scientists believe the public wearing masks is pointless – Norway, Finland and Finland scientists agree as there is no evidence that they do less harm than any good.

13. Many of the world’s leading scientists say that the lockdown experiment did far more harm than any good, and will cost many more lives in the long term

14. Millions of British workers will lose their jobs when furlough finishes, thousands of businesses will stop trading, the British economy will suffer its greatest collapse in peace time because of the lockdown experiment.

15. Sweden’s economy continues to recover well – the Swedish are enjoying life and not living in fear.

16. The best way to protect the vulnerable is population immunity.

17. The regulators are preventing the media questioning the effectiveness of the novel lockdown.

For more facts about covid visit www………

75175 ▶▶ Sarigan, replying to Major Panic, 3, #1296 of 1428 🔗

You could add Netherlands to the no mask list.

75341 ▶▶▶ bluemoon, replying to Sarigan, 2, #1297 of 1428 🔗

With regard to your keep it simple point above – would there be room for a simple definition: 1. COVID 19 is a virus which…… 2. Coronavirus is the name given to the family of viruses which include all common cold and flu viruses.,,,,,
It’s just that so often I have been asked, ‘well what about all the positive tests for coronavirus?’

75343 ▶▶▶▶ bluemoon, replying to bluemoon, 2, #1298 of 1428 🔗

Also, can this thread be transferred to today’s forum? It’s important IMO to keep in front of posters.

75176 ▶▶ Anonymous, replying to Major Panic, 4, #1299 of 1428 🔗

If this is a leaflet you’ll be handing out to people I think that 17 statistics is maybe too much. If you could keep it to 10 with a larger font it would be more impactful. Perhaps six stats about the disease (who is dying, schools, cases now being linked to younger and no corresponding increase in hospitalisations) and then 4 about the economy.

Some of these statements are perhaps less obvious as facts – particularly ‘the Swedish are enjoying life’.

Bullet 17 is accurate but I wonder if to an average person this would discredit the leaflet and make it look tinfoil hat.

Add sources.

75181 ▶▶▶ Major Panic, replying to Anonymous, #1300 of 1428 🔗

that’s great, makes sense, thank you – which 10 would you suggest?

75219 ▶▶▶▶ Mark, replying to Major Panic, 1, #1301 of 1428 🔗

Always hard to condense, but limiting to ten if possible makes good sense. Hard to say which ones to remove – probably depends on your target audience and intended results (in terms of what you want them to think about). Some can probably be combined.

Great work, anyway. My first thoughts would be:

Combine 8 and 9.
Add Holland to 12 and amend extra Finland
Remove 15 and 16 (not because there’s anything wrong with them, but just for conciseness).

75235 ▶▶▶▶▶ Sam Vimes, replying to Mark, 2, #1302 of 1428 🔗

I think you might be looking at a set of leaflets, each with a selection of five or six killer points, maybe the odd belter duplicated on different leaflets. These would be ‘big brothers’ to BluePill’s stickers, mentioned below. Just thoughts, happy to be shot down.
Isn’t it a shame we have to avoid real numbers and stats?

75239 ▶▶▶▶▶▶ Mark, replying to Sam Vimes, #1303 of 1428 🔗

You could definitely produce more targeted subsets as well as the general purpose one. And there might be a case for the “hard” numbers in those.

75237 ▶▶▶▶▶ Mark, replying to Mark, 1, #1304 of 1428 🔗

Also combine 10 and 11.

75252 ▶▶▶▶▶▶ Major Panic, replying to Mark, 1, #1305 of 1428 🔗

Thanks, we’ve whittled it down to 12 points

75180 ▶▶ Sam Vimes, replying to Major Panic, 3, #1306 of 1428 🔗

This is probably too wordy, but something along the lines of “If you test positive, you won’t die; you won’t get taken to hospital; you won’t be given medicine – you will just be sent home and told to stay in – that’s all!”

75182 ▶▶ Martin Spencer, replying to Major Panic, 1, #1307 of 1428 🔗

Point 10 you call it “community immunity” but at point 16 you call it “population immunity”.

75187 ▶▶▶ Major Panic, replying to Martin Spencer, #1308 of 1428 🔗

oops…

75183 ▶▶ Basics, replying to Major Panic, 4, #1309 of 1428 🔗

If it’s not too late to add a two-peneth can I suggest high up in the list is a mention of why oppose the government measures.

The importance of normal life and freedom. That pointing out the valued information points is done through concern and care, thoughtfully. To give the reader a reason to continue through the points.

Apologies for not following the earlier discussion. Has 19 been decided against? Covid-19.

Thanks for posting. I am sure some of the talented writers here are better able to further sharpen the list.

75188 ▶▶ stefarm, replying to Major Panic, #1310 of 1428 🔗

Any chance of having the picture of Guantanamo prisoners wearing orange jump suits, masks and shackles on the back?

75257 ▶▶▶ Major Panic, replying to stefarm, 1, #1311 of 1428 🔗

lets not give the bedwetters ideas – they might pressure the Government into making that lot mandatory

75204 ▶▶ IMoz, replying to Major Panic, 1, #1312 of 1428 🔗

Life expectancy is how long you are expected to live had you been born today (Life Expectancy at Birth) if mortatily rates do not change. So you need to look at historical life expectancy and find the correct life expectancy for people to be dying this year, then anyone over that life expectancy has lived past that. I did that exercise when COVID-19 panic started, and it was 75 or thereabouts, there’s a statistical fiddle where you add a number of minutes to each year lived due to medical advances etc, but it doesn’t make that much difference and I can’t quite remember where the fiddle is described.

75216 ▶▶▶ Stuart Barker, replying to IMoz, 2, #1313 of 1428 🔗

Neither approach is correct in fact. The corresponding figure you theoretically want is the remaining life expectancy for people who are already 80.

The reason is that life expectancy at birth is effectively a weighted average of the likelihood of dying each year from birth upwards. So as you live longer the remaining expectancy of life does, in fact, increase. It’s not a statistical trick or anything like that, it’s just a fact that, having survived so far your weighted average remaining life has gone up.

But having said all that, the average expectancy of life at 80 is also misleading because, of course, by definition the majority of COVID deaths have comorbidities so it is a false assumption that they would have gone on to experience average life expectancy (that’s one of the mistakes made by the very poor paper that suggested average life years lost to COVID was 10).

It’s actually really difficult to come up with an honest estimate of future lost life expectancy, the best you can say really, is that it is almost certainly less than the average remaining life expectancy for the population of 80 year olds as a whole.

75220 ▶▶▶▶ IMoz, replying to Stuart Barker, #1314 of 1428 🔗

Yet the only way to determine how much of a life expectancy an 80 year old today ought to have had is to go back 80 years and see what the life expectancy was at their time of birth, then fiddle that for advances.

Why do you say that having survived so far the weighted average goes up, what’s the pathological or statistical model there?

75226 ▶▶▶▶▶ Stuart Barker, replying to IMoz, #1315 of 1428 🔗

The way to determine life expectancy is to look at current data and that is what the ONS does. The life expectancy you had at birth is necessarily unreliable because it was based on data then.

Your life expectancy goes up as you age regardless of any improvement to mortality generally, because each year you survive is one more year when you didn’t die. In particular overall life expectancy at birth is materially reduced by infant mortality and the so-called accident hump in your 20s. If you survive both of those then your life expectancy is inevitably higher than it was at birth.

I know it feels unintuitive but just think about it for a bit 🙂

75251 ▶▶▶▶▶▶ IMoz, replying to Stuart Barker, #1316 of 1428 🔗

Ok, we’re talking about different metrics.

What I’m talking about is: applying the law of large numbers, has the person outlived people born in the same year.

What you’re talking about is, given a person’s age, how many years would we expet them to “stick around,” Of course, your metric doesn’t work well for COVID-19 specifics, as you rightly say, due to comorbidities. 🙂

75213 ▶▶ IMoz, replying to Major Panic, 1, #1317 of 1428 🔗

Point 12: “… Norway, Finland and Finland scientists …”

75215 ▶▶ TheBluePill, replying to Major Panic, 5, #1318 of 1428 🔗

I like the idea of a leaflet, but I wonder if we may be thinking too logically here. The sheeple aren’t interested in facts or stats.

I’ve been thinking that what I would like is a roll of small stickers, preferably acrylic, round and about the size of a mug, each with a simple message such as “the virus is a lie” or “no one is dying of covid”. Maybe have a link to this or another site.

Every time you get the train, slap a few on the back of the seats. Go shopping, slap them on the trolley handles. Go to the pub, stick them on the beer mats.

The sheeple may start to think there are more people thinking this way and may move to a different herd.

If someone sourced these I’m sure we would be happy to pay for them.

75238 ▶▶▶ Major Panic, replying to TheBluePill, 2, #1319 of 1428 🔗

you are right and thats a great idea – but i wonder if that would be like putting ”God doesn’t exist” stickers on the back of church pews

75332 ▶▶▶▶ Cheezilla, replying to Major Panic, #1320 of 1428 🔗

Not if you are confirming someone’s suspicions.

75286 ▶▶ bluemoon, replying to Major Panic, 2, #1321 of 1428 🔗

Thanks for putting this together.
I think that assertions are better avoided. Just as a for instance, Point 14. “Millions of British workers will lose their jobs” etc – might be better expressed as “Many thousands of British workers have already lost their jobs, and with the British economy predicted to contract xxxx (there have been studies published on this forum and I can’t remember the predictions exactly, sorry) then many more thousands will be unemployed by the end of the year.”

75347 ▶▶ Carrie, replying to Major Panic, #1322 of 1428 🔗

Great! To point 11 you could add that there has been no spike in infections as a result of Norway and Denmark re-opening schools post-lockdown..

75177 Mibi, 3, #1323 of 1428 🔗

There were much more people at the Berlin protest than BBC reported!

500.000 were registered ahead of the event, but during the demonstration, there were between 800.000 and 1.3 million!

Get the details here (in German): https://www.youtube.com/watch?v=WzWGk3MP8XE&feature=youtu.be

75191 RickH, replying to RickH, 9, #1324 of 1428 🔗

Nothing new. But I’ve just been looking – as usual – at the excellent updated CEBM graphics on deaths and hospital admissions.

I have been wavering towards thinking that stupidity and ignorance could be, indeed, a major component of this man-made disaster.

This could indeed be true of the ordinary Joe who gets no further than the notoriously crap MSM for information.

But for those in charge? Just look at those bar charts with their blindingly clear message about a disappearing infection – well below epidemic levels. Then read the paper that puts testing nonsense into context.

It stretches credibility that anyone closely involved with the management of the country could honestly believe the ridiculous knicker-wetting Fear and Panic narrative about this pretty ordinary virus.

Not difficult to work out the conclusion.

Dangerous times.

75278 ▶▶ guy153, replying to RickH, 3, #1325 of 1428 🔗

They might think it’s disappeared because of all the crap and so they need to keep “squeezing the brakes” etc to keep it so low. It’s hard to believe they can really be that stupid but their whole existence depends on the lie.

Remember all that ridiculous nonsense last year when they kept saying they wouldn’t ask for a Brexit extension and kept “preparing” for no deal? They had decided that admitting the truth was an “extinction level event” so therefore the truth did not exist.

The way they’re “preparing” for the second wave is very a similar activity.

75196 BecJT, replying to BecJT, 29, #1326 of 1428 🔗

I wrote to the Royal College of General Practitioners:

I have been trying to find the answer to this, but have been unable so I wonder if you can help me. Could you tell me what specific aspects of the law GP practices are following when they say that patients cannot be seen in person, and must only be seen by telephone or digital appointment please? The CoronaVirus Act was revoked and replaced on 3rd July with Part 2 and it’s unclear exactly what applies to medical care? https://www.legislation.gov.uk/uksi/2020/684/regulation/1/made Matt Hancock has since said all healthcare apts will have to remain remote / digital for the foreseeable. On what authority has he done that? And on what legal basis are GP practices enacting it?

Secondly, could you point me at what rights patients have during this time? If, say, GP practices are enacting guidance as if it was law, and are rationing, reducing or cutting services to patients, what recourse do patients have?

Thirdly, could you let me know, are GP practices and care providers still subject to PSED duty, equality impact assessments and risk assessments? I assume they are obliged, when working out what services to offer, to ensure they are not discriminatory. E.g. telephone appointments could be exclusionary to hard of hearing and deaf people, and zoom or digital appointments are difficult to access for those who are elderly, don’t have access to technology or are learning disabled?

My local practice, I hear anecdotally, are asking patients to take photos of body parts and text and email to them the surgery. I assume that practice is not consistent with good risk assessments, GDPR, or patient dignity, privacy or confidentiality? it would only take one nefarious person in the practice to upload intimate photos to a porn site, or share them outside the practice for that to be quite a serious breach I assume?

I’ve looked at your website, and I notice that you have plenty of information about GPs assessing the risks to themselves, but I can’t find anything about assessing risks to patients by withdrawing care in this way? Could you tell me what GPs are obliged to do?

I assume that GP practices are assessing the risks to their patients when they are not seen in person, and each practice is obliged to carry out such a risk assessment? This article on risk assessments is useful, http://laworfiction.com/2020/07/risk-assessments-an-important-chink-in-the-lockdown-armour/ In law, Covid19 does not represent a clear and imminent danger. I assume therefore, when risk assessing remote services, GPs are obliged to balance risks? Such as missed diagnoses, late diagnoses, missing symptoms by relying on the patient to self report them, late referrals etc?

I also note RCGP is recommending GP practices enforce the wearing of masks when people do have to come into the practice, and enforce social distancing (which is not law).  Here is the law on masks: http://laworfiction.com/wp-content/uploads/2020/07/Face-Covering-Exemption-Notice-with-Law-Explained-24-July-2020.pdf I assume GP practices have been given clear guidance on the exemptions that apply to face masks and are clear that they cannot refuse care to anyone who is legally exempt from wearing one?

The reason I ask all this is my local GP practice is refusing to see my elderly dad, he’s getting very threadbare care by telephone, and access to care is policed by over zealous receptionists who are giving out advice that I believe is neither lawful, enforceable, nor accurate. I want to know on what basis are NHS providers withdrawing care from their patients like this?

Many thanks

75203 ▶▶ Hubes, replying to BecJT, 10, #1327 of 1428 🔗

That is a fantastic letter. I can’t understand why doctors are still operating in this way. It’s an absolute disgrace.

75230 ▶▶▶ anon, replying to Hubes, 2, #1328 of 1428 🔗

having spoken to a few – they either buy the propaganda (or pretend to) or are too scared to speak out

the nhs threatens staff who speak out in case you were unaware

75242 ▶▶▶▶ BecJT, replying to anon, 6, #1329 of 1428 🔗

I was aware, but there comes a point in all our lives that when faced with a moral dilemma we do the right thing, so I’m rapidly running out of sympathy.

75266 ▶▶▶▶▶ anon, replying to BecJT, 4, #1330 of 1428 🔗

they’re mostly trapped in big mortgages, school fees etc.

they’re paid handsomely too.

…difficult to get a man to admit something when he’s paid to think otherwise (I can’t recall the quote)

PS you must have the patience of a saint if you have any sympathy left!

75268 ▶▶▶▶▶▶ AN other lockdown sceptic, replying to anon, 4, #1331 of 1428 🔗

In other word, turkeys don’t vote for Christmas

75271 ▶▶▶▶▶▶▶ anon, replying to AN other lockdown sceptic, 2, #1332 of 1428 🔗

precisely!

75253 ▶▶▶▶ Hubes, replying to anon, 2, #1333 of 1428 🔗

Who from the NHS threatens the staff? How do they threaten them? Verbally? Is the threat dismissal?

I’m not sure you can be dismissed for questioning and speaking out against current policies that are both unlawful and unethical.

75267 ▶▶▶▶▶ anon, replying to Hubes, 1, #1334 of 1428 🔗

dismissal is what I heard.

75285 ▶▶▶▶▶▶ BecJT, replying to anon, 1, #1335 of 1428 🔗

That can’t be lawful either can it?

75434 ▶▶▶▶▶ JohnB, replying to Hubes, #1336 of 1428 🔗

I fear you can be.

I heard yesterday, I think on Anna Breese, about 2 cancer surgeons dismissed (GMC ? BMA ?) for speaking out.

75247 ▶▶▶ BecJT, replying to Hubes, 2, #1337 of 1428 🔗

Thanks! It is a disgrace, but the question is, is it a lawful one? I suspect not!

75209 ▶▶ RickH, replying to BecJT, 7, #1338 of 1428 🔗

A good letter, indeed. The only other question to ask might be how the ‘enforcement’ of face masks is justified in terms of the basic medical ethic of ‘Do no harm’.? This boils down to practical risk assessment, and in this case, benefits from mask wearing are assumed, not established, whereas the harms are clear in terms of discomfort and the impediment to normal breathing, with possible hypoxia and hypercapnia.

75244 ▶▶▶ BecJT, replying to RickH, 1, #1339 of 1428 🔗

Yep, I hope the implied question through the entire letter was that point! Absolute bastards! I’ve just written to Simon Dolan to ask if his lawyers would like to take this up.

75211 ▶▶ anon, replying to BecJT, 2, #1340 of 1428 🔗

wonderful!

let us know if they reply..

75218 ▶▶ Olive, replying to BecJT, 2, #1341 of 1428 🔗

The Care Quality Commission should also have this issue on their radar as it has a direct impact on a practice’s safety and responsiveness, not say their obligation to provide a caring service.

75241 ▶▶▶ BecJT, replying to Olive, 3, #1342 of 1428 🔗

Yes I might do them next, I think the rule on lack of visits was never ever law, so all those homes and hospices turning loved ones away did so with no legal standing whatsoever. In effect they kidnapped people’s relatives!

75249 ▶▶▶▶ bluefreddy, replying to BecJT, 5, #1343 of 1428 🔗

Well done BecJT!

75293 ▶▶▶▶▶ BecJT, replying to bluefreddy, 1, #1344 of 1428 🔗

I don’t know much about the CQC or what’s going on in their establishments so by all means let me know the key things I need to ask and I’ll go and jack russell them as well!

75321 ▶▶▶▶▶▶ Cheezilla, replying to BecJT, #1345 of 1428 🔗

Bec, you’re a star!

75255 ▶▶ p02099003, replying to BecJT, 4, #1346 of 1428 🔗

I am a nurse practitioner working in an urgent care centre, we are seeing patients face to face, the patients are usually booked in from their GP surgery either by receptionists or a GP following a telephone consultation. From a personal perspective I have sent photographs of skin disorders to my own GP via a secure website. There is also a secure link for video consultations. The big problem with the latter is that it needs a smart phone, which not everyone has.

75275 ▶▶▶ BecJT, replying to p02099003, 2, #1347 of 1428 🔗

That’s helpful, thanks, I’m still not sure it’s lawful though, on what legal basis are doctors not just booking appointments as normal? Access to technology is a massive equality issue for sure, hence my question about PSED. Lots of families only have internet access on one pay as you go phone with a data bolt on, it’s prohibitively expensive for them to access care in this way.

Is it all risk assessed? The clincher is in law covid is not a ‘risk’, so that should bugger up the risk assessments, vs the risks of not seeing patients properly.

75327 ▶▶▶ Cheezilla, replying to p02099003, 1, #1348 of 1428 🔗

And do you think that’s an acceptable way for GPs to “see” patients?

75365 ▶▶▶▶ p02099003, replying to Cheezilla, 1, #1349 of 1428 🔗

Short answer is no. I have made telephone consultations, only because the GP practices have told the patient it will be a remote consultation. If I have any concerns at all then I’ll try to get the patient in for face to face, but that isn’t always possible due to lack of my appointment slots! I am seeing quite a few people with chronic conditions that should be managed by their GP, so I refer them back telling them to make sure they speak to the GP. The Secretary of State for health has indicated that the current method of GPs seeing patients remotely is the way forward.

75319 ▶▶ Cheezilla, replying to BecJT, #1350 of 1428 🔗

That’s wonderful. Here’s hoping that, if they daren’t incriminate themselves in print by answering you properly, at least it pricks some consciences.

I suspect our best way to fight is by asking awkward questions.

75342 ▶▶ Carrie, replying to BecJT, 1, #1351 of 1428 🔗

Great letter – well done!

75198 Mibi, 4, #1352 of 1428 🔗

“A Catholic Writes”: I’d be interested in such a resistance group or an underground church! Have you (author of the article) joined the forum on Lockdown Sceptics?

75199 Hannahbanana, 3, #1353 of 1428 🔗

Second round of hassle-free mask-free shopping in lidl done. I was a little braver this time and used a trolley and took my time. I even spoke to staff, who sadly are now all wearing masks but didnt question me at all.
1 other mask-free shopper, another elderly lady using hers as a fetching chin strap! And saw at least 1 child masked up. Parents trying to normalise it before term rolls around. Good grief.

In the gym, we are almost completely mask free still – hallelujah!

75200 Mibi, replying to Mibi, 15, #1354 of 1428 🔗

There were many more people at the protest in Berlin than BBC reported.

500.000 were registered before the event. During the demo there were between 800.000 and 1.3 million present!

More info here (in German): https://youtu.be/WzWGk3MP8XE

75210 ▶▶ anon, replying to Mibi, 6, #1355 of 1428 🔗

impressive numbers!

is there any way to hold the bbc to account? or rid of them entirely. it is blatant propaganda.

75430 ▶▶▶ JohnB, replying to anon, -1, #1356 of 1428 🔗

Held to account ?

Ho ho, very funny. Of course not.

75272 ▶▶ Drawde927, replying to Mibi, 1, #1357 of 1428 🔗

Really encouraging, but I was disturbed to read that the German media were representing the protest in the same blatantly biased way as the UK media (labelling them as far-right extremists, underestimating numbers). There seems to be a lot more organised dissent in Germany, both from the public and professionals/scientists, but this doesn’t seem to translate to their media!

75274 ▶▶▶ anon, replying to Drawde927, 2, #1358 of 1428 🔗

all media are corrupt and most receive their scripts from a central ‘source’

75303 ▶▶▶ Bella, replying to Drawde927, 1, #1359 of 1428 🔗

Why would the German be less insidious than the UK media. They’re almost all multi-nationals these days

75608 ▶▶▶ Mark, replying to Drawde927, #1360 of 1428 🔗

German media were representing the protest in the same blatantly biased way as the UK media (labelling them as far-right extremists

I noted some time back that this is hopefully going to backfire on them badly in the longer term, because what they are doing is associating the hated (by the media classes) far right with the truth and with courage and common sense, on this crucial issue.

75214 duncanpt, replying to duncanpt, 4, #1361 of 1428 🔗

Do you think someone could point out to Boris & Co that no one ever wins at whack-a-mole?

75222 ▶▶ Tom Blackburn, replying to duncanpt, 6, #1362 of 1428 🔗

….and that the moles, if left to their own devices, actually go back into the hole of their own accord

75225 Lockdown Truth, replying to Lockdown Truth, 2, #1363 of 1428 🔗

Hi all

Still tweaking my idea.

Which do you like MORE?

WE WILL BE FREE

OR

WAKE UP BE FREE

Thanks

LT

75227 ▶▶ anon, replying to Lockdown Truth, 1, #1364 of 1428 🔗

WE WILL BE FREE!

would be my preference

75229 ▶▶▶ Lockdown Truth, replying to anon, #1365 of 1428 🔗

Thanks

75232 ▶▶▶▶ anon, replying to Lockdown Truth, #1366 of 1428 🔗

non Monsieur merci a vous!

75300 ▶▶▶▶ Bella, replying to Lockdown Truth, #1367 of 1428 🔗

Already taken by RDawg who has done a lot on this site and Twitter (and had the courage to post a photo of himself there with Dellingpole.) Please don’t queer his patch.

75262 ▶▶▶ Drawde927, replying to anon, 1, #1368 of 1428 🔗

Definitely agree – WE WILL BE FREE! is the one to go for.

WAKE UP BE FREE arguably has a rather lecturing/patronising tone to it (like the woke “educate yourself”, the other slogan is much more positive and all-embracing.

75281 ▶▶▶▶ Lockdown Truth, replying to Drawde927, #1369 of 1428 🔗

Thanks

75370 ▶▶ Alec in France, replying to Lockdown Truth, #1370 of 1428 🔗

What about

2 + 2 = 4 ?

Too subtle for most but once you are in the know…

Example: a local expat archery group called itself “Club 1346”. It took years before anyone French realised.

75228 EssieSW, replying to EssieSW, 12, #1371 of 1428 🔗

Just spotted this vomit inducing article on my web browser homepage:
https://www.msn.com/en-gb/lifestyle/style/a-parents-guide-to-kid-s-face-coverings-plus-28-to-shop/ar-BB16ZuH1?ocid=spartan-ntp-feeds

Highlights inldue:
The new government guidelines have stated that it’s compulsory for children over the age of 11 to wear a face mask in these spaces. But that doesn’t necessarily mean anyone younger shouldn’t be encouraged to wear one – you might be preventing the spread of a potentially deadly disease, after all”

“You might be surprised to hear that face masks aren’t currently required in schools.”

“You wouldn’t let your child ride a bike without a helmet, then why let them go out the house without a face covering? What’s important is not to get into confrontation and an argument.”

Very emotive and manipulative language to strike fear into parents.

Unfortuantley there is no comment section as I would be very interested to see how this piece was being received.

75233 ▶▶ Tenchy, replying to EssieSW, 6, #1372 of 1428 🔗

An iniquitous article. One of the worst I’ve seen in connection with the current hysteria.

75427 ▶▶▶ JohnB, replying to Tenchy, 2, #1373 of 1428 🔗

And that’s against some serious competition !

75234 ▶▶ anon, replying to EssieSW, 3, #1374 of 1428 🔗

MSN = microsoft – one of the tech giants authorised to spread ‘approved’ ‘news’ laced with NLP and propaganda

75236 ▶▶ RickH, replying to EssieSW, 2, #1375 of 1428 🔗

Well – that clears up one thig:

~ Big data/tech is indeed deeply complicit in promoting falsehoods about this political uinitiative.

75311 ▶▶ Cheezilla, replying to EssieSW, #1376 of 1428 🔗

That’s appalling!

75426 ▶▶ JohnB, replying to EssieSW, 2, #1377 of 1428 🔗

What’s important is not to get into confrontation and an argument.”

They are obviously concerned that discussion will put an end to their bollocks. 🙂

75231 Tenchy, replying to Tenchy, 19, #1378 of 1428 🔗

There are many good letters in The Telegraph today. Here’s one of them:

How to wear a mask

SIR – In April I visited my sister in hospital. She died the next day with Covid-19 and other serious illnesses.

On the ward I was given personal protective equipment and told by the staff that after 30 minutes I would have to change my mask (Letters, August 1). The doctor explained that after this time exhaled water vapour partly saturates the fabric, causing it to become ineffective. Germs also build up inside the mask, presenting a possible danger to oneself and others; oxygen intake is reduced, and more carbon dioxide is inhaled.

What of those encouraged to wear masks for long periods at work, in shopping malls and on long journeys?

James O’Brien
Ilkley, West Yorkshire

75269 ▶▶ DavidC, replying to Tenchy, 4, #1379 of 1428 🔗

Quite! I’ve posted a couple of comments here before about the tonnage of waste of masks. If 1 in 4 people in the UK wears ONE disposable mask a day and disposes of it at the end of the day it will produce about 64 TONS of waste face masks in ONE day! The amount of waste (masks, sanitiser bottles, wipes saturated with sanitisers, etc etc) is enormous.

DavidC

75310 ▶▶▶ DressageRider, replying to DavidC, #1380 of 1428 🔗

It makes me feel sick to think about it.

75240 Tom Blackburn, replying to Tom Blackburn, 10, #1381 of 1428 🔗

I visited the Imperial War Museum North on Saturday. On the whole it was a pleasing break from the norm and a good opportunity for my children to receive some form of education. Fairly quiet (which suits me) but not completely dead either. Around 60% masks vs non-mask wearers. Similar proportion amongst staff.

There is a section on propaganda and how British and German governments sent similar messages to their people. There was also a section on the threat of nuclear war and the associated advice to people – ‘duck and cover’ etc.

There appeared to be a worrying lack of self-awareness amongst our mask-wearing brethren whilst viewing/discussing these exhibits. I took the opportunity to loudly educate my kids that the (largely useless) messages and techniques used then bear a remarkable similarity to those being sent out now – ‘stay alert’ etc.

The kids get it and began mocking Boris by mimicking his slogans in a daft voice. Silence from all of those stood around including mask-wearing staff. Why?

75243 ▶▶ RickH, replying to Tom Blackburn, 7, #1382 of 1428 🔗

The ‘Why? is pretty obvious : nobody likes being called out for being a sucker. 🙂

75254 ▶▶▶ T. Prince, replying to RickH, 8, #1383 of 1428 🔗

They need to be called out. I’m on one of these local neighborhood apps and at the weekend some grown up child posted how she had walked her dog in the park and there were groups of yoofs standing together, no social distancing, no masks (??!!!) blah, blah. She received a lot of comments calling her out for being so hysterical which was quite reassuring given that commentators aren’t anonymous. I feel that people are no longer prepared to stand back and let bed wetters determine how the rest of us should lead our lives

75290 ▶▶▶▶ Bella, replying to T. Prince, 6, #1384 of 1428 🔗

They need to be called out, because they are complicit. In the old days they were called collaborators.

75309 ▶▶▶▶▶ Cheezilla, replying to Bella, 3, #1385 of 1428 🔗

Maybe we should revive the term and use it liberally as appropriate.

75246 Kev, replying to Kev, 6, #1386 of 1428 🔗
  1. Can the government, or health professionals give an exact figure of individuals who have died of Coronavirus, as opposed to those designated as dying with Coronavirus? Why were death certificates changed to allow merely the suspicion of Covid-19 infection, since when was this considered good medical practice? Because of this we can never know the true number of deaths due to the “pandemic”, and this will impact our ability to plan accordingly for future outbreaks.
  2. Can the government provide empirical evidence that the policy of lockdown has saved even one single life?
  3. How many people to date have died due to the policy of lockdown, due to non treatment of chronic illness, suicide or other causes not attributable to Coronavirus?
  4. Can the government provide the empirical evidence of the number of people who would have died had we not adopted lockdown and social distancing policies?
  5. Can the government provide the empirical evidence of the number of people who would have died had we sealed our borders and not locked down healthy individuals? Not predictions or extrapolations, but hard data.
  6. Can the government provide the empirical evidence that lack of social distancing measures in outdoor settings would have resulted in even one single infection?
75259 ▶▶ Steve Hayes, replying to Kev, 1, #1387 of 1428 🔗

You do realise that it is impossible to provide empirical evidence for something that has not happened?

75277 ▶▶▶ Kev, replying to Steve Hayes, 1, #1388 of 1428 🔗

Of course. But they should be able to provide empirical evidence for the course of action they followed. Imperial College are claiming their policy was a total success and the 500,000 deaths they predicted was avoided by lockdown policies, okay prove it!

75260 ▶▶ guy153, replying to Kev, 2, #1389 of 1428 🔗

The ONS do have a number for the number of death certificates where Covid wasn’t just mentioned but was also given as one of the causes of death. I think the total is about 1300 or so.

75280 ▶▶▶ Lockdown Truth, replying to guy153, 1, #1390 of 1428 🔗

Is that for real?

75283 ▶▶▶▶ JohnB, replying to Lockdown Truth, 2, #1391 of 1428 🔗

I did a post on this a while back that between March and the end of June according to the ONS figures COVID-19 was involved in only killed 1,901 people under the age of 80 (4,234 in total with people of 80) that had no pre-existing illness, and just 736 between 0-65.

75284 ▶▶▶▶▶ JohnB, replying to JohnB, 1, #1392 of 1428 🔗

Also, remember there is no autopsies being done so a lot of these could also have underlying illnesses but they will never be discovered.

75339 ▶▶▶▶▶▶ Carrie, replying to JohnB, #1393 of 1428 🔗

They also they removed the requirement of a second doctor to countersign the death certificate, because there is no going back on cremations for another check on cause of death…

75410 ▶▶▶▶▶▶▶ Keen Cook, replying to Carrie, #1394 of 1428 🔗

And I read the bodies were only released quickly if Covid was put on the death certificate (even if not confirmed) otherwise a long wait for grieving families.

75270 ▶▶ DavidC, replying to Kev, #1395 of 1428 🔗

Excellent!

DavidC

75304 ▶▶ Cheezilla, replying to Kev, #1396 of 1428 🔗

Lots of false premisses in your questions.

You can’t provide empirical evidence for something that might or might not have happened.

Your very first question assumes there will be future outbreaks.

75329 ▶▶▶ Kev, replying to Cheezilla, #1397 of 1428 🔗

I did address that point below, however the point is that the government and health “experts” are basing policy on unproven and unverified theories. There is no evidence that lockdown, social distancing, mask wearing or any other measures taken are effective at stopping the spread of this (or any) virus, but there appears to be circumstantial evidence that Countries like Sweden have seen a better outcome. Only when more data sets are available will we know for certain, although lets not hold our breath for honest reporting of that!

One thing we can take from this entire episode in insane government policy making is that there will be without any doubt future outbreaks, not necessarily of this virus, but of other future viral (or bacterial) outbreaks. Even if the government doesn’t want a lockdown, this has created a precedence, the Covid zealots will demand a similar or even more draconian response for the next disease, maybe even the next seasonal flu strain.

I despair at what I’ve witnessed out and about, people proudly wearing masks in the street like some badge of honour. We have become a cowed, fearful and suspicious country in just five months.

75384 ▶▶ RickH, replying to Kev, #1398 of 1428 🔗

Simple to answer : No to all.

… which is a big part of the problem.

75248 hotrod, 5, #1399 of 1428 🔗

This Global conspiracy idea. When you have governments of all types around the world how would that ever work?

While I agree with the huge overreaction and poor management by the government I can’t buy Left, Centre and Right parties all signing a secret pact to do the same thing.

World peace all of a sudden run by “Big pharma” or Mr Gates??? Really?

This approach undermines what most of us are standing for and I am pretty sure that Toby is not working to that narrative.

The WHO on the other hand I don’t trust, nor anyone who is going to work for them, e.g. Whitty and Hunter.

75250 The Boy From Ripon, replying to The Boy From Ripon, 1, #1400 of 1428 🔗

Does this mean that MP’s will be forced to stay at home, as many, including the PM, are over 50??

75258 ▶▶ guy153, replying to The Boy From Ripon, 1, #1401 of 1428 🔗

Unfortunately he “works” from home anyway.

75296 ▶▶ Cheezilla, replying to The Boy From Ripon, #1402 of 1428 🔗

Not forced. They’ve already been paid £90k this year to stay at home.

75256 swedenborg, 4, #1403 of 1428 🔗

Boris threats to the pubs
https://www.bag.admin.ch/bag/fr/home/das-bag/aktuell/news/news-02-08-2020.html
 After a relentless campaign blaming bars, restaurants and clubs for the resurgence of Covid-19 in Switzerland, the Swiss government issued a clarification those represented ~3.5% of transmissions, with the highest proportion within households 27,2%(BTW Schools 0.3%)

75263 Sam Vimes, 1, #1404 of 1428 🔗
75264 Tim Bidie, replying to Tim Bidie, #1405 of 1428 🔗

Brilliant article by Tim Stanley in The Daily Telegraph:

‘….a new model of social organisation was emerging: therapeutic authoritarianism.’

He may have captured the zeitgeist in two words….

https://www.telegraph.co.uk/news/2020/08/02/cure-irrational-covid-fear-healthy-dose-conservatism/

75276 ▶▶ Carrie, replying to Tim Bidie, 14, #1406 of 1428 🔗

Good comment I just read from DT comment article.

‘Boris, please note not all of us get our news from the biased mainstream media or the internet companies who think they are the only arbiters of facts (Google, Youtube, Facebook, Twitter banning doctors tells us all about the hidden agendas,).
We have figured out this is a mild disease, the hospitals are empty, Doctors are being banned from talking about HCQL as a cure or supressant, and muzzles are not for supressing the disease. They are of course for control. If they were a genuine necessity, you’d specify the type. At the moment, a paper bag will do.
I am over 50, I pay a lot of tax. Come for me and my company is leaving the UK.
Every day more and more are waking up. You really will wet the bed the day you realise its a significant number that know you’ve been lying to us.
Media coverage of the march in Germany against lockdowns this weekend? Where is that?’

People are waking up!

75279 ▶▶▶ Carrie, replying to Carrie, 4, #1407 of 1428 🔗

This comment made me laugh:

‘So the only way for us over 50’s will be to go out in disguise – mask, dark glasses, wig, jeans barely held up, undies showing, speaking blaccent and using the word ‘like’ six times in every sentence. May need to get a fake ID as well.’

75287 ▶▶▶ Bella, replying to Carrie, #1408 of 1428 🔗

If in DT can you post a link?

75289 ▶▶▶ Cheezilla, replying to Carrie, 1, #1410 of 1428 🔗

That’s why they’re preparing to bring in the troops.

75593 ▶▶▶▶ JohnB, replying to Cheezilla, #1411 of 1428 🔗

?

75288 ▶▶ Cheezilla, replying to Tim Bidie, 1, #1412 of 1428 🔗

Covid has brought home the importance of spiritual necessities like friendship, good food, travel or faith. The Tories should put themselves firmly on the side of those things and become, unashamedly, the party of joy.

Well they’re certainly the party of fear and separation at the moment!

75298 ▶▶ stefarm, replying to Tim Bidie, #1413 of 1428 🔗

Good to see the contributors have sussed out ‘notre dame’ is from our friends in the 77th brigade.

75265 p02099003, 1, #1414 of 1428 🔗

https://www.bbc.co.uk/news/uk-53632043 90 minute tests, testing for a large number of viruses, detecting DNA of SARS-COV-2 after converting the RNA to DNA.

75273 Basics, replying to Basics, #1415 of 1428 🔗

Government propaganda at the daily mail. UK Column today covering the war-like language and NLP being used in government propaganda.

https://www.dailymail.co.uk/news/article-8572833/Worrying-staying-safe-army-health-professionals-working-scenes.html

Ukcolumn.org
Live now.

75282 ▶▶ Cheezilla, replying to Basics, 1, #1416 of 1428 🔗

If you missed it live, the UKC broadcast is available on demand shortly after. Always worth watching.

75291 Cheezilla, replying to Cheezilla, 2, #1417 of 1428 🔗

Looking at the headlines this morning, it struck me that there doesn’t really seem to be any news.

Do you think the over 50s baloney is a red herring? Need to keep our ears to the ground more than ever!

75295 ▶▶ Bella, replying to Cheezilla, 1, #1418 of 1428 🔗

It’s the silliest of silly seasons

75325 ▶▶ RickH, replying to Cheezilla, 2, #1419 of 1428 🔗

One analysis is that it’s a canary – to see what public response is as a help to gauge how far to go with more repression.

75355 ▶▶▶ Tenchy, replying to RickH, 1, #1420 of 1428 🔗

Almost certainly.

75429 ▶▶ Polemon2, replying to Cheezilla, 1, #1421 of 1428 🔗

It better be!!!!

75294 Bella, 4, #1422 of 1428 🔗

Someone must have asked and maybe even answered this question before because it’s too obvious, but I’m still going to post. If Bill Gates is such a wizard at fighting viruses why is his software riddled with them? My peace of mind has been shattered by his shit show scores of times over the years. Where’s your vaccine for that Bill?

75302 mjr, 1, #1423 of 1428 🔗

MONDAY’S PAGE HAS SNEAKED UP ON US
https://lockdownsceptics.org/2020/08/03/latest-news-93/#respond
Dont forget to take your bags with you when you leave

75323 ▶▶ RickH, replying to stefarm, 5, #1425 of 1428 🔗

Indeed. The real kicker is the ‘Critical Care Bed’ occupancy graph. Think of it every time you hear bollocks about ‘Save Lives’!

75316 Bella, replying to Bella, 8, #1426 of 1428 🔗

I saw a disturbing thing on Countryfile last night (I know BBC but I was in a neighbour’s flat). This Coronabollocks is killing the independent brewing industry, something like 60 million tons of hops are going begging because no-one’s buying. Millions of gallons of beer being thrown away. Like everything else this Lockdown only benefits the multinationals and speaking as an ex-member of CAMRA I’m dreading going back to that ghastly keg ale whcih all tastes like communal piss. Double Diamond (does not) work wonders. Beer, not tea, is the national drink of this country and we have some fantastic independent producers. One hop grower said it if goes under it will never recover. For this offence alone Johnson should be…urgh, aaargh, errgh!!!!!

75428 ▶▶ Polemon2, replying to Bella, #1427 of 1428 🔗

greed, but then if you know you won’t be able to sell it, why make it? (The beer that is)

75437 Alec in France, 2, #1428 of 1428 🔗

Just read some hints in our regional French newspaper on mask wearing in heatwave conditions.

They recommend (with no apparent irony) choosing ‘breathable fabrics’.

Hardly any seriously negative comments.

The Brits here are even worse:

Met a fellow sceptic couple yesterday.

They are having to keep quiet when meeting other expats, 95% of whom have swallowed all the psyop baloney, won’t listen to any counterarguments, are dutifully wearing their muzzles (probably even in bed?) and ‘can’t wait for things to go back to normal when we get the vaccine’.

Non sperandum est.

Users

213 users made 1,378 comments today.

LikesUserPostsReplies
258Farinances3, 3, 4, 2, 8, 2, 0, 0, 2, 15, 15, 6, 5, 6, 9, 1, 3, 6, 7, 9, 8, 5, 5, 0, 12, 2, 0, 2, 0, 6, 4, 2, 10, 3, 4, 1, 3, 8, 2, 6, 0, 6, 0, 2, 0, 0, 2, 3, 1, 3, 1, 0, 10, 6, 4, 2, 2, 3, 3, 6, 6, 6, 2, 1, 0, 0
237BecJT131, 9, 7, 5, 5, 1, 1, 2, 2, 1, 5, 5, 4, 12, 3, 4, 6, 6, 3, 8, 7, 18, 9, 1, 4, 4, 5, 10, 6, 1, 2, 3, 1, 29, 6, 1, 2, 1, 3, 1, 2
231RickH5, 33, 6, 2, 3, 1, 9, 1, 7, 3, 2, 7, 11, 7, 6, 3, 5, 6, 3, 3, 3, 0, 3, 3, 1, 2, 10, 2, 15, 0, 3, 7, 2, 1, 2, 2, 3, 1, 3, 6, 5, 2, 9, 7, 2, 7, 0, 2, 5
220Carrie7, 7, 0, 0, 4, 4, 0, 5, 1, 1, 0, 2, 0, 0, 3, 1, 2, 0, 1, 0, 2, 4, 3, 2, 8, 1, 6, 2, 2, 0, 1, 1, 4, 2, 2, 2, 1, 3, 2, 3, 0, 3, 1, 0, 0, 8, 1, 3, 12, 3, 1, 4, 6, 5, 0, 0, 0, 5, 1, 1, 2, 5, 1, 1, 7, 4, 5, 3, 0, 0, 12, 4, 5, 1, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 14, 4, 0
182Awkward Git6, 3, 10, 5, 2, 0, 0, 71, 10, 2, 0, 50, 11, 12
144A. Contrarian14, 3, 2, 2, 1, 18, 3, 2, 8, 1, 3, 11, 4, 3, 4, 3, 3, 2, 5, 0, 0, 2, 4, 3, 7, 0, 4, 0, 1, 6, 1, 1, 4, 3, 0, 3, 1, 1, 1, 10
144Nick Rose6, 0, 0, 6, 4, 1, 2, 1, 10, 1, 0, 1, 3, 10, 1, 5, 0, 1, 1, 0, 1, 1, 1, 3, 1, 3, 2, 1, 4, 17, 13, 11, 6, 6, 0, 7, 3, 2, 7, 1, 1
142kh14854, 5, 9, 8, 2, 58, 8, 4, 1, 6, 5, 10, 5, 3, 1, 2, 0, 1, 4, 3, 3
130IMoz5, 18, 2, 7, 0, 17, 1, 0, 1, 3, 7, 6, 6, 2, 2, 7, 2, 1, 1, 8, 4, 1, 8, 0, 4, 1, 3, 3, 0, 1, 0, 4, 3, 0, 1, 0, 0, 1
129MiriamW-sometimes-AlanG3, 31, 7, 0, 2, 9, 1, 18, 0, 21, 3, 1, 9, 0, 2, 2, 1, 1, 3, 3, 0, 0, 0, 3, 6, 3
118Dave #KBF30, 8, 1, 8, 7, 2, 3, 4, 14, 5, 9, 12, 2, 8, 4, 1
100anon13, 9, 2, 5, 29, 13, 1, 10, 0, 0, 0, 1, 3, 0, 0, 2, 4, 2, 1, 2, 6, 2, 1, 0, 3
99guy1534, 1, 0, 20, -1, 11, 2, 0, 2, 3, 7, 1, 1, 4, 3, 0, 0, 0, 2, 1, 1, 7, 2, 3, 6, 0, 10, 3, 3, 2, 1
97swedenborg5, 7, 46, 11, 26, 17, 5, 4, 8, 2, 2
94Barney McGrew2, 0, 14, 38, 2, 9, 7, 0, 0, 4, 7, 5, 6
93OKUK15, 1, 3, 6, 2, 0, 16, 4, 0, 5, 1, 1, 6, 1, 9, 4, 9, 4, 6
91annie2, 2, 4, 4, 1, 5, 5, 30, 7, 2, 5, 0, 5, 0, 1, 6, 3, 2, 7, 0, 0
88Sam Vimes6, 16, 4, 10, 12, 3, 4, 2, 7, 1, 18, 3, 6, 2, 3
87Cheezilla2, 0, 2, 0, 1, 2, 1, 2, 3, 3, 1, 3, 1, 0, 1, 0, 1, 1, 10, 0, 2, 2, 1, 2, 0, 0, 2, 2, 4, 0, 11, 5, 4, 4, 2, 0, 0, 2, 1, 0, 0, 1, 0, 0, 3, 0, 0, 1, 1, 1, 2
86Harry hopkins43, 11, 0, 21, 11
85Lockdown Truth21, 3, 1, 5, 7, 1, 1, 0, 4, 1, 11, 19, 2, 1, 2, 1, 0, 2, 2, 0, 0, 1
70Margaret10, 4, 6, 1, 0, 3, 4, 32, 7, 3
70Bart Simpson0, 4, 1, 0, 5, 2, 0, 6, 9, 10, 8, 3, 1, 0, 6, 5, 0, 0, 2, 4, 1, 0, 3
70Bella45, 1, 10, 3, 4, 5, 3, 4, 6, 1, 2, 4, 1, 0, 1, 0, 1, 0, 6, 0, 1, 8
67stefarm0, 3, 0, 11, 47, 4, 0, 0, 2
67Major Panic5, 2, 4, 7, 2, 5, 7, 1, 2, 4, 2, 0, 0, 0, 0, 1, 1, 1, 0, 7, -1, 13, 0, 1, 0, 1, 2
65Bella Donna8, 0, 2, 7, 22, 1, 10, 4, 11
62Basics67, 7, 15, 1, 5, 0, 1, 2, 1, 0, 1, 1, 6, 5, 4, 0
60Tenchy08, 1, 7, 8, 2, 6, 2, 6, 19, 1
59Tom Blackburn22, 7, 1, 0, 10, 3, 6, 10
57Tyneside Tigress19, 12, 12, 2, 7, 1, 4
55Paul24, 13, 18
55Achilles6, 3, 1, 6, 0, 18, 7, 14
54wendy23, 2, 4, 3, 4, 6, 2, 6, 2, 2
51Dan Clarke15, 0, 13, 2, 5, 5, 3, 1, 3, 1, 12
50nat19, 8, 12, 6, 5
50Darryl7, 10, 3, 4, 10, 12, 4
49DRW5, 14, 2, 3, 7, 4, 0, 2, 3, 3, 6
48Julian4, 18, 13, 13
48Drawde92711, 7, 2, 9, 7, 5, 5, 0, 1, 1
46bluemoon4, 4, 5, 8, 2, 5, 0, 1, 1, 10, 2, 2, 2
45richard riewer3, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 2, 0, 0, 2, 1, 1, 0, 1, 0, 8, 0, 0, 1, 0, 0, 0, 11, 2, 0, 2, 3, 7
39Mr Dee3, 3, 6, 0, 2, 7, 9, 9
37Bruno2, 1, 0, 8, 5, 0, 6, 2, 1, 10, 0, 2
34John Ballard34
34DocRC0, 34
34RichardJames3, 4, 3, 0, 21, 3
34Hubes3, 15, 1, 1, 0, 0, 1, 1, 10, 2
34Jay Berger115, 1, 1, 1, 4, 3, 1, 1, 5, 1
32Northern Chubs32, 0, 0
31AngloWelshDragon0, 31
31NickR6, 1, 21, 3
30Kate0, 30
29Toby Pierides18, 9, 2
29Bugle1, 2, 5, 1, 4, 0, 1, 15
28ChrisDinBristol28, 0
28mjr10, 9, 1, 4, 7, 3, 3
28Lili1, 0, 2, 3, 0, 0, 3, 6, 3, 1, 1, 8
27Poppy26, 1
27Ned of the Hills20, 0, 7
26T. Prince3, 09, 4, 2, 8
24Doodle24
24wendyk24
24Lms237, 4, 1, 1, 3, 2, 1, 3, 2
24Mark4, 4, 1, 5, 1, 3, 1, 3, 1, 0, 1, 0
23Humanity First16, 2, 4, 1
22Cruella19, 3
22IanE17, 4, 1
22Mibi3, 415
22Kev15, 6, 1, 0
21Lisa from Toronto5, 15, 1
21Victoria1, 8, 8, 4
20Olive18, 2
20Xenophanes17, 1, 2
20Jonathan Palmer7, 3, 5, 5
19Templeton10, 9, 0
19JulieR4, 1, 1, 1, 12
19Sarigan9, 2, 3, 1, 1, 0, 3
17profund chap17
17Edna16, 1
17mhcp7, 10
17Andy C14, 0, 3
17Country Mumkin2, 2, 4, 9
16fiery16
16bluefreddy11, 5
16Ewan Duffy15, 1
16Hoppity12, 4
15Lorenzo Basso15
15Howie597, 8
15PoshPanic5, 5, 1, 1, 3
14Steve Martindale14
14BTLnewbie3, 0, 1, 1, 9
14Cicatriz5, 0, 0, 3, 1, 5
14Kath Andrews0, 5, 0, 3, 3, 2, 1
13Wesley13
13Eddie0, 1, 4, 8
12EssieSW12
12tonyspurs12
12Stephen7, 5
12GLT0, 4, 6, 2
12janis pennance3, 2, 6, 1
12PD46, 1, 1
11tallandbald11
10PowerCorrupts73
10hotrod53, 2
10James0076, 2, 2
10TheBluePill2, 3, 5
10DavidC0, 0, 3, 0, 1, 0, 2, 4, 0
9GrowYourOwn9
9Jenny9
9sarnskeptic9
9nfw0, 9
9Nobody20200, 0, 0, 9
9DoesDimSyniad0, 4, 2, 1, 2
9Tim Bidie0, 0, 4, 3, 0, 1, 0, 0, 1, 0
8JYC8
8Kelly deacons8
8LuluJo8
8AllieT7, 1
8Ethelred the Unready53
8smileymiley5, 3
8Fed up8, 0, 0
8Richard3, 3, 1, 1
7dpj7
7Hammer Onats7
7John Ballard7
7DressageRider0, 0, 2, 0, 1, 4, 0
6Bazza6
6BobT6
6Jonathan Castro6
6Martin Byrne6
6Old Mum6
6Rick6
6Biker6, 0
6TJN2, 4
6p0209900314, 1
6Binra0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 2
5anti_corrup