2020-10-14

Sourcehttps://lockdownsceptics.org/2020/10/14/latest-news-162/
Published2020-10-14T08:15:47
Last updated2020-10-14T13:44:03
Scraped2020-12-20T20:18:07
Articles14
Comments2,327
Users320

Articles

Comments

185628 stefarm, replying to stefarm, 3, #1 of 2327 🔗

1st the worst

185795 ▶▶ Sir Patrick Vaccine, replying to stefarm, 3, #2 of 2327 🔗

Piers Corbyn on setting up anti lockdown groups #OurMovement Action Groups

https://www.youtube.com/watch?v=t3hC7nEp-v4

youtube com/watch?v=t3hC7nEp-v4

187543 ▶▶▶ Sir Patrick Vaccine, replying to Sir Patrick Vaccine, #3 of 2327 🔗

Is the ‘cure’ worse than Covid? Driven to despair by lockdown, two of Professor Angus Dalgleish’s colleagues took their own lives… and compelled him to join a growing rebellion against Cromwellian restrictions
Cancer specialist says he has been lost two colleagues to suicide in two weeks
One ‘killed himself as result of profound despair at loneliness created by Covid’
Prof Angus Dalgleish says focus on Covid-19 is ‘distorting healthcare priorities’
Daily Mail news/article-8824833/Lockdown-despair-drove-two-Professors-lives.html
https://www.dailymail.co.uk/news/article-8824833/Lockdown-despair-drove-two-Professors-lives.html

185804 ▶▶ Jpeg, replying to stefarm, 3, #4 of 2327 🔗

Scientific Pandemic Influenza Group on Modelling” … should someone tell them this isn’t influenza?

185882 ▶▶▶ Country Mumkin, replying to Jpeg, 1, #5 of 2327 🔗

I’d have thought they will be rebranding the flu

185972 ▶▶▶ Rowan, replying to Jpeg, 9, #6 of 2327 🔗

Who says it is isn’t influenza? There is no proper evidence to suggest otherwise.

186076 ▶▶▶ RichT, replying to Jpeg, 4, #7 of 2327 🔗

The medical definition of flu is an “Influenza like illness” or ILI. Coronavirus is definitely an ILI.

186951 ▶▶▶ caipirinha17, replying to Jpeg, 2, #8 of 2327 🔗

Funny, we seem to have a Deputy CMO who is a specialist in… influenza… who better to convince us that it’s absolutely definitely not that?

185983 ▶▶ OKUK, replying to stefarm, 1, #9 of 2327 🔗

You’d be sickened to be second.

186743 ▶▶ Sir Patrick Vaccine, replying to stefarm, 2, #10 of 2327 🔗

Great Barrington Declaration co-author:

Dr Jay Bhattacharya, co-author of the Great Barrington Declaration: “The current lockdown strategy seeks herd immunity. That is the end point. The question is how much death and suffering will there be in the meantime?”

By the way there is appalling clip of Hancock dismissing the Great Barrington Declaration

14 Oct 2020
https://www.youtube.com/watch?v=ivVuUqLDqAk

186812 ▶▶▶ Adam, replying to Sir Patrick Vaccine, 1, #11 of 2327 🔗

Hancock is not qualified to so arrogantly dismiss these esteemed individuals who have knowledge Hancock worked in the cesspit called the city of london before politics

185631 smileymiley, 1, #12 of 2327 🔗

Bah! Missed by a squeak 😱

185634 The Spingler, 1, #13 of 2327 🔗

Almost!

185981 ▶▶ Jo, replying to FenTyger, #15 of 2327 🔗

Anyone got a copy of this to avoid paywall? Thanks

186538 ▶▶▶ Cheezilla, replying to Jo, 8, #16 of 2327 🔗

It’s an excellent article. Worth reading in full. Here are some bits:

‘Do no harm’ are three words all doctors must follow in the course of their work. These words make me convinced that Covid-19 lockdowns are the wrong approach, and a growing number of doctors are on my side.

…. If lockdowns were a prescription drug for Covid-19 treatment, the FDA would never have approved it.

…. In August, the Lancet published an analysis of data from 50 countries. The researchers found that full lockdowns were ‘not associated’ with decreased mortality from Covid-19.

…. if a physician were to prescribe a lockdown to a savvy patient who asked about the risks, the physician would have to disclose that depression, suicide, homicide, overdose, wife-beating, and starvation are potential side effects. Rare is the patient who would agree to take such a pill, which brings me to the other pillar of medical ethics: autonomy. Physicians do not force treatment on competent, non-consenting patients…..

185640 Awkward Git, replying to Awkward Git, 13, #17 of 2327 🔗

Not even on the podium.

Found this from March 2020:

https://www.reuters.com/article/us-usa-stocks-shortselling-idUKKBN21811E

Someone made a hell of a lot of money just before everything shut down.

Insider dealing trials coming up?

Good thing – on the Daily Wail’s website, not one complimentary comment about Boris or Kier.

Very hostile and sceptic.

185705 ▶▶ karenovirus, replying to Awkward Git, #18 of 2327 🔗

Reuters behind a paywall

185715 ▶▶▶ chaos, replying to karenovirus, 1, #19 of 2327 🔗

There’s a firefox app that gets round any paywall.. seek and ye might find.

185751 ▶▶ Nobody2020, replying to Awkward Git, 1, #21 of 2327 🔗

There were a few memebers of US congress being investigated for potential insider dealing a few months ago for doing just this.

185855 ▶▶ Cruella, replying to Awkward Git, 24, #22 of 2327 🔗

While this makes me feel better, knowing that people aren’t fooled it also makes this all more depressing because we still can’t change anything. I mean the casual dismissal of the Barrington Declaration in governement, simply shrugged off in the most idiotic manner indicates there’s nothing we can do. Even the WHO asking nations not to lockdown isn’t enough to compel the politicians. There seems to be no way out until they decide it is over. This has to be about something else.

186370 ▶▶▶ janeinthemindfield, replying to Cruella, 19, #24 of 2327 🔗

There are things we can do. We can change things. We are going to have to give it our all. Obviously writing to MPs etc. We can also refuse to comply with the restrictions and all associated fines etc. We need to engage, persuade and explain to people what is really going on at every opportunity and illustrate why these restrictions are utterly disproportionate. I was heartened to hear about the man running the gym who said he would defy the lockdown and stay open. We need more of this type of steady defiance as well as persuasion. If we all refuse to comply, they cannot keep it going.

To me, this whole covid debacle is an illustration of how ‘the pen is mightier than the sword.’

People comply because they believe the rhetoric and propaganda.

We have to make an almighty effort to clarify, refute, reframe and persuade.

We have to get out there and engage in person, on Twitter, on the Guardian blogs where everyone believes the polar opposite to us (and where I am currently being pre-moderated for saying a week or so before the Barrington Declaration that ‘we should support and shield the elderly and vulnerable if they want to be shielded and let the young catch it’.).

It is worth remembering that they are as terrified as we are. We are terrified of the implications of this utterly disproportionate global reaction to a mild virus, they are terrified of sickness and death of themselves and their loved ones. We share this in common with them.

Hello everyone. I come here for sanity, information and comfort every day. My wifi is usually off by then tho, so I have only tried to comment once (when my guardian stuff was deleted to complain about censorship and control of the narrative by msm. I do not know where that comment went, but anyway, here i am again.

We are going to have to fight this, because it is massive and Global and there is no other way out. I have been searching for a way out for myself and my family for months and cannot see any way out. We have to meet and plan and group together. We cannot just do this online.

If we lose, we are basically leaving our children to a totalitarian prison planet digital dystopia.

I was in Homebase this morning, had a chat to 2 different staff. One of them said its like an open prison in the North and hethinks its all disproportionate. The other looked really scared and said none of it makes sense and how massively its impacting everything.

People are waking up. They are shell shocked and dont know what to do.

Did anyone see the article in the Mail yesterday about the women in France labouring and giving birth in masks. Sickening cruelty. Total abuse. Terrifying.

I hope this comment gets posted!

186512 ▶▶▶▶ janeinthemindfield, replying to janeinthemindfield, 8, #25 of 2327 🔗

Another thought I had recently and wanted to post on here was this. I am not putting it very well, but in regards to making people feel guilty/criminalised for perfectly normal, human behaviour -e.g. ‘stay at home, dont kill granny,’ etc., using guilt to manipulate particularly the young for needing to socialise etc.

Frustrating this perfectly natural drive in the young to socialise is real cruelty. It will inflict a psychological wound. This precious time will not come back and its harder later…

A parallel for this guilt tripping occurred to me… despite being a Catholic convert, I am aware that in the past, Catholic teaching of sin and guilt for perfectly normal behaviour, i.e. sexuality etc was used to control behaviour. People ended up with really warped attitudes to sexuality etc.

Its a nasty manipulation.

If anyone can summarise this guilt tripping into a snappy soundbite, referencing religion that would make it easier to call out! Society nowadays is so secular that anything associated with religion is smeared by association!

186567 ▶▶▶▶▶ Cheezilla, replying to janeinthemindfield, 4, #26 of 2327 🔗

Good points! It’s definitely been a very effective PsyOp. It’s become so blantant that people are seeing it for what it is.

It’s important not to feel disempowered. Passive disobedience wherever possible is a good start.
Demonstrate genuine normality – wear your smile. Look people in the eye.

Talk to those who’ll listen. They might already be awake but need to know they’re not on their own.

187145 ▶▶▶▶ Nick, replying to janeinthemindfield, 4, #27 of 2327 🔗

Quote From the Spectator article. This puts to bed any idea that lockdown is saving granny.

“ I have personally admitted dozens of elderly people to hospital with illness resulting from social isolation and neglect. Some were literally starving to death. One patient, in her eighties, lived in a retirement community but relied on family members to feed her meals. When they were socially distanced (banned) from the premises, she couldn’t feed herself and her health quickly deteriorated. Another patient, a 92-year-old woman, simply gave up on life and started refusing her meals once her family stopped coming to visit. Both these scenes were catastrophically inhumane and will stick with me for a long time. Neither is captured in the government’s Covid-19 statistics.”

These people are being harmed and killed by the government.

https://www.spectator.co.uk/article/a-medic-s-case-against-another-lockdown

187332 ▶▶▶▶▶ janeinthemindfield, replying to Nick, 3, #28 of 2327 🔗

The abuses being inflicted on every section of society, from imprisoning kids on their first time away from home at university to criminally denying the elderly the love and comfort of their families in their last months and years of life, as well as the smashing of businesses which often constitutes people’s life’s work, denying care to the sick… the insane incursions into every aspect of people’s lives and liberties etc etc gives me a chill… it reminds me of the abuse psychopaths inflict on their victims before they murder them…

186550 ▶▶▶ Cheezilla, replying to Cruella, 1, #29 of 2327 🔗

Watch UK Column!

187827 ▶▶▶ Adam, replying to Cruella, #30 of 2327 🔗

There is something we can do that is stop simply complying with this nonsense https://www.remove-the-tory-government.org

185642 RyanM, replying to RyanM, #31 of 2327 🔗

6th is just 5th last place… Oh, well.

185706 ▶▶ karenovirus, replying to RyanM, 2, #32 of 2327 🔗

1st was all that mattered to the Greeks.

185785 ▶▶ Country Mumkin, replying to Mabel Cow, 8, #34 of 2327 🔗

Mabel this is great. I love it. I’m going to get stickers printed.

186007 ▶▶▶ Mabel Cow, replying to Country Mumkin, 6, #35 of 2327 🔗

Do you have a fighting fund that I can contribute to?

I don’t feel like I’m doing enough, but other than hacking away at posters, I don’t know what to do for the best.

186571 ▶▶▶▶ Cheezilla, replying to Mabel Cow, 2, #36 of 2327 🔗

You’re doing a great job!

185646 nickbowes, replying to nickbowes, 32, #37 of 2327 🔗

So Labour want to continue the trashing of livelihoods, jobs and dreams – what a surprise !
Kier is probably owned, like the idiot Tories, by the Davos set. Young people party and rebel !

185716 ▶▶ chaos, replying to nickbowes, 6, #38 of 2327 🔗

He’s on Trilateral Commission.

185741 ▶▶▶ Awkward Git, replying to chaos, 8, #39 of 2327 🔗

Says it all along with being ex-head of the CPS.

187497 ▶▶▶▶ Exiled off mainstreet, replying to Awkward Git, 1, #40 of 2327 🔗

As part of the instigatgion of the criminal Assange persecution in this role, he has already marked himself out as an enemy of the people. He is a restoration of Bliar’s neutering of the opposition, creating a one party state in Britain.

185650 Jim, replying to Jim, 4, #42 of 2327 🔗

Can anyone help me if I’m asked at or before a job interview why I’m not wearing a mask?
I didn’t write down on my application I had any disabilities so I’m wondering if I’ve got myself in a pickle and am lowering the chance of being offered a job?
Thank you!

185688 ▶▶ Mabel Cow, replying to Jim, 4, #43 of 2327 🔗

If you feel you have to say anything, you can use low mood .

My advice would be to present them with a printout of my discriminatory challenges document and say nothing more on the subject.

185719 ▶▶▶ matt, replying to Mabel Cow, 5, #44 of 2327 🔗

Unfortunately I think this is the wrong decision and that the only actual course of action is to wear a mask if asked to (@Jim – have they told you you need to?). Having ticked the “no disabilities” box, you’ll be on shaky ground, I would have though and showing them legal documentation at an interview is immediately going to mark you out as litigious.

If it were me, I think this is one of the very few circumstances where I would bite the bullet and wear a mask. I can’t think of another circumstance in fact.

185749 ▶▶▶▶ Mabel Cow, replying to matt, 1, #45 of 2327 🔗

Sadly, I agree.

185757 ▶▶▶▶ Jim, replying to matt, 2, #46 of 2327 🔗

There was no indication or anything about wearing a mask but, you know, these days the world has tilted on its axis!

185767 ▶▶▶▶▶ matt, replying to Jim, 4, #47 of 2327 🔗

Well, they’re not compulsory in offices, so hope for the best. Personally, I wouldn’t want to make any hiring decisions without seeing the person’s face in an interview – but then again, I’m not pro-mask.

You may very well not be asked to wear one, but I’m sorry to say that, – in my opinion – if you want the job, you probably should if they ask you to. Only you can know how much you need/want this particular job.

185871 ▶▶▶▶ Miss Owl, replying to matt, 2, #48 of 2327 🔗

Thre is no disabilities box. Illegal to ask.

185892 ▶▶▶▶▶ matt, replying to Miss Owl, 1, #49 of 2327 🔗

Yes and no. Assuming there was one, it will probably have been part of a survey relating to candidate diversity. In addition, several companies have a policy of always offering an interview to people with disabilities. As long as you aren’t obliged to provide the information, but you’re given the opportunity to volunteer it, it’s fine and not uncommon practice.

185911 ▶▶▶▶▶▶ Miss Owl, replying to matt, 1, #50 of 2327 🔗

Fair enough. I just wonder why this same person is back again, having been given masses of advice by many of us previously. Perhaps he didn’t get the response he was trying for and is having another go.

185930 ▶▶▶▶▶▶▶ matt, replying to Miss Owl, 1, #51 of 2327 🔗

I can understand the anxiety. A job interview is a stressful thing anyway and having to balance a principled stand against masks with your livelihood makes it more so.

186677 ▶▶▶▶▶▶▶ Jim, replying to Miss Owl, #52 of 2327 🔗

What’s wrong with that Suey? Just scroll past. I have lost my business and am crossing my fingers for a part time cleaning job. I don’t want to f**k it up and I also don’t want to wear a mask. Have you ever asked and clarified and reclarified a question?????

186916 ▶▶▶▶▶▶▶▶ Miss Owl, replying to Jim, #53 of 2327 🔗

I apologise, of course. Nothing’s wrong with that.

And nothing’s wrong with a cleaning job; you were the one yesterday saying “it’s only” a cleaning job. I wish you luck in your interview, and my advice stands, for what it’s worth: wear a lanyard as a courtesy and, if they ask, tell them you are exempt and explain that your inability to wear a mask would not prevent you doing the job. If they ask WHY you are exempt, reply courteously that you don’t wish to discuss it further.

Or, of course, you could wear a mask if you wish, if you think it might be more likely to get you the job; then decide that droplets and aerosols from cleaning fluids getting on to the mask are causing you issues so you can’t wear one while doing the job. Your choice entirely.

Again, I wish you luck, and please do come back and let us know how you get on.

186111 ▶▶▶▶▶▶ Sophie123, replying to matt, 2, #54 of 2327 🔗

But a disability that might prevent mask wearing (eg panic attacks, asthma) isnt one I would think of to fill in on an employment form (wheelchair user, registered deaf or blind) as under normal circumstances they would not require any special accommodation in an office-type setting.

185966 ▶▶▶▶ stewart, replying to matt, 3, #55 of 2327 🔗

Why not claim that wearing a mask provokes anxiety and that you’ve been advised not to wear one.

That isn’t a disability anymore than, say, an adverse reaction from taking anti-malarial medication as a preventative measure.

Under normal circumstances, you don’t have a disability. If they force you to do something unnatural, like wear a mask, then you have an adverse physical reaction.

Perfectly legitimate.

186585 ▶▶▶▶▶ Cheezilla, replying to stewart, #56 of 2327 🔗

Isn’t a common qualification “the ability to work under pressure”?
Being susceptible to anxiety wouldn’t do you any favours!

186113 ▶▶▶▶ Nsklent, replying to matt, 1, #57 of 2327 🔗

Or wear a loose scarf if it less oppressive.

186291 ▶▶▶▶ Chris John, replying to matt, 1, #58 of 2327 🔗

Asthma isn’t a disability and a valid medical excuse

185724 ▶▶▶ Victoria, replying to Mabel Cow, 4, #59 of 2327 🔗

Great advice but I won’t use it at an interview. Low mood: not what we want. Presenting discriminatory challenges: Stay clear this person will be difficult

185874 ▶▶▶▶ Mabel Cow, replying to Victoria, 2, #60 of 2327 🔗

You are of course right. I was in too much of a rush to be “helpful” to think it through. Employers don’t generally want people who buck authority.

186575 ▶▶▶ Cheezilla, replying to Mabel Cow, #61 of 2327 🔗

I wouldn’t fancy employing anyone who put “low mood” on an application form!

185689 ▶▶ Barney McGrew, replying to Jim, 5, #62 of 2327 🔗

Unfortunately, I don’t think anyone really considers mask exemption to be ‘real’ – it is only there as a theoretical, notional counter to hypothetical claims that some people cannot wear masks. In practice, you are expected to wear a mask, and if you don’t, some weak-minded people will genuinely wish to avoid you – not great for a job interview!

185696 ▶▶ PatrickF, replying to Jim, 4, #63 of 2327 🔗

I’d say “my circumstances have changed since I wrote the application.”
In other words, I was fine yesterday, but not today!
A decent employer will be aware of The Equality Act 2010.
Ask them! Good luck.

185728 ▶▶ chaos, replying to Jim, 3, #64 of 2327 🔗

Many with asthma don’t consider themselves to have a disability per se. However.. what kind of job is it? Retail?

185752 ▶▶▶ Jim, replying to chaos, 1, #65 of 2327 🔗

No, it’s just a part time cleaning job!

185815 ▶▶▶▶ Two-Six, replying to Jim, 5, #66 of 2327 🔗

as long as you can maintain social distance you don’t need to wear one anyway.

186595 ▶▶▶▶ Cheezilla, replying to Jim, 1, #67 of 2327 🔗

Maybe comply if the interview requires it and keep one in your pocket when working, in case the muzzle inspector is doing his rounds.

Hopefully this is all academic and won’t be a problem! The interview should be antisocially-distanced anyway and most cleaners work alone, so are automatically distanced.

185773 ▶▶ HelenaHancart, replying to Jim, 8, #68 of 2327 🔗

You don’t have to be disabled in anyway to be exempt. The government guidelines make it quite clear that even “distress” from putting on and/or removing a f/c is sufficient. In fact you don’t have to prove anything to anyone, your reason for not wearing one, if you believe it to be valid. Explain you are entitled to medical privacy. If they refuse to take your application further they could be discriminating against you. Check out the LaworFiction website, as they have some excellent advice. Print out, make or obtain an exemption lanyard if you feel it gives you more confidence (but you don’t have to.) And just start as you mean to go on

185787 ▶▶▶ Barney McGrew, replying to HelenaHancart, #69 of 2327 🔗

But that’s what I’m referring to above. In theory, it’s a legal exemption, but in practice it’s not worth the paper it’s written on.

185875 ▶▶▶▶ HelenaHancart, replying to Barney McGrew, 7, #70 of 2327 🔗

In theory the government should have carried a medical risk assessment of mask wearing by the general public before “mandating” it with threats of fines, but it didn’t. I wrote to my MP for this information but he couldn’t provide it, saying mask wearing was being implemented because it “may” do some good in the wider community, blah, blah. I know various organisations have asked the government directly, and again NO evidence has been provided. Therefore under Article 2 of the Human Rights Act 1998, which holds up (for the moment) against the gaslighting “rules” the government are voraciously making, they have to have exemptions, should harm come to anyone forced to wear one, which they could follow up with a lawsuit. Anyone can exempt themselves if they believe they have a “reasonable” excuse. The fines are in place for those who refuse outright to wear one, and who hang long enough to be issued with a fine. So, as you say, it’s not worth the paper it’s written on.

185811 ▶▶ Two-Six, replying to Jim, 11, #71 of 2327 🔗

The exenptions are there because it’s The Governments way of ensuring they aren’t going to get busted for implementing an illegal medical experiment. They can say masks are “optional”. So avoiding falling foul of human rights law, the Nuremberg convention on medical experiments. They know this. Like people say you don’t need to prove anything to anybody or declare anything. You can just not wear one.

It’s that simple.

Do you really want to work for a bunch of charlies that insist on you wearing a face nappy anyway?

185843 ▶▶ wat tyler, replying to Jim, 4, #72 of 2327 🔗

You just say you don’t wear a mask and if they ask why say you have a medical condition .If they continue pressing you say you had something personal happen to you when you were young and it causes you anxiety and you don’t wish to talk about it .

185897 ▶▶▶ Keen Cook, replying to wat tyler, 3, #73 of 2327 🔗

Yes. Thats right. It can also increase anxiety & you can say that you will be anxious about the interview (because you want the job – positive sign for potential employer.) and you find wearing mask makes communication v difficult. Go for trust etc.

186598 ▶▶▶ Cheezilla, replying to wat tyler, 1, #74 of 2327 🔗

It’s illegal for them to ask!

185872 ▶▶ Miss Owl, replying to Jim, #75 of 2327 🔗

You again? Previous days’ advice no good for you? They can’t ask you. Wear a lanyard.

186681 ▶▶▶ Jim, replying to Miss Owl, #76 of 2327 🔗

Why are you being so disrespectful and horrible?
No, maybe the advice wasn’t enough.
Maybe I need more and I need reassurance because I have lost my business and have no income at the moment.
Maybe, Suey, you’d do well to keep schtum instead of inflicting unnecessary hurt with your barbed comments and being an all round awful person needless commenting?

186926 ▶▶▶▶ Miss Owl, replying to Jim, #77 of 2327 🔗

I’ve apologised to you further up – or down, depending on which way you read this.

185651 Bob, 28, #78 of 2327 🔗

Labour, Conservative and all the other MPs can simply fck off. I’m not listening get to any of them ever again and nor will I vote for any of them.
12 out or 650 voted to cancel the CV legislation. 12…..

185654 hat man, replying to hat man, 1, #79 of 2327 🔗

This looks terrific:
https://www.youtube.com/embed/V6G_evJyVQ4

I’m wondering if there’s anyone on this site who could do a translated version with an English translation shown on screen. There is some technical vocabulary so it would require a German speaker with advanced skills.

185681 ▶▶ Kevin 2, replying to hat man, #80 of 2327 🔗

You can go to settings on the video and then switch on auto-translate, which then gives English subtitles. Not perfect but gives you a reasonable idea of what is being said.

185691 ▶▶▶ hat man, replying to Kevin 2, #81 of 2327 🔗

Thanks, I’ll try it and get back to this site with the result if it looks acceptable.

185695 ▶▶▶▶ Mabel Cow, replying to hat man, #82 of 2327 🔗

I just tried copy-pasting the subtitle transcript into translate.google.com, but the results were pretty bad.

186939 ▶▶▶▶▶ Cheshire Andy, replying to Mabel Cow, #83 of 2327 🔗

DeepL (deepl.com) is far better for translations than any Google spyware crap.

185709 ▶▶▶ hat man, replying to Kevin 2, #84 of 2327 🔗

Unfortunately that just produces word-for-word translation which often comes across as gibberish. I can follow it only because I know what’s being said in the original, and I think a non-German speaker would really struggle.

186604 ▶▶▶ Cheezilla, replying to Kevin 2, #85 of 2327 🔗

German subtitles only!

185993 ▶▶ Silke David, replying to hat man, 1, #86 of 2327 🔗

Hello hat man, I am a native German, watched the video.
She is presenting information which is widely available.
Looks like she is an a level student giving a presentation to the AfD political party.
The AfD is the known as rightwing party which gained a lot of seats in the Bundestag and in local parliaments in the last election and has been questioning the current policies, which is on one hand good, but also gives MSM the angle that opponents (like Querdenken) are politically on the right.

186560 ▶▶▶ hat man, replying to Silke David, 1, #87 of 2327 🔗

I am aware of what you say, except where you claim the information is widely available. Of course it is not made available to the public via the MSM, who would not cast doubt on the PCR test as she does. That is the point.
Whether she’s talking to the AfD or say the Revolutionary Marxists of Ostfriesland ist mir egal!

187501 ▶▶▶ Exiled off mainstreet, replying to Silke David, #88 of 2327 🔗

“right” or “left” is not really applicable anymore. It is systemic versus anti-systemic. Obviously, Starmer, a criminal based on his Assange role, cannot be considered to really be “left”. The person does appear to be somebody around 20 or so, and is certainly more advanced than an “a level” student, or it would not be posted. The salient fact is that debunking the validity of the testing from a sceptical perspective.

185655 p02099003, replying to p02099003, 55, #89 of 2327 🔗

In Hancock’s speech he says: “Many infectious diseases never reach herd immunity, like measles and malaria and Aids and flu”. This show the ignorance of the man, saying malaria is an infectious disease, when it’s a parasite passed from mosquitoes to humans, but as far as I am aware not from human to human. Measles we do have herd immunity due to the vaccine, that’s how vaccines work in a population. AIDS is also not infectious in the sense that the general population can acquire it without specific behaviour patterns.

185665 ▶▶ mhcp, replying to p02099003, 43, #90 of 2327 🔗

Hancock has just made the day for all those opposed to 3-in-1 injections for kids. Clearly since there is no herd immunity for measles we don’t need to vaccinate them. Since isn’t that the point of mass vaccination?

Why isn’t anyone calling him out on this idiocy?

What I’m seeing is a complete lack of understanding about science and the scientific method in general. Or theorist arseholes getting their 15 minutes of fame because they can use an exponential function.

And this is the same nation that birthed the Industrial Revolution

185697 ▶▶▶ Andrew Fish, replying to mhcp, 16, #91 of 2327 🔗

There seems to be a complete lack of understanding of how vaccines actually work. Numerous times I’ve seen people arguing that we have to wait for a vaccine because there is no immunity. God knows what they think a vaccine actually is – unicorn tears, presumably.

Obviously, when it comes to the Industrial Revolution, it’s worth noting that this was almost entirely driven by the “middling sort” – the political and aristrocratic elites were largely ignorant of the science then too (with the odd exception) and tended to look down on the “new money.” Hence, successful industrialists building properties like Cragside and Castle Drogo to show they were the equals of the landed gentry.

185792 ▶▶▶▶ kf99, replying to Andrew Fish, 6, #92 of 2327 🔗

Interesting. I who loathe “stately homes”, loved Cragside . Not sure it will survive within the newly woke NT.

185863 ▶▶▶▶▶ Caroline Watson, replying to kf99, 2, #93 of 2327 🔗

Quite. Lord Armstrong was an arms dealer!

185739 ▶▶▶ Judy Watson, replying to mhcp, 17, #94 of 2327 🔗

Also the same nation that faced up to the threat from Hitler – now acquiescing to crazy rules from a shambolic government

185764 ▶▶▶▶ Adam, replying to Judy Watson, 8, #95 of 2327 🔗

Getting rid and burying ⚰️ this government is vital for our health and prosperity and Labour must be permanently out of office

186944 ▶▶▶▶ Cranmer, replying to Judy Watson, 2, #96 of 2327 🔗

Indeed. For the first time in my life I am considering not attending the Remembrance Day service at my parish church. I cannot in all conscience claim to be remembering those who fought for our freedom when I am surrounded by people willingly giving up their own freedom for no good reason.

186610 ▶▶▶ chris c, replying to mhcp, 3, #97 of 2327 🔗

Here’s a Hancock worth listening to

https://www.youtube.com/watch?v=2VN8zH366M8

scary thought that music like this may never happen again

To call Matt Hancock a divot would be unfair to divots

186616 ▶▶▶ Cheezilla, replying to mhcp, 1, #98 of 2327 🔗

If you watch this:
https://unherd.com/2020/10/england-has-always-been-two-nations/?tl_inbound=1&tl_groups

It’s very clear the North of England birthed the Industrial Revoloution.
Unfortunately, we are governed by a completely different country, ie the South of England.

187166 ▶▶▶▶ chris c, replying to Cheezilla, #99 of 2327 🔗

I always thought it was rather odd that the Norman French who bequeathed us the southern English were actually French Vikings, quite different from the English Vikings who gave us the north, or a lot of it. Meanwhile us Saxons just quietly get on with things.

187226 ▶▶▶▶ Fingerache Philip., replying to Cheezilla, #100 of 2327 🔗

No it started in Coalbrookdale in Shropshire.

185672 ▶▶ Cicatriz, replying to p02099003, 13, #101 of 2327 🔗

And AIDS destroys the immune system. The clue is kind of in the name…

185731 ▶▶▶ matt, replying to Cicatriz, 11, #102 of 2327 🔗

And, given that you can never get rid of the HIV virus, by definition nobody can develop immunity to it. You either have it or you don’t have it. Another completely ridiculous example. Go Hancock!

185673 ▶▶ p02099003, replying to p02099003, 6, #103 of 2327 🔗

Actually I should have said HIV not AIDS, as AIDS does not necessarily result from an HIV infection.

185678 ▶▶▶ Cicatriz, replying to p02099003, 4, #104 of 2327 🔗

That’s true, do you think Handcock knows any of that though?

185690 ▶▶ matt, replying to p02099003, 26, #105 of 2327 🔗

This came up yesterday. Honestly, I don’t know where the man is getting this crap from – it’s hard to believe that anybody who has any understanding of virology, immunology or general medicine could possibly have given him the sound bite, so I have to assume he’s made it up himself. Which sounds about right, given the level of idiocy it displays.

I’m convinced what’s needed is a more aggressive stance informed by actual science. Hancock and his ilk should not be allowed to get away with spouting this kind of anti-scientific rubbish and having it repeated by a cadre of innumerate, scientifically illiterate political journalists (and fellow ministers and back benchers). His statement is flat out wrong and he’s chosen irrelevant examples to illustrate his “point”.

185700 ▶▶▶ matt, replying to matt, 20, #106 of 2327 🔗

Oh, and re measles – we had herd immunity a long time before the vaccine was introduced. That’s why it was almost always only caught by and passed between the very young, who hadn’t previously been exposed (and for whom it is the least concerning). Herd immunity isn’t expected to eliminate a virus, just to significantly suppress the spread. The very fact that, pre-vaccine, adult cases were rare is a good demonstration of herd immunity in action. The vaccine acts as a bolt on to try to reduce those adult cases (and severe childhood cases) even further.

To apply the same example to SARS-CoV-2, once we are at a level of herd immunity, you shouldn’t expect nobody to catch it, just that those few who do mostly won’t notice it and the occasional co-morbid patient who suffers badly from it will be indistinguishable from someone suffering similarly from the raft of ILI causing viruses already going around. The numbers will reduce, but they’ll almost certainly never disappear.

185879 ▶▶▶▶ VickyA, replying to matt, 15, #107 of 2327 🔗

If you look at the history of mortality and measles since in England and Wales , there were around a 570 deaths a year in the 40s. But after that it had already reduced to around 90 (1958-67) when the vaccine was introduced in 1968. A lot of reductions pre vaccine were due to better food, healthcare and housing, not vaccines. There seems to be a pattern in data manipulation perhaps?
I don’t want to sit on any anti vaccine platform as everyone has a right to make their own decisions, but I know what decision I will make about a COVID vaccine knowing more of the history of development of them. Anyone interested should check out Dr Judy Mikovits.

185908 ▶▶▶▶▶ Christopher, replying to VickyA, 14, #108 of 2327 🔗

Exactly , Engineers , Plumbers and Electricians are one of the reasons for improved health in the last century along with greater numbers being raised out of poverty. Putting this improvement in general health of the people in the western world down to vaccines is palpably false.

185916 ▶▶▶▶▶▶ Keen Cook, replying to Christopher, 6, #109 of 2327 🔗

Exactly. waterborne diseases are still big killers in developing world.

186057 ▶▶▶▶▶▶ p02099003, replying to Christopher, 4, #110 of 2327 🔗

Ironically it could have been these same improvements that precipitated the polio epidemics. Polio is spread through the orofaecal route. This was endemic but children didn’t necessarily succumb as they developed immunity as they grew up with it. When sanitation improved this community immunity was diminished leaving children open to developing the disease, there was no vaccine and there was an increased need for iron lungs. Mary Berry had polio as did Ian Drury. I was fortunate that the oral Salk vaccine was available for me.

186339 ▶▶▶▶▶▶▶ Nigel Sherratt, replying to p02099003, 3, #111 of 2327 🔗

Salk’s alturism quite a contrast to the current lot. Our star batsman at school had a caliper (and a runner in inter-school matches, he did his own running otherwise).

186670 ▶▶▶▶▶▶▶ chris c, replying to p02099003, 3, #112 of 2327 🔗

Interesting point! Yes I knew a few people who’d had polio. I had the vaccine, and DTAP and smallpox because that’s pretty much all there was when I was young (missed out on the BCG because I was supposedly immune to TB). IMO there’s a world of difference between a tried and trusted vaccine for a dangerous disease and a lot of the crap they pump into children nowadays. I have to wonder if that many vaccines destroy the immune system and make more vaccines necessary. Just the same scam as high carb low fat diets based on wheat, soy and industrially produced omeha 6 seed oils which make you ill so you need statins, diabetes drugs etc.

186645 ▶▶▶▶▶ Cheezilla, replying to VickyA, 2, #113 of 2327 🔗

I thik you’ll find a lot of nasty diseases, diptheria being an obvious one, were already disappearing pre-vaccine because of the extensive slum clearance and council house building in the 1950s.

186613 ▶▶▶▶ djaustin, replying to matt, -1, #114 of 2327 🔗

Endemic coronoaviruses have seasonal transmission and waning immunity. They reinfect typically in a timescale of 24mo in all but children. I doubt this one will be much different. Lifelong immunity is very very unlikely. We never had her immunity to measles, all we had was a very young age of infection and a very high seroprevalence reflecting that most people had been infected by their teens. About 9/10 people are in the same position for varicella (chickenpox). I personally believe adults who have not had it, should be vaccinated. It kills about 30 adults a year.

186634 ▶▶▶▶ chris c, replying to matt, 7, #115 of 2327 🔗

Quite!

I spent a large part of my life catching every cold, flu and food poisoning bug going. Then I finally learned to eat properly. In the last fifteen years I haven’t had the flu and only about two colds. Then last december I caught something suspiciously covid-like to which I evidently didn’t have much immunity but I managed to blat it without too many consequences. Hail the all-conquering immune system. Feed it well (and get out in the sun)

186950 ▶▶▶▶▶ Cranmer, replying to chris c, 1, #116 of 2327 🔗

Have you heard of the Wim Hof Method? It’s a breathing exercise, I started doing it to increase lung capacity for sports, which it helps with, but it’s also supposed to boost the immune system.

185887 ▶▶▶ Cheshirecatslave, replying to matt, 11, #117 of 2327 🔗

He’s wrong about flu too. The strains that caused lethal pandemics are still around but kill very few people. If an uncontacted tribe ,say in the Amazon were exposed to flu, it would likely kill them because of no herd immunity.

185904 ▶▶▶▶ matt, replying to Cheshirecatslave, 10, #118 of 2327 🔗

Yes.

I think the reason I’m so irritated by this statement is because – in a strong field – I think it’s the stupidest, most ill-informed statement made by any public figure during this whole sorry episode.

186140 ▶▶▶▶▶ Sophie123, replying to matt, 1, #119 of 2327 🔗

with you there.

186349 ▶▶▶▶▶ annie, replying to matt, 7, #120 of 2327 🔗

God, and look at the competition for that title!

186345 ▶▶▶ annie, replying to matt, 6, #121 of 2327 🔗

He’s a cretin.
Sadly, so are almost all if those he’s addressing.

186652 ▶▶▶▶ Cheezilla, replying to annie, 2, #122 of 2327 🔗

He’s an unbelievably arrogant cretin!

187850 ▶▶▶▶▶ Adam, replying to Cheezilla, #123 of 2327 🔗

I would happily headbutt Hancock and the fatass dope Johnson

186635 ▶▶▶ Cheezilla, replying to matt, 5, #124 of 2327 🔗

Press headlines this morning should have read:
“HANCOCK THINKS MALARIA IS CAUSED BY A VIRUS!”

They had a great opportunity to crucify him.
Maybe next time. (Not holding my breath)

185698 ▶▶ tonyspurs, replying to p02099003, 47, #125 of 2327 🔗

Just as I thought

186130 ▶▶▶ Nsklent, replying to tonyspurs, 2, #126 of 2327 🔗

That made me laugh out loud.

185702 ▶▶ Judy Watson, replying to p02099003, 2, #127 of 2327 🔗

Re Malaria and AIDS – you beat me to it. Also I have known people to get Malaria more than once.

185723 ▶▶▶ matt, replying to Judy Watson, 9, #128 of 2327 🔗

Because it’s a parasite, not a virus.

185775 ▶▶▶ Iansn, replying to Judy Watson, 2, #129 of 2327 🔗

I can vouch for that as I have had it twice. Take the tabs for 3 days and you are OK.

186038 ▶▶▶ p02099003, replying to Judy Watson, 3, #130 of 2327 🔗

The parasite is in the red blood cells, and stays there. The symptoms can erupt at any time.

186348 ▶▶▶▶ Nigel Sherratt, replying to p02099003, 5, #131 of 2327 🔗

Yes, my father’s from Surabaya (5th Indian Division Signals) came back from time to time throughout his 90 year life.

185707 ▶▶ stefarm, replying to p02099003, 3, #132 of 2327 🔗

How the fuck is aids or hiv infectious.

Don’t remember mark Fowler spreading it around Albert square

185883 ▶▶▶ Miss Owl, replying to stefarm, 6, #133 of 2327 🔗

The sainted Princess Diana could have told you that the general population was at no risk whatsoever, and she was no Mensa member.

185917 ▶▶▶ Christopher, replying to stefarm, 6, #134 of 2327 🔗

it’s infectious if you put the pee pee in the poo poo . 😉

186060 ▶▶▶▶ p02099003, replying to Christopher, 3, #135 of 2327 🔗

Also if infected blood is transfused into another person, Isaac Asimov was one such person.

186230 ▶▶▶▶▶ mjr, replying to p02099003, 1, #136 of 2327 🔗

or using dirty needles

186351 ▶▶▶▶▶▶ annie, replying to mjr, 2, #137 of 2327 🔗

Well, lockdown would prevent all that, eh?

186663 ▶▶▶▶▶▶ Cheezilla, replying to mjr, #138 of 2327 🔗

I would say infection via transfusion and dirty needles is basically inoculation.

185734 ▶▶ Basileus, replying to p02099003, 9, #139 of 2327 🔗

Clearly there are factual inaccuracies in his speech. How does one start proceedings for ‘Misleading the Commons’.?

185740 ▶▶▶ Andrew Fish, replying to Basileus, 7, #140 of 2327 🔗

How about trying to get a recall petition going in his constituency?

185835 ▶▶▶▶ Silke David, replying to Andrew Fish, 3, #141 of 2327 🔗

As some one who used to live in his constituency and now lives in the neighbouring, I say “Good Luck” …..

185750 ▶▶▶ Awkward Git, replying to Basileus, 4, #142 of 2327 🔗

Parliamentary Standards Commissioner responsible for this sort of thing but not interested in doing any investigations. I tried.

The Speaker of the House might get involved if he said it in Parliament.

185742 ▶▶ Tyneside Tigress, replying to p02099003, 13, #143 of 2327 🔗

Response to Handsy from 2 of the 3 GBDers:

https://www.dailymail.co.uk/news/article-8836185/Matt-Hancock-says-NOT-true-herd-immunity.html

Virus experts savage Matt Hancock for claiming herd immunity is ‘a flawed goal’ and thousands will die without tough restrictions – as they say ‘after eight months it is shocking he does not have a basic understanding’

185821 ▶▶▶ Basics, replying to Tyneside Tigress, 6, #144 of 2327 🔗

” as they say ‘after eight months it is shocking he does not have a basic understanding’”

Witty van tam vallance and tge rest are as responible for not schooling him as he is for acceoting a position of responsibility beyond his ken.

185840 ▶▶▶▶ matt, replying to Basics, 8, #145 of 2327 🔗

But why does he feel qualified to make this unmitigated bullshit up on the spot?

It always used to bother me during Hancock’s half hour that he would refer to clinicians in the NHS as “colleagues”. Maybe this is the answer,, though – maybe he thinks that being Health Secretary is the same as having a medical degree.

185957 ▶▶▶▶▶ Basics, replying to matt, 3, #146 of 2327 🔗

Healthtech board member Hancock.
Colleagues is a words used by hateful politicians here. Coukd he be referencing common puropse colleagues. Inclusive bullshit language.

186407 ▶▶▶▶▶ PatrickF, replying to matt, #147 of 2327 🔗

Dr Hancock, why does shit come out of my anus, and shit comes out of your mouth?

186668 ▶▶▶▶▶ Cheezilla, replying to matt, #148 of 2327 🔗

Simple – hubris!

185748 ▶▶ Awkward Git, replying to p02099003, 5, #149 of 2327 🔗

He’s definitely an idiot of the highest grade.

But look at the people around him, unfortunately he’s one of the brighter ones.

185825 ▶▶▶ Two-Six, replying to Awkward Git, 4, #150 of 2327 🔗

I think Nadine Dorreys is more clever than Handy Cock

185984 ▶▶▶▶ Will, replying to Two-Six, 1, #151 of 2327 🔗

I am not sure which of them is being damned with faint praise in that statement.

186353 ▶▶▶▶ annie, replying to Two-Six, 2, #152 of 2327 🔗

My dog is. He doesn’t spout crap from his mouth.

187857 ▶▶▶ Adam, replying to Awkward Git, #153 of 2327 🔗

There is no one in this government that is intelligent,they make corbyn and dopey Lammy & Abbot appear intellectual

185781 ▶▶ PaulC, replying to p02099003, 6, #154 of 2327 🔗

DM has a great article today (surprised Will missed it) ‘Virus Experts Savage Matt HANDCOCK FOR CLAIMING HERD IMMUNITY IS ‘A FLAWED GOAL’…..

185789 ▶▶ GCarty80, replying to p02099003, 4, #155 of 2327 🔗

“AIDS is also not infectious in the sense that the general population can acquire it without specific behaviour patterns.”

Which is most likely the reason why test/track/trace is fairly easy when dealing with STDs more generally.

185827 ▶▶ Caroline Watson, replying to p02099003, 14, #156 of 2327 🔗

No disease does reach total herd immunity on its own; it just ceases to be an ‘epidemic’. Vaccine doesn’t create total herd immunity either; the only disease that has been fully eradicated is smallpox. I think we’ve pretty much eradicated anthrax in cattle too, but by a policy of mass slaughter, which isn’t exactly appropriate in humans!!
When I was a child, there was no measles vaccine and it broke out occasionally in schools. I had it just after I started which was common; little children who had largely been at home with mothers and grannies and limited social contact were suddenly brought together in one place. Measles is seen as a “childhood illness’ but that was because adults had usually had it as children. Chicken pox, particularly, was seen as a desirable thing to have as a child because it was much more dangerous in adults.
Natural total herd immunity isn’t possible because the herd isn’t static; there will always be new people. But, if a certain level of immunity hadn’t been established to viruses before vaccines were invented, we’d have been wiped out as a species centuries ago.

186959 ▶▶▶ Cranmer, replying to Caroline Watson, 3, #157 of 2327 🔗

Was talking about this with an old boy in my village who said as a lad he was made to play with a neighbour’s child who had measles, specifically so he’d catch it young. Imagine that nowadays! His parents would probably be sent to prison.

186968 ▶▶▶▶ Suitejb, replying to Cranmer, 2, #158 of 2327 🔗

Indeed. When I had German measles as a child my friend’s mother sent her round to stay and she slept in my bedroom!

187176 ▶▶▶▶ chris c, replying to Cranmer, 1, #159 of 2327 🔗

Oh yes we had “chickenpox parties” and probably for mumps and measles too when I was young. In my case unneccesary, just going to school gave me all three within a year. Oh God I just had a flashback to the smell of sick and Dettol in the school corridor.

187223 ▶▶▶ Monty Bodkin, replying to Caroline Watson, #160 of 2327 🔗

Caroline,
Good summary. Thanks.

185905 ▶▶ Keen Cook, replying to p02099003, 8, #161 of 2327 🔗

Malaria is due to a mosquito injecting the poor recipient with the wretched parasite that takes up residence in the blood cells. It is not an ‘infectious’ disease in the way a respiratory disease is. The mozzie is the carrier. Hancock seriously doesn’t know what he’s talking about. But we knew that.

185657 Will, replying to Will, 83, #162 of 2327 🔗

Towards the end of yesterday’s discussion someone asked where the “vulnerable” stand in relation to Covid. I hope fellow sceptics don’t think me conceited but I thought I might repost my reply:

We are vulnerable as a family: my daughter is having chemotherapy and a blood therapy designed to bleach her B cells plus she is on methotrexate, so all in all she is thoroughly immuno compromised, but we don’t need anyone else to curtail their existence for our safety, thank you very much. It is an absolute doddle to shield/ protect ourselves and we are worried about colds, never mind sars-cov-2.

185674 ▶▶ karenovirus, replying to Will, 37, #163 of 2327 🔗

Good for you Will, best wishes to your daughter and the rest of your brave family.

185710 ▶▶▶ Jenny, replying to karenovirus, 57, #164 of 2327 🔗

My parents (and many of their friends) are in their 80s. Rabidly anti-lockdown and think it is totally absurd. With all the “killing Granny” nonsense, we rarely hear Granny’s voice.

185822 ▶▶▶▶ The Filthy Engineer, replying to Jenny, 14, #165 of 2327 🔗

As ever, the “elderly” are the forgotten cohort.

186678 ▶▶▶▶▶ Cheezilla, replying to The Filthy Engineer, 7, #166 of 2327 🔗

Actually they’re not forgotten, they’re the excuse.

186966 ▶▶▶▶▶▶ Cranmer, replying to Cheezilla, 4, #167 of 2327 🔗

Well said! I think the more frightened ones are the 1960s boomer generation. People in their late seventies and beyond are not so bothered because they grew up in the post war era when relative hardship was the norm and you didn’t expect things handed to you on a plate. My mother, in her late seventies, has been completely calm and sang-froid through this whole nonsense, and we have been ‘interpreting’ the rules on visiting etc with a nod and a wink.

187146 ▶▶▶▶▶▶▶ JohnB, replying to Cranmer, 3, #168 of 2327 🔗

I think the more frightened ones are the 1960s boomer generation.

Strangely, I think the more frightened ones are the 80s/90s/00s. About as valid a thought.

187212 ▶▶▶▶▶▶▶ Fingerache Philip., replying to Cranmer, 1, #169 of 2327 🔗

My wife and myself will be 72 just before Christmas and we think exactly the same as your mother.

185866 ▶▶▶▶ Caroline Watson, replying to Jenny, 24, #170 of 2327 🔗

Absolutely. My 89 year old father is vehemently opposed and delights in sending me articles by Peter Hitchens and Richard Littlejohn.

186357 ▶▶▶▶▶ annie, replying to Caroline Watson, 6, #171 of 2327 🔗

Three loud cheers for him.

186724 ▶▶▶▶▶ chris c, replying to Caroline Watson, 7, #172 of 2327 🔗

Throughout the lockdown when I went for my daily exercise I’d see several eighty years olds and beyond defiantly walking their dogs. Not taken in unlike many younger ones

185699 ▶▶ Andrew Fish, replying to Will, 18, #173 of 2327 🔗

I don’t see that as conceit – you undoubtedly speak for a great many people who despise what is being done effectively in their name.

185893 ▶▶ PaulH, replying to Will, 30, #174 of 2327 🔗

My 83 year old parents feel just the same. They just want to enjoy what is left of their remaining active lives and are more than capable of judging their own level of acceptable risk.

The last thing they need is 42-year old Matt Hancock pitching up and destroying their lives on the basis of “saving granny”.

186969 ▶▶▶ Cranmer, replying to PaulH, 2, #175 of 2327 🔗

I suspect it’s because Hancock can’t understand that an 83 year old can’t reasonably expect another 30 or 40 years of life as he can.

187960 ▶▶▶ Jamie, replying to PaulH, #176 of 2327 🔗

My dad too. He’s 80, a passionate lefty, believes it’s all totally disproportionate. Speaks to his health visitor about the state of hospitals and reports back to me that they’ve essentially been empty since April. He smells a rat.

Another thing. My cousin is a nurse in Blackpool, she was giving care to a gentleman unrelated to covid, the man was tested for covid, it came out positive. She asked the doctor whether she should self isolate. The doctor replied ‘no, you can go home, it will be fine’

Go figure?

185901 ▶▶ Cheshirecatslave, replying to Will, 29, #177 of 2327 🔗

I’ve had poor health all my life and had to try and avoid infections. I am strongly anti lockdown. I wish to make my own decisions. I choose to go to church and see close friends while avoiding crowds and confined spaces. Being shut up in isolation is a living death.

186361 ▶▶▶ annie, replying to Cheshirecatslave, 7, #178 of 2327 🔗

Are you the only ‘vulnerable’ person with that much sense? From the way the Fascist crap merchants tslk, anyone would assume that you are.

186444 ▶▶▶▶ Bella Donna, replying to annie, 8, #179 of 2327 🔗

Amazingly it’s those who are more vulnerable who create the least fuss. Once again it’s the virtue signallers causing the problems for the rest of us.

185975 ▶▶ Bart Simpson, replying to Will, 22, #180 of 2327 🔗

Well said. My father-in-law turned 80 this year and still lives up the Democratic People’s Republic of Scotland.

He’s fed up with lockdowns, is fed up that he can’t go to concerts, can’t go to the library to do his research and can’t really go anywhere due to the dire public transport around his area and beyond.

So much for saving the elderly but what’s being done to them is cruel.

186100 ▶▶▶ Judith Day, replying to Bart Simpson, 10, #181 of 2327 🔗

I sympathise with your Dad. I still have library books due to be returned at the end of March; we were told to keep them ‘for the time being’.
I really miss my weekly visits to the Library, and the plays and concerts at our two excellent local theatres.

186138 ▶▶▶▶ Bart Simpson, replying to Judith Day, 6, #182 of 2327 🔗

Same here. I also go to concerts and haven’t been to the British Library for months now. I will have to go at some point for work reasons but my pass is expiring and can’t pre-book tickets at the moment.

186928 ▶▶▶ Jay Berger, replying to Bart Simpson, 4, #183 of 2327 🔗

It’s a very woke virus.
And Gen Y and Z are the most vulnerable to it in that regard.
Which fits in with the general decline of educational standards and the IQ since Boomers and Xers were educated.

185976 ▶▶ stewart, replying to Will, 9, #184 of 2327 🔗

I wish the BBC would interview you and put you on the news instead of all the, sorry, bedwetters – can’t help it..

186212 ▶▶ HelenaHancart, replying to Will, 11, #185 of 2327 🔗

I’m on Methotrexate for RA, so I know what a trial that can be, let alone the other meds your daughter has to take. I too, take full responsibility for my health, and I’m avidly anti-lockdown. When did we all suddenly become so unable to have autonomy over our own bodies that the government feels it has the right to interfere into our lives and our privacy for a virus, in circulation in any other year, would hardly be noticed. Wishing your daughter well with her treatment.

186365 ▶▶▶ annie, replying to HelenaHancart, 4, #186 of 2327 🔗

In Wales, the government owns our bodies and can chop them up the instant our breath is out of them.

185658 2 pence, 6, #187 of 2327 🔗

History repeats itself.
In 1919 the media and her controllers launched a psychological assault on the Australian population pertaining to the imminent appearance of a deadly disease that was headed for our shores, known initially as the pneumonic influenza epidemic.
The public became erratic with the media feeding the fear and the states acted not much better with all borders closed and non-essential travel ground to a halt.
https://threadreaderapp.com/thread/1308428022182109185.html

185659 Nic, replying to Nic, 23, #188 of 2327 🔗

I post here regularly about brazil, no lock down got loads of stick.
Glad to say they held there nerve deaths continue to fall as do infections I said last month it will be over in brazil by xmas and I’m still saying that will be the case.herd immunity has nearly been reached.

185664 ▶▶ Will, replying to Nic, 10, #189 of 2327 🔗

Great news!!!

185671 ▶▶▶ Nic, replying to Will, 12, #190 of 2327 🔗

Yes it it is media were all over brazil a few months ago .nothing said now similar to sweden which is never mentioned. I think if we have another lockdown we must resist

185661 Victoria, 15, #191 of 2327 🔗

T&T

185666 PastImperfect, replying to PastImperfect, 8, #192 of 2327 🔗

The Australian Defence Force is trying to give itself unlimited, without time restrictions or sunset clauses, access to call an Emergency and to bring FOREIGN ARMED MILITARY ONTO THE STREETS OF AUSTRALIA.

https://www.facebook.com/AustraliansForAssange/photos/a.123927632382700/365159241592870/

185771 ▶▶ Adam, replying to PastImperfect, 5, #193 of 2327 🔗

It’s treason simple as

185667 karenovirus, 11, #194 of 2327 🔗

I’m still waiting for a Downfall vid with Boris in the Horseguards Bunker yelling down ‘phones with ever more insane lockdown instructions to Covid Marshal Gaulieters who either aren’t there or know the game is up . . .

Meanwhile hanckrock, witless, unbalanced and the rest of the grizzled gang are hunted down by loyalist Sceptics to face trial.

The SAGE having been listed in order of the famous Pack Of Cards with ferguson as Ace Of Spades.

185675 DJ Dod, replying to DJ Dod, 34, #195 of 2327 🔗

As others here have noted, there is no opposition. The entire political class are complicit in this disaster, but presumably they think that they will be able to distance themselves from the damage they have caused before the next general election.

I’m hoping there will be an independent candidate in my constituency, because I don’t see how I’m going to be able to vote otherwise…

185679 ▶▶ Victoria, replying to DJ Dod, 11, #196 of 2327 🔗

Yes either independents or the new political parties.

185680 ▶▶ Jonathan Palmer, replying to DJ Dod, 15, #197 of 2327 🔗

If you are allowed to vote again

185686 ▶▶ Andrew Fish, replying to DJ Dod, 7, #198 of 2327 🔗

The trouble is they think we have no choice – both sides are counting on dumping the blame on the other and assuming no third force can come through between them. We got into a similar situation in 1982, when Labour were still seen as the wreckers of our economy, but the Conservatives seemed to be making it worse – the SDP were polling at over 50% prior to the Falklands conflict. Arguably if the Argentinians hadn’t been trying to bolster their own nationalist base history could have been very different.

185714 ▶▶▶ Victoria, replying to Andrew Fish, 13, #199 of 2327 🔗

Agree. However they are in for a big shock. There will be enough anger and misery for voters to be disillusioned, also enough facts and court cases to use against them.

People like us will stand up as follows:
1) standing as independents or for one of the new political parties
2) vote for any party but Labour or Conservatives – ballot spoiling won’t help

I will do everything in my power to oust my Conservative MP that has failed dismally to protect his constituents. The fight is on!!!!

185786 ▶▶▶▶ Julian, replying to Victoria, 4, #200 of 2327 🔗

SDP could be an option. Or UKIP if that’s your bag.

185850 ▶▶▶▶▶ kf99, replying to Julian, 4, #201 of 2327 🔗

David Kurten looks good. But he needs a party. He’s not going to be joining the SDP anytime soon. It’s all so fragmented.

186413 ▶▶▶▶▶▶ JamesDrebin, replying to kf99, 2, #202 of 2327 🔗
186611 ▶▶▶▶▶▶▶ kf99, replying to JamesDrebin, 2, #203 of 2327 🔗

Oh, interesting. Why didn’t Lawrence Fox join that?

How about a “Heritage-SDP alliance”

188080 ▶▶▶▶▶▶▶▶ JamesDrebin, replying to kf99, #204 of 2327 🔗

Yeah, although not sure if the SDP have particularly traditionalist leanings? So probably not on the level of a merger, but sure, cooperation-wise that would be good. The Personal Freedom Alliance for the win.

185954 ▶▶▶▶ Paul M, replying to Victoria, 8, #205 of 2327 🔗

My MP, James Daly, has been voting against the measures recently – he was one of 42 last night. Sadly, voting for him (if ever we are allowed to) would mean voting for a party that has destroyed the country

Once the truth comes out, I’m hoping for big political upset to sweep the lot of them out.

Fingers crossed for Simon Dolans injunction hearing tomorrow, though I suspect the courts will have been nobbled

186544 ▶▶▶▶▶ Cranmer, replying to Paul M, 1, #206 of 2327 🔗

A high court challenge to the government of Spain was nobbled recently. I suspect it will happen here too. Where’s Gina Miller in all this? (joke.)

185694 ▶▶ Saved To Death, replying to DJ Dod, 7, #207 of 2327 🔗

I really doubt they are worried about the next general election.

185703 ▶▶▶ Mabel Cow, replying to Saved To Death, 4, #208 of 2327 🔗

Perhaps there won’t be a next general election.

It’s been done before .

185774 ▶▶ Adam, replying to DJ Dod, 2, #209 of 2327 🔗

SDP I joined in April and don’t regret

185977 ▶▶▶ TheBluePill, replying to Adam, 4, #210 of 2327 🔗

I’ve been toying with joining the SDP for some time. However, I will struggle to join any political party unless it has a manifesto pledge to fully investigate and prosecute the perpetrators of the 2020 shit show.

186372 ▶▶▶ annie, replying to Adam, 3, #211 of 2327 🔗

What’s their take on the current lunacy?

185807 ▶▶ mattghg, replying to DJ Dod, 3, #212 of 2327 🔗

I spoiled my ballot paper last time. Not sure how I can escalate that any further!

185828 ▶▶▶ Two-Six, replying to mattghg, 5, #213 of 2327 🔗

crap on it

186782 ▶▶▶▶ chris c, replying to Two-Six, #214 of 2327 🔗

Yes use it to wipe

186368 ▶▶ annie, replying to DJ Dod, 6, #215 of 2327 🔗

How about standing yourself?
Sceptics’ party. Crowdfund the deposits. Contest every seat. Make a Coalition for Sanity with the Monster Raving Loonies.

186848 ▶▶▶ James Bertram, replying to annie, 1, #216 of 2327 🔗

It doesn’t need a party. It doesn’t need an election. Any one of us on here could print some leaflets and distribute them now, stating that we will stand in the next election as an Independent on the platform of being the Anti-Lockdown candidate – that we will campaign to have a full investigation, to have any current colaborator MP put on trial, to compensate those who have unduly suffered by seizing the assets of convicted colaborators – and that should put the fear of God into them!

186889 ▶▶▶▶ James Bertram, replying to James Bertram, #217 of 2327 🔗

Side two of the Urgent Action Now leaflet has some information on the Nuremberg Code:
https://www.stopnewnormal.net/downloads
‘Enforcing Covid regulations is an international breach of human rights…’

187074 ▶▶▶▶▶ janeinthemindfield, replying to James Bertram, #218 of 2327 🔗

I managed to download 2 of the leaflets and now in both safari and chrome, when i click download google wants me to make an account?? i would happily print these out and give them to people, but dont want to make a google account!!

185676 Victoria, 14, #219 of 2327 🔗

“We in the World Health Organisation do not advocate lockdowns as the primary means of control of this virus. The only time we believe a lockdown is justified is to buy you time to reorganise, regroup, rebalance your resources, protect your health workers who are exhausted, but by and large, we’d rather not do it.”

Ha! The only reason why WHO suddenly have this view on lockdowns is because of the class action suit by Dr. Reiner Füllmich and the ACU.

The German COVID-19 Extra-Parliamentary Inquiry Committee – in German – ACU – German acronym for Ausserparlamentarischer Corona Untersuchungsausschuss – (see diagram from http://www.ACU2020.org website) is planning to launch a Class Action Suit against not only governments and government officials, but specifically against the manufacturers of the infamous PCR test (PCR – Polymerase Chain Reaction – is a technique used to “amplify” small segments of DNA) which, according to honest virologists all over the world, is absolutely unsuitable for covid-19 testing. It has actually not even been licensed to carry out such tests.

…..

……

https://www.globalresearch.ca/germany-extra-parliamentary-corona-investigative-commission-launching-class-action-suit-against-corona-criminals/5725633

185682 kf99, 9, #220 of 2327 🔗

The Dr Beaker reference is superb.

On the Dorries tweet, how big is this going to be? The Twitter response is only about 99.9% against her

185687 PastImperfect, 8, #221 of 2327 🔗

https://www.globalresearch.ca/medical-doctor-warns-bacterial-pneumonias-rise-mask-wearing/5725848?fbclid=IwAR33DldgoPOMIcOAAFxGHMlhWVAwMiW08Nroqr60tmUgNHc_bRBSr11GSsE

“…the fear factor has got to step back. This idea that I don’t want to give you something that I don’t even know that I have is almost at the point of ridiculous. Let’s use some common sense.”

185704 Basics, replying to Basics, 14, #222 of 2327 🔗

Brought over from yesterday

LS commenter Lilli posted:

Excellent comment in the Telegraph:
Lucilla Rowbury
14 Oct 2020 8:34AM
I applaud any journalist with the integrity and courage to speak the truth. Thank you.
This is about total decimation of the economy so that Klaus Schwab’s great reset or fourth industrial revolution can be implemented. There is mounting evidence of global corruption and crimes against humanity to ensure that this new world order is brought forward.
Here in the UK, Johnson isn’t oblivious to the destruction, he’s not incompetent; Johnson is doing EXACTLY what he has been told to do.
In the coming months Johnson and Hancock will herald in this new world order (Great Reset posters already up in parts of the UK) and the gullible amongst us will think how wonderful that something good has come out of this crisis. But the more informed amongst us will realise that the virus has been used as trojan horse to accelerate the plans of one of the most ethically repugnant psychopaths on this planet.
The measures taken by our government (most governments) were never about health: it has always been about control.
Say goodbye to life as you knew it.
Say hello to totalitarianism, global government, digital currency, AI, endless vaccines, and, ultimately, depopulation.

185711 ▶▶ Basics, replying to Basics, 4, #223 of 2327 🔗

From yesterday also. This is really important to see the globalists intention of a reshaped population is coming at us with UK Government collusion.

The Fourth Industrial Revolution’
The 2017 Matt Handcock speech you didn’t know about. On the UKGov website.

https://www.gov.uk/government/speeches/the-4th-industrial-revolution

“…And I’m delighted to speak alongside so many impressive colleagues who really understand this, and alongside Professor Klaus Schwab who literally ‘wrote the book’ on the 4th Industrial Revolution. Your work, bringing together as you do all the best minds on the planet, has informed what we are doing, and I’m delighted to work with you. …”

185725 ▶▶▶ Basics, replying to Basics, 2, #224 of 2327 🔗

TT added this link to the Healthtech board of which Hancock is mouth piece. Relevant to who has been developing the implentstion of the 4th Industrial revolution. Notice it is Health which has been deliberately chosen to force this onto populations, notice too the SARS-CoV-2 carry on is a supposed health emergency.

https://tech.newstatesman.com/public-sector/healthtech-advisory-board

186145 ▶▶▶▶ RichT, replying to Basics, 3, #225 of 2327 🔗

Also Devi Sridhar is on the World Economic Forum Council on the Health Industry. This could explain Führerin Krankie’s approach.

185713 Censored Dog, replying to Censored Dog, 6, #226 of 2327 🔗

It doesn’t matter whether Biden wins in November or not, the UK political class will not change course and the only thing you can do is to disobey restrictions.

It’s also highly likely that Boris will try to advertise this ‘circuit-breaker’ as a thing the public has to do to ‘Save Christmas’

If you can’t tell, I am very blackpilled at the moment.

186421 ▶▶ JamesDrebin, replying to Censored Dog, 1, #227 of 2327 🔗

Saaame. 🙁

185717 Mabel Cow, replying to Mabel Cow, 24, #228 of 2327 🔗

Toby / Will

Please can we have a new rule that all pictures of the right honourable Mr Matt Hancock MP are blurred out.

My mental state is precarious enough without having to see his shit-eating grin every day.

Kind regards

Mabel

185761 ▶▶ Basics, replying to Mabel Cow, 3, #229 of 2327 🔗

I agree. Or install a wordpress plug-in that allows for scrawled defacing of pictures.

186374 ▶▶▶ annie, replying to Basics, 1, #230 of 2327 🔗

Oooooh yeeeees.

185718 TJP, replying to TJP, 9, #231 of 2327 🔗

We need to launch a campaign:
Country goes into full national lockdown > all ministers, MPs, elected representatives to donate their full salaries for each day of lockdown to a fund supporting those left without jobs or businesses
Local lockdowns > same but for local MPs/representatives
Pub and restaurant closures > hospitality sector to estimate % of losses with respect to a normal year, MPs donate the same % from their salary
Then at least they’d had an incentive to keep lockdowns short.

185820 ▶▶ CGL, replying to TJP, 6, #232 of 2327 🔗

But this will be the 3rd holiday we have missed now this year. I know it sounds like such a 1st world problem doesn’t it, but we have nothing else to look forward to. Just a week Dorset and the others were a week in mid-Wales and a trip to a mobile home in France – we’re not talking Barbados or anything flash. Just some quality respite. We arent allowed to have 1 minutes peace are we.

185974 ▶▶▶ Felice, replying to CGL, 3, #233 of 2327 🔗

Quite understand. I was supposed to have a month walking across Spain in May, a week volunterring in Spain in August, visiting a friend in Spain in Sept…
So far, we’ve managed a 3 night break in the Lakes in brilliant weather in July, which my 96 year old mother trashed by having a heart attack.
I desperately need a break too.

186729 ▶▶▶▶ Cheezilla, replying to Felice, 2, #234 of 2327 🔗

You want a change? Try a week in Liverpool.

185990 ▶▶▶ stewart, replying to CGL, 5, #235 of 2327 🔗

You know things are moving in a bad direction if people in 1st world countries stop having 1st world problems and start having 3rd world problems.

186726 ▶▶▶ Cheezilla, replying to CGL, 2, #236 of 2327 🔗

Poor you! People have lost their jobs and livelihoods but you need a holiday.

185721 PastImperfect, 4, #237 of 2327 🔗

Hancock WEF speeches, meeting Gill Gates and vision for the NHS.

https://www.facebook.com/CaanageMedia/photos/a.111211127418040/118450803360739/

185722 Kev, replying to Kev, 10, #238 of 2327 🔗

Dr Tedros seems to have problems forming his sentences properly

“Herd immunity is achieved by protecting people from a virus, not by exposing them to it,” he said.

What he meant was “Herd immunity is achieved by exposing people to a virus, not by protecting them from it” – What exactly does a vaccine do if it doesn’t expose you to the virus, that is how it works.

“Never in the history of public health has herd immunity been used as a strategy for responding to an outbreak, let alone a pandemic,” he also said .

What he meant was “Never in history has herd immunity NOT been used as a strategy for responding to an outbreak, let alone a pandemic,”

185758 ▶▶ A. Contrarian, replying to Kev, 9, #239 of 2327 🔗

Never in history have lockdowns been used as a strategy either…

185809 ▶▶▶ Basics, replying to A. Contrarian, 2, #240 of 2327 🔗

Where did the lockdown concept come from?
An Americans 16 year olds science project. This was then developed by her scientist father into a paper, her name appears in the paper.

Open to learning more about the origin. My answer above is what I know, I have seen the paper. However, it may not be true that this was the origin. I would like to be informed if anyone can add to this.

186315 ▶▶▶▶ Nigel Sherratt, replying to Basics, #241 of 2327 🔗

AOC perhaps?

185729 Mayo, replying to Mayo, -11, #242 of 2327 🔗

Try telling that to the Swedes, Professor.

Be careful here. The rise in infections in Sweden is not that different to what was happening in the rest of Europe about 6 weeks ago. A steady increase – but very few hospitalisations. Then, as the infection spread further, we got a slight uptick in hospital cases which has now become a steady trickle.

Sweden might get away with it but they have tended to be a few weeks behind the likes of France, Spain, Italy & the UK.

185760 ▶▶ sky_trees, replying to Mayo, 5, #243 of 2327 🔗

Indeed. I think the evidence is very sketchy to say ‘because Sweden didn’t lock down, that’s why Covid is so low there’. There’s a lot unexplained about this virus.

I wondered if countries are recording things differently depending on their agendas, to be honest. If this situation has shown one thing, it’s that you can torture data to get it to show whatever you want, basically. Objective truth is a slippery concept.

185782 ▶▶▶ mhcp, replying to sky_trees, 1, #244 of 2327 🔗

It’s not about the amount of infections or deaths. It’s how it compares to flu season where you don’t take measures.

it’s the measures not the disease

185783 ▶▶▶ Julian, replying to sky_trees, 5, #245 of 2327 🔗

The Swedes never said they could suppress covid, they realised it needed to be lived with sustainably over a long period, and that is what they are doing.

Regarding the data, I agree that it is hard to make comparisons. All you can really do is look at all-cause mortality as a % of population and compare with previous years in that country. To my knowledge, in every country in the world, that figure is not in any way unprecedented and is often very average. Everything else is just noise.

185998 ▶▶▶ stewart, replying to sky_trees, 6, #246 of 2327 🔗

There is so much truth to what you say.

How many people in Britain would know anything about any epidemic if it simply wasn’t talked about and any “covid” deaths were simply put down to respiratory disease.

If it wasn’t for the constant bombardment from the news, people would be completely oblivious to anything strange going on.

186579 ▶▶▶▶ Cranmer, replying to stewart, 3, #247 of 2327 🔗

I think 24 hour news and social media is part of it. An alternative virtual reality has been created in which millions of otherwise healthy people are dropping dead from Covid, and the addicted public mostly lack the critical faculties to see through it.

186737 ▶▶▶▶ Cheezilla, replying to stewart, 2, #248 of 2327 🔗

Because the only thing strange going on is the mockdown measures!

187188 ▶▶▶▶▶ chris c, replying to Cheezilla, 1, #249 of 2327 🔗

Yes and the lockdowns stop you going out into the real world and meeting all the people who haven’t died or know anyone who did.

187284 ▶▶▶▶ Monty Bodkin, replying to stewart, #250 of 2327 🔗

Most people I talk to have no recollection of the bad flu season of 2017/8 when excess winter deaths in this country exceeded 50,000. It simply wasn’t newsworthy and so the general public remained oblivious. As did I, incidentally.

187273 ▶▶▶ Monty Bodkin, replying to sky_trees, #251 of 2327 🔗

There was much scratching of heads earlier this year because no-one could understand why Gemany had such a relatively low death rate (approx 9,000 at that time in a population of 83 million) The difference was that the Germans were recording only those deaths directly attributable to Covid. Here and elsewhere in Europe, as we all know, Covid was added to many more death certificates as the cause of death than should have been the case.
German statistics provide us with a much more accurate representation of the level of mortal danger i.e not very much for most people. Even Sweden’s figures are inflated (albeit inadvertantly) by the fact that they also made the tragic error of shifting the sick elderly into care homes to create more space in the hospitals. This accounts for about half of their 5,900 deaths.

185762 ▶▶ Achilles, replying to Mayo, 11, #252 of 2327 🔗

Sweden might get away with it? They’ve gotten away with it since May. It is quite clearly a successful strategy. If they’d got it wrong it would have been obvious in Summer and certainly now, there wouldn’t even have been an argument about it. The dead bodies would be piled on the streets with condemnation to follow. Still waiting…still waiting…still waiting…

185777 ▶▶ Julian, replying to Mayo, 11, #253 of 2327 🔗

The Swedes said you could only give final judgement after a year or more. So far on any reasonable measure they are doing way better than the UK.

So what if there is a steady increase in hospitalisations (I mean genuine ones – people with actual covid)? Sad for those affected, but normal. People get ill. Trying to abolish one illness at the cost of all other illnesses and normal life is futile, damaging and insisting on doing so when you know it won’t work is evil.

185791 ▶▶ swedenborg, replying to Mayo, 6, #254 of 2327 🔗

The virus is un-stoppable. It is mainly spread by airborne transmission and being near 1m of any infected also with facemasks risks being infected. All nations (incl Sweden) deviated from earlier practice in flu pandemics plan (all adhered to in 2019) that SD measures should have disappeared after the peak i.e May, June. Sweden despite not having lockdown still had SD which was adhered to in the beginning. Never in the world history have we had SD 6 months after the first wave. It is preposterous to think that you can adhere to SD for such long times. This can be done for a very short time period. Spain is a good example that facemasks are total useless as the natural state of humans is to mingle, even more so using facemasks as a talisman.
We all hoped that the C-19 would disappear after the first wave like Sars but unfortunately it is now a seasonal virus. Now we have the colder weather with a true second wave in all European countries. Sweden has now double hospitalizations and double ICU use compared to the nadir a month ago. But they have a bigger chance to have a lesser wave than other hard lockdown countries. There will be the day of reckoning for all European countries and worst for the ones with the hardest lockdown.
Spain is probably the country with biggest chance of reaching herd immunity this time in Europe as the pandemic is now slowing down there.

186014 ▶▶▶ MiriamW-sometimes-AlanG, replying to swedenborg, 8, #255 of 2327 🔗

I agree with this but I would stick to ‘seasonal’ rather than ‘2nd wave’. That term has become part of the fear-porn. Will next year’s seasonal viruses be the ‘third wave’ etc. This is what the globalist psychos seem to want to brainwash us with.

It beats me why people can’t see that in October, in the northern hemisphere, you will get an increase in respiratory viruses which will continue until the end of winter. Sadly some of these people will die. It happens every year. MW

186267 ▶▶▶ BeBopRockSteady, replying to swedenborg, 7, #256 of 2327 🔗

Yes. Seasonal. And we have created a monster with track and trace, health passporting, social circles and occasions destroyed, health systems at capacity for years to come, unemployment crisis, societal relationships toxified even more, break up of the UK accelerated. The list is endless. All in 8 months.

185732 Censored Dog, replying to Censored Dog, 11, #257 of 2327 🔗

It doesn’t matter whether Biden wins in November or not, the UK political class will not change course and the only thing you can do is to disobey restrictions.

It’s also highly likely that Boris will try to advertise this ‘circuit-breaker’ as a thing the public has to do to ‘Save Christmas’

If you can’t tell, I am very pessimistic at the moment.

185765 ▶▶ Janice21, replying to Censored Dog, 2, #258 of 2327 🔗

Same here. How will they ever turn this around or admit they are and were wrong?!

186006 ▶▶ stewart, replying to Censored Dog, 2, #259 of 2327 🔗

If the Fuhrer does what Starmer is saying he should do then he will look feeble, pathetic and clueless.

Mind you, he doesn’t seem to mind that too much given his track record this year, so can’t rule it out.

186378 ▶▶▶ annie, replying to stewart, 1, #260 of 2327 🔗

Feeble, pathetic and clueless.
An improvement.

187889 ▶▶▶ Adam, replying to stewart, #261 of 2327 🔗

Even Hitler knew what day it was unlike Johnson

187882 ▶▶ Adam, replying to Censored Dog, #262 of 2327 🔗

If Biden wins America deserves all it gets and I hold no particular admiration for Trump either

185735 chaos, 5, #263 of 2327 🔗

Boris and Starmer sitting in a tree.
With Klaus and Gates and Prince Charley.

185737 Basics, replying to Basics, 2, #264 of 2327 🔗

Michael Yeadon

https://threadreaderapp.com/thread/1309793649069260806.html

Yesterday, 2 strikingly similar events tells us the oppressive police state closes in. My sister is visiting her daughter in Lincoln & loves looking after her granddaughter. Daughter & husband go out for a drink as a couple (they’re fit & well, late-20s). No pub would let them… read on via link

186806 ▶▶ chris c, replying to Basics, #265 of 2327 🔗

That is a must-read

185743 GuyRich, replying to GuyRich, 32, #266 of 2327 🔗

The gaslighting is beyond insane now. No such thing as herd immunity? I thought that was the basic premise of vaccines. WHO stating lockdowns don’t work and only serve to increase poverty. What in the actual fu*k are they trying to do to us here. Obviously there is a massive transfer of wealth that has taken place and is continuing to take place but this shit is just going to keep on coming, especially while BEDWETTING retards take the bait. I literally want to rip my own fu*king head off and be done with this but that would give these power hungry scumbags what they want. Can we please, somehow, band together, rush parliament/downing street by the thousands, grab the psychopaths and string the fu*kers up on the nearest lamp posts. For fu*k sake.

185753 ▶▶ Basics, replying to GuyRich, 7, #267 of 2327 🔗

Dipped into google for you, the sacrifices we make…

Top result :
Herd immunity is a form of indirect protection from infectious disease that occurs when a sufficient percentage of a population has become immune to an infection, whether through vaccination or previous infections, thereby reducing the likelihood of infection for individuals who lack immunity. Wikipedia

Next result:
Coronavirus: WHO head calls herd immunity approach ‘immoral’ BBC

185759 ▶▶▶ Country Mumkin, replying to Basics, 3, #268 of 2327 🔗

I’d print that off I were you basics. They’ll come for it and tweak the meaning.

185756 ▶▶ Country Mumkin, replying to GuyRich, 5, #269 of 2327 🔗

It really is gaslighting. Very abusive.

Amazing how effective it is on some people. And those it is most effective on seem to be similar in nature.

185798 ▶▶ Kev, replying to GuyRich, 9, #270 of 2327 🔗

Things are likely to change, and very soon. When furlough ends we could see upward of 6 million people unemployed, many with minimum or even no benefits.

When people have something to lose they won’t take risks, they won’t rebel, they wont protest.

When people have nothing to lose eveything changes for them! If you have no money at all, what difference does a £10,000 fine make to you? You can’t pay it!

Very few people have felt financial hardship up to this point, furlough has protected them from that. In two weeks time that will all change.

As a side point legally, how can the government pay 2/3 of the minumum wage?

186074 ▶▶▶ Bart Simpson, replying to Kev, 1, #271 of 2327 🔗

There’s an excellent graphic here that shows the economic Armageddon that we’re heading to:

https://www.dailymail.co.uk/debate/article-8836699/Britain-not-sacrificed-altar-fighting-Covid-19-writes-Professor-ROBERT-DINGWALL.html

Won’t be surprised that when furlough finally ends, rioting will begin.

187899 ▶▶▶ Adam, replying to Kev, #272 of 2327 🔗

Another reason to rid ourselves of Johnson and his inept privileged entitled knob ridden crew

185745 Adam, 2, #273 of 2327 🔗

Proof Labour is as inept authoritarian and unfit as much as the cons and libs are for public office get rid of the LibLabConSNP now https://www.sdp.org.uk

185746 Country Mumkin, 3, #274 of 2327 🔗

Listened to Toby Young’s and James Delingpole podcast today. Very much enjoyed it. Loved hearing Toby rant on 28 Sept episode. He let rip about the student union and their inability to support the students in prison. Very good listen. I recommend it.

185747 Basics, 11, #275 of 2327 🔗

Good luck and postive thoughts to Simon Dolan and team tomorrow.

185754 Iansn, 1, #276 of 2327 🔗

With this speech by Starmer, SAGE have clearly made this a political argument and have obviously key members have been in discussion with and backed Starmer to push their agenda. Doris needs to snuff this out immediately or it is obvious that everyone in Westminster represents two cheeks of the same ars3. Good cop, bad cop routine – cross party can you beleive thaat.

185763 Thomas_E, replying to Thomas_E, 42, #277 of 2327 🔗

Morning , another depressing day and things are going from bad to worse. Like I said a couple of days ago, I don’t read the articles anymore, I’m depressed enough without them. I sometimes feel like we are just like ants, screaming at a tsunami to turn back. It doesn’t matter any more, the whole political scene is in lockstep with this.The only difference is they try to outdo each other on who can impose more tyrannical living conditions. Nothing matters, no science is allowed but THEIR science. They are now saying that herd immunity (something that has been in the medical books for more than a century is a myth!!). It doesn’t matter if every single doctor in the UK tomorrow comes on television and says this is all bollocks..It will not change one opinion ,one policy, it will change nothing .And all this talk about how they will pay at the next election , blah,nblah,blah…No they wont! Nobody will pay, fucking Hanckok is going to get a knighthood for this !! We are all deludiding ourselfs if we think we can convince anybody. Fuck them! My best friend yesterday told me with a serious face that the The Great Barrington Declaration is fake scinece and a conspiracy theroy..He has 2 degrees from Oxbidge ;-( I give up, I can’t do this anymore, hey have won..I will never take a vaccine or wear a mask but that does not matter because everybody else will be queueing for days to get it..They killed the economy, sports, arts, theater, music, pubs…What else is there left of what once was a great country? Nothing but sheeple and us, the small minority screaming that the emperor has no clothes while waiting for Covid Marshals in black to kick our doors down and check our thinking. 2 years in Afghanistan, IED’s , snipe, mortars, Taliban , militias, friendly fire., landmines, poisoned water, ambushes…none of that could kill me but this surely will. I’m loosing the will to live..

185768 ▶▶ Julian, replying to Thomas_E, 8, #278 of 2327 🔗

Things are indeed pretty terrible, but the tide is turning, albeit very slowly. Don’t let them win.

185778 ▶▶ Censored Dog, replying to Thomas_E, 3, #279 of 2327 🔗

Chin up, mate. We wouldn’t have defeated Hitler with that attitude. Despite everything that is going on right now, this is far from our darkest hour.

185799 ▶▶ Stephanos, replying to Thomas_E, 7, #280 of 2327 🔗

Sorry to hear all this and I do sympathise. Rene’s comment was quite heartfelt I thought. Here’s an idea.
Unless your MP is one of the virtuous ones (unlikely, only about 10% are), remove their wreath from the war memorial (if they have the nerve to put there), tear it up and leave it at the local constituency office with a sharp and bitter comment from an ex-soldier. I presume you are an ex-soldier?
Then put your own wreath there in its place. You are REALLY entitled to do so.

186142 ▶▶ JohnMac, replying to Thomas_E, 3, #281 of 2327 🔗

No, it’ll turn round. The will to be free is greater than the will to control other people, as Dr Vernon Coleman says.

185769 Tyneside Tigress, replying to Tyneside Tigress, 12, #282 of 2327 🔗

If anyone from Sky is looking in, especially Ashish Joshi, regarding the report last night from Warrington hospital ICU.

How staged was your report?

The lady giving an interview from her bed, who had been in hospital since last Wednesday had remarkably fresh nail varnish.

The man who admitted he was overweight and diabetic, but that he felt safe to be where he was – last time I assume, because he was talking so ‘normally’ albeit wearing an oxygen mask, he would have been told to stay at home.

The old man who appeared twice in the report in two different situations. First shown in a chair fumbling with his belongings but with a tube in his nose. Second time, in a bed, looking into the camera in a full face mask, a bit like one of the child actors in a charity video.

Umh..

185800 ▶▶ Basics, replying to Tyneside Tigress, 1, #283 of 2327 🔗

Did not view myself. Were they wearing shoes in bed as ICU patients were seen to be in NYC hospital during Spring, tv reports showed.

Good to remember an American network aired footage from Italy as a New York hospital in Spring too.

Fakery abounds, odd in this day and age in 21st century Great Britain. BBC Panorama Saving Syriah’s Children (not available on iplayer) has been forensically analysed if anyone wants to learn how to look for staging clues.
https://bbcpanoramasavingsyriaschildren.wordpress.com/2020/08/13/saving-syrias-children-notes-for-editors-2/

https://www.ukcolumn.org/insight-saving-syrias-children-worst-case-fake-news

185912 ▶▶ p02099003, replying to Tyneside Tigress, 1, #284 of 2327 🔗

Don’t forget the health care worker from Kuwait saying she watched as Iraqi soldiers took newborns out of their incubators and left them on the floor. Thus ramping up the hatred towards Iraq following the invasion of Kuwait. Except she was the daughter of the Kuwaiti ambassador and was following a script.

186026 ▶▶ stewart, replying to Tyneside Tigress, 10, #285 of 2327 🔗

I’ve stopped watching TV and don’t read any of the main papers. Just can’t do it.

It’s as if my entire life I’ve been happily drinking water from the tap at home, then one day I’ve had a look inside the water tank and found half a dozen dead rats floating in it. After that, I just wouldn’t be able bring myself to drink the water from the tap again. It would make me retch.

That’s how I feel about the BBC, Sky, The Times, The Guardian, the NYT, Bloomberg, the Economist, the whole bloody lot. All of it self serving and reeking of self-importance.

185770 Iansn, replying to Iansn, 6, #286 of 2327 🔗

Posting this again as I think it gives a true idea of what the ‘tests’ are all about.
At £10 test( a very, very conservative estimate after all costs deducted) x 215,000 a day right now ramping up to say 500,000 a day, do you think Serco have vested interest in ensuring that more positive test are turned in every day as this will result in a demand for more testing? Or should they tell the truth and put the real figure out. The same for Hancock agreeing to handing over every persons details from the NHS to these felons so they can message us to download the APP( I am sure Deloitte and all the rest of the cartel cannot belIeve he agreed to that, how about GDPR Mr Hancock, I dont need a f@ kin txt from Delottie to ask me to download the APP.). Thats the real level of the simpletons governing us, totally in the pocket of big business and they are so thick they cant see this.

185779 ▶▶ Kev, replying to Iansn, 1, #287 of 2327 🔗

More likely they do see it, very clearly, and are hansomely rewarded for aiding and abetting these measures.

185772 Awkward Git, 3, #288 of 2327 🔗
185776 zacaway, 5, #289 of 2327 🔗

Reposting this from yesterday, as an antidote to the continuing madness of the headless chickens leading us.

Jason Lenney, Premier of Alberta , Canada has announced the Government of Alberta’s policy is:

We’re not going to enforce our way out of COVID. Alberta’s approach is to focus on the broader health of society – physical, mental, social, and economic – by encouraging personal responsibility, rather than micro-managing people’s lives.

https://mobile.twitter.com/jkenney/status/1316030172148064261

Worth watching the short video/

185784 Basics, replying to Basics, 2, #291 of 2327 🔗

Guardian.
“Covid-19 may cause sudden and permanent hearing loss, experts have found, adding that such problems need early detection and urgent treatment.

“The coronavirus has been found to affect the body in myriad ways, from a loss of taste and smell to organ damage.

“Now doctors have reported fresh evidence that Covid could also affect hearing.”

Is it me or is that written with the styke of a local rag? Anyway, the subline says ‘Study team says Covid-19 patients in intensive care should be asked about hearing loss’.

https://www.theguardian.com/world/2020/oct/13/covid-may-cause-sudden-permanent-hearing-loss-uk-study

185788 ▶▶ stefarm, replying to Basics, 6, #292 of 2327 🔗

Pardon?

185801 ▶▶▶ Basics, replying to stefarm, 2, #293 of 2327 🔗

I SAID….oh never mind!

185806 ▶▶▶▶ stefarm, replying to Basics, 2, #294 of 2327 🔗

Gotta laugh……..

185808 ▶▶ bluemoon, replying to Basics, 2, #295 of 2327 🔗

But so does flu! Loss of smell, loss of taste, loss of hearing. And in some cases these losses are permanent. Doctors should know this!!

185824 ▶▶ NorthumbrianNomad, replying to Basics, 5, #296 of 2327 🔗

Maybe that’s why Johnson can’t hear all the people shouting “INFECTIONS DO NOT EQUAL CASES!!!!!!” and “CANCER MATTERS!!!!!”

185851 ▶▶ Londo Mollari, replying to Basics, 5, #297 of 2327 🔗

Just to point out that if this were true (and it is, I suspect as true as the notion that Cv forces you to get on a crowded train) then face masks don’t help. Many of those with minor hearing loss (like myself) rely to some extent on face and lip reading. Masks make that impossible

185938 ▶▶▶ Adam, replying to Londo Mollari, 6, #298 of 2327 🔗

I also really struggle hearing people from behind their face nappies.

185948 ▶▶▶ Basics, replying to Londo Mollari, 4, #299 of 2327 🔗

Masks have a big impact on commincation for those with good hearing. I can imagine this situation being inexpressably frustrating for anyone relying on lip reading.

Masks to some are the sight of slience.

185953 ▶▶▶▶ Cheshirecatslave, replying to Basics, 5, #300 of 2327 🔗

I’ve good hearing but couldn’t make out a word a masked young fellow at church was saying. Turned out he was offering me a mask. I politely declined.

186058 ▶▶▶ Bart Simpson, replying to Londo Mollari, 1, #301 of 2327 🔗

I don’t have any problems with my hearing but even I struggle to hear and understand people wearing muzzles.

185856 ▶▶ Silke David, replying to Basics, 4, #302 of 2327 🔗

Maybe people THINK their hearing gets worse as people speak at their normal volume and the face covering makes it hard to understand them.
I worked in a cafe and so often had to ask people to speak up so I could take their order correctly.

185937 ▶▶ Adam, replying to Basics, 4, #303 of 2327 🔗

Saw that earlier. Panic, panic, panic….! So does the common cold. I’ve had reduced hearing in my left ear for over ten years following a bad cold. Had grommets fitted 3 times. The list of covid symptoms grows longer by the day.

186827 ▶▶▶ chris c, replying to Adam, 1, #304 of 2327 🔗

Surely it would be shorter to list the symptoms covid doesn’t cause

186305 ▶▶ Nigel Sherratt, replying to Basics, 1, #305 of 2327 🔗

Sorry, can’t hear you with that mask on.

185790 Stockwell, 8, #306 of 2327 🔗

FT’s Alphaville has a very interesting article today arguing that there is natural tendency for people to control the spread of viruses by altering their behaviour to limit the perceived risks to themselves as individuals,

The article quotes the following blog which makes a similar point with plenty of detailed evidence to support it

Reproduction numbers tend to 1 and the reason could be behavioural | VOX, CEPR Policy Portal

It goes without saying that we all individuals adjust our behaviour to provide what we see as the best outcome in any situation. Epidemics are no different. In their case, however, instead of maximising our profits we make the effort to minimise our losses.

The Vox article also makes the point, at the very end, that lockdowns are probably counterproductive. They lull people into reducing the amount of effort the put into individually avoiding the diseases by encouraging them to think the Government is forcing others to do it for them.

It’s the reverse of moral hazard.

185793 stefarm, replying to stefarm, #307 of 2327 🔗
185862 ▶▶ stefarm, replying to stefarm, #308 of 2327 🔗

Birmingham C-19 Walk-through Testing Site .

185794 Sir Patrick Vaccine, 2, #309 of 2327 🔗

Piers Corbyn on setting up anti lockdown groups #OurMovement Action Groups

https://www.youtube.com/watch?v=t3hC7nEp-v4

185796 Adam, replying to Adam, 17, #310 of 2327 🔗

Email from my dad yesterday. Three nurses at my nan’s care home testing positive for the Rona. Obviously a bit concerned in case my vulnerable 96 year old grandmother gets it, but goes to show that lockdown has completely failed in its goal to protect the vulnerable, while simultaneously trashing everyone’s lives. Anyway, further email today saying that one of the nurses testing positive has now tested negative. THE TEST IS SHIT!

185814 ▶▶ Achilles, replying to Adam, 2, #311 of 2327 🔗

…and of course if they’d been knocked down by a bus before that second test they’d now be a Covid death in the figures.

185849 ▶▶▶ Cicatriz, replying to Achilles, 5, #312 of 2327 🔗

They probably still would be as I doubt the negative test will erase the positive one in the statistics.

185819 ▶▶ NorthumbrianNomad, replying to Adam, 4, #313 of 2327 🔗

Yes, but this is also deliberate, I’m afraid. They know that the high “case” numbers among students aren’t going to translate into anything useful, so they’re working as hard as they can to get it back into care homes.

186835 ▶▶ chris c, replying to Adam, 1, #314 of 2327 🔗

I was told there was a “case” in a local care home. She didn’t have any symptoms and no-one else caught it. I suspect there’s a lot of that around. These PCRs go to 11

185797 Caroline Watson, replying to Caroline Watson, 9, #315 of 2327 🔗

Johnson’s response to Keir Starmer should be.
‘OK, we’ll have a short lockdown. And, as advised by the WHO, we will use it constructively. We will call in a highly experienced and successful private sector CEO to do a quick and dirty review of the NHS to establish why it ‘isn’t coping’. They will be told to look particularly at how many staff are off sick or laid off and why, the role of the unions, the influence of BLM, whether time is being wasted on ‘gender’ and other such nonsense, restrictive practices and why so many people catch Covid in hospital. They will also look at why treatment for other conditions is apparently not taking place. At the end of the two or three weeks, they will report to me and their findings will be implemented. If there is more efficiency as a result, they will be asked to do a fundamental, root and branch review of NHS management and systems once this is all over.‘
That’s what Margaret Thatcher would have done! Johnson doesn’t have the ability or the balls!

185816 ▶▶ NorthumbrianNomad, replying to Caroline Watson, 10, #316 of 2327 🔗

Johnson’s response should be the same as Blackadder granting Baldrick a short holiday.

“Very well, Starmer, have a short lockdown. [Pause.] Did you enjoy it?”

185925 ▶▶ Jonathan Palmer, replying to Caroline Watson, 8, #317 of 2327 🔗

Starmer and Johnson are 2 sides of the globalist coin.This is all theatre.At the moment Boris can pose as the defender of liberty while instituting a 3 tier lockdown system from which there is no escape.
I think in a week or a bit more Johnson will ‘cave in’ to the fake pressure and put us into lockdown which has been planned for a few months.
This is not about a virus

186071 ▶▶▶ MiriamW-sometimes-AlanG, replying to Jonathan Palmer, 6, #318 of 2327 🔗

We could save a lot of wasted time and wrangling on here if people would stop believing the politicians’ puppet-show and allow the truth in. It is not a happy process; I know because I’ve had to go through it myself.

Parliamentary ‘democracy’ is an illusion; there is no saviour waiting in the wings. The party leaders, the Cabinet, SAGE etc are all signed up, on the same side and are parroting their lines. What appears to be disagreement is a Punch and Judy show to distract us while the lockdowns continue to break our spirit and trash everything we know.

If we don’t grasp that this is about nearly every world leader implementing the WEF agenda, we’re sunk. If you don’t believe this, compare the language on the WEF website with the content of Johnson’s conference speech Other people have dug out some of Hancock’s old speeches. It’s the same stuff: 4th industrial revolution, T&T, mass surveillance, vaccines, ‘new normal’, everything that’s been there to see (if we cared to) for decades and which escalated so starkly in March under the cover of ‘Covid’. I admit I didn’t really start to get it until towards the end of the first 3 weeks and I feel embarrassed I didn’t see it coming.

We saw a ‘Build back Better’ (notice the 3 word formula) beautifully crayoned on a bridge in Keynsham back in early September and a chill went up our spines. People just don’t/won’t get what’s going on and we fear that many don’t want to.

All of us who do get it have no choice but to resist but we will need clear heads. MW

186491 ▶▶▶▶ JamesDrebin, replying to MiriamW-sometimes-AlanG, 2, #319 of 2327 🔗

It is utterly maddening that so many remain resolutely ignorant – or in denial – of those facts. I call them “Coincidence Credulists.”

186691 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to JamesDrebin, 2, #320 of 2327 🔗

A lot of people on LS still believe in the party system. People seem to think that the SDP or UKIP could save the day. I do not think this can happen. Meanwhile, I note that the Netherlands is now toeing the line:

https://www.dutchnews.nl/news/2020/10/the-netherlands-goes-into-partial-lockdown-face-masks-will-be-compulsory/ MW

186798 ▶▶▶▶▶▶ JamesDrebin, replying to MiriamW-sometimes-AlanG, #321 of 2327 🔗

The machine cannot be stopped.

187280 ▶▶▶▶▶▶▶ janeinthemindfield, replying to JamesDrebin, #322 of 2327 🔗

There has got to be some way out?

187278 ▶▶▶▶ janeinthemindfield, replying to MiriamW-sometimes-AlanG, #323 of 2327 🔗

What must we do? How can we possibly resist this global tyranny?

187304 ▶▶▶▶▶ MiriamW-sometimes-AlanG, replying to janeinthemindfield, 1, #324 of 2327 🔗

All I can advise is to refuse to comply with any of it as best you can and keep telling people the truth about what is going on. This requires getting out and about. Forget social media; it is the reliance on smartphones that has helped to get people hypnotised by fear.

I can not pretend to you that what we face is easy but all I can say is, more people do seem to be doubting the official narrative now. Let’s hope this is enough to stop the process, at least this time. For some good rational scientific discussion to pass on, I recommend this video from Ivor Cummins in conversation with Dr Sebastian Rushworth, an ICU doctor from Sweden. It only tangentially hints at a global agenda but should not ‘frighten the horses’.

https://www.youtube.com/watch?v=w6IeN6sgJ3g MW

188052 ▶▶▶▶▶▶ JamesDrebin, replying to MiriamW-sometimes-AlanG, #325 of 2327 🔗

Excellent advice.

185802 Banjones, replying to Banjones, 8, #326 of 2327 🔗

I do wish people would stop calling them ”cases”. They’re NOT. Dr Lee in the Telegraph set out quite clearly the difference between ”cases” and ”positive tests”:
”….What is a “case” of Covid? Let’s say you developed a viral cold last winter. Were you a “case” of a viral respiratory infection? On a theoretical level the answer must be yes. But on a practical, real-world level, the answer is no: you went to work and carried on with life. You were invisible to the authorities. Let’s say it got a bit worse and you saw your GP. Still no. You decided to take a couple of days off. Still no – you might show up in sick leave statistics, but not as a case of respiratory infection. If you got so far as being admitted to hospital with serious illness, you would show up as a “case” – a tiny proportion of those who actually had the illness.
”The contrast with today is clear. Covid was made a notifiable disease in February, obliging all “cases” to be reported to the authorities. Since the only way to identify Covid is with a lab test, positive tests have been equated with positive “cases”. Back then, it was claimed there were no asymptomatic cases, but we now know that 90 per cent or more of people have Covid asymptomatically. A positive test is clearly not a positive “case”…. .

185812 ▶▶ NorthumbrianNomad, replying to Banjones, 9, #327 of 2327 🔗

They’re all deliberately misusing these words and ignoring anyone who corrects them. The confusion between “case” and “infection” was made abundantly clear months ago but they just don’t take any notice. I’ve given up thinking they might be this stupid. It’s malevolent.

187289 ▶▶▶ janeinthemindfield, replying to NorthumbrianNomad, #328 of 2327 🔗

Do they really want to destroy everything precious that gives life meaning simply for money and power??Surely the elites already have huge amounts of money and power… I can see what is happening and what they are trying to do, but I do not understand why? Whatis the motive? What do they gain? They have everything already…

185803 Londo Mollari, replying to Londo Mollari, 6, #329 of 2327 🔗

Given the apparent idiocy (or malevolence) of Nadine Dorries, Matt Hancock and the others, maybe we should try a different approach. Maybe we should pick an MP, minister or whatever, and do a mass emailing on a particular day. We might have to have a group operation, perhaps under the name of something like “They work for Pharma.”

186296 ▶▶ Nigel Sherratt, replying to Londo Mollari, #330 of 2327 🔗

Idiocy and malevolence seem to be symptoms of ‘Long Covid’.

185805 Janice21, replying to Janice21, #331 of 2327 🔗

N Ireland executive announcing new measures live now.

185810 ▶▶ Eddy, replying to Janice21, 1, #332 of 2327 🔗

The mainland always follows N.I.

185839 ▶▶ mhcp, replying to Janice21, #333 of 2327 🔗

Making me ashamed of where I’m from. You would think actual measurements and calibration of tests would go on, since Ulster is known for its pedantry and stubborness.

But then we did have Eric Smyth as mayor.

185817 Sir Patrick Vaccine, replying to Sir Patrick Vaccine, 16, #335 of 2327 🔗

Dr Matt Strauss
A medic’s case against another lockdown
https://www.spectator.co.uk/article/a-medic-s-case-against-another-lockdown

‘Do no harm’ are three words all doctors must follow in the course of their work. These words make me convinced that Covid-19 lockdowns are the wrong approach, and a growing number of doctors are on my side.

Medical students throughout the West are taught the principles of beneficence and non-maleficence as pillars of medical ethics. In simple terms, they dictate that the likely benefits of our treatments ought to substantially outweigh their potential risks.

In my practice, I prescribe medications like atorvastatin to lower cholesterol, or warfarin to thin the blood, because international, randomised, double-blind control trials have proven that their benefits far outweigh their risks. If I were to prescribe thalidomide (which causes birth defects) for morning sickness, or phen-phen (which causes heart problems) for weight loss, that would be unethical malpractice; their risks outweigh their benefits. Generally, prescriptions for such medications are not allowed because regulatory bodies like the Food and Drug Administration in the US or the MHRA in the UK take them off the market once their disproportionate risks become clear.

If lockdowns were a prescription drug for Covid-19 treatment, the FDA would never have approved it. The seminal Imperial College London paper and other mathematical models like it were used to justify their use, but clinicians would never prescribe a drug or propose a surgery based on such modelling. The now well-publicised failure of these models to accurately predict Covid-19 outcomes proves the rule.

Luckily, we no longer have to talk about mathematical models. We now have seven months of real-world data to look at. Some pundits compare Sweden to Norway to argue for lockdown. Others compare Sweden to the UK, or Florida to New York to argue against. Either sort is vulnerable to accusations of cherry-picking the data. In medical science, we rely on epidemiologists to take all the available data from all the countries and perform statistical analyses to correct for as many different variables as possible.

This has now been done for lockdowns. In August, the Lancet published an analysis of data from 50 countries. The researchers found that full lockdowns were ‘not associated’ with decreased mortality from Covid-19. These are hard outcome data; reality cannot be waved away with theories or projections.

So much for the purported benefits. What about the risks? We cannot answer this question fully because a worldwide lockdown experiment has never been run before. However, evidence for the harms of lockdown is now piling up. In the US, homicides are up 50 per cent compared to last summer. In France, domestic violence calls are up 30 per cent. In Canada, almost three times more people are contemplating suicide compared to last year; and in British Columbia, overdose deaths have tripled from pre-pandemic levels. When you deprive children of their education, adults of their livelihood, and elderly people of their social connections, desperation and despair quickly set in. While a thoughtful person might have predicted this, the mathematical models did not.

All of these numbers fit with what I see in my clinical practice. I have personally admitted dozens of elderly people to hospital with illness resulting from social isolation and neglect. Some were literally starving to death. One patient, in her eighties, lived in a retirement community but relied on family members to feed her meals. When they were socially distanced (banned) from the premises, she couldn’t feed herself and her health quickly deteriorated. Another patient, a 92-year-old woman, simply gave up on life and started refusing her meals once her family stopped coming to visit. Both these scenes were catastrophically inhumane and will stick with me for a long time. Neither is captured in the government’s Covid-19 statistics.

So if a physician were to prescribe a lockdown to a savvy patient who asked about the risks, the physician would have to disclose that depression, suicide, homicide, overdose, wife-beating, and starvation are potential side effects. Rare is the patient who would agree to take such a pill, which brings me to the other pillar of medical ethics: autonomy. Physicians do not force treatment on competent, non-consenting patients. When we discuss treatments with patients, we strive to ground those discussions in the patient’s values and not our own.

185818 ▶▶ Sir Patrick Vaccine, replying to Sir Patrick Vaccine, 28, #336 of 2327 🔗

I am a life-support specialist. At this point in my career, hundreds of elderly patients have instructed me not to put them on life support. Many have told me they are comfortable with their mortality and that if not much time is left to them, they would rather spend it eating ice cream or listening to music with their family, not hooked up to my machines. It is not for me or the SAGE group to tell such a person what they ought to decide. These are questions of values, not medical science, and values are personal.

It would be deeply unethical for me to put such a patient on a ventilator against their wishes. It would likewise be deeply unethical for the SAGE group to commit such a person to social isolation. I know that reasonable, educated people can decline to consent to further lockdowns because I, for myself, do not consent to further lockdowns.

185830 ▶▶▶ mhcp, replying to Sir Patrick Vaccine, 2, #337 of 2327 🔗

This reminds me of the Charlie Guard case where the parents initially wanted to take the child to the US for treatment, then just to the house. At each stage the medical establishment were against it and got the courts involved.

At no point was the fact that at that stage medical advice was no more use than the parents’ own thoughts. At no point was it made apparent that “Do No Harm” is not the sole edict of medicine. You can do social harm which they did by preventing the parent’s have final say when all medical attempts had failed.

So it’s no surprise that the primacy of medicine is strong in this country. Or that most of these medical specialists have no fucking clue about actual science and measurement. They do not ever seem to ask “How was that measured?” before using it to drive guidelines.

Which if all the engineers took this approach you’d be dead in so many ways from the things your take for granted.

185837 ▶▶▶ Achilles, replying to Sir Patrick Vaccine, 4, #338 of 2327 🔗

Simple really isn’t it when you put it like that? At the moment though the quality of human life seems to be irrelevant, it’s all about the statistics.

185896 ▶▶▶ Caroline Watson, replying to Sir Patrick Vaccine, 12, #339 of 2327 🔗

Absolutely. My grandfather, a stoic old countryman, died in the mid 80s at the age of 82. We don’t know what he died of, although his weight loss and obvious pain indicated cancer of some kind; his attitude was, ‘When your number’s up’, and he refused doctors and dreaded hospitals. On his last day, the ambulance came to take him to hospital, but was turned away on arrival because he was dead. He was determined not to be ‘messed about with’ and to die in his own bed, and that is what happened.
Many would criticise us for not insisting that he had medical treatment but he was determined to do it his way and I am proud that he did. That attitude is still there in the older generation, particularly in country people, and they should be listened to.

186148 ▶▶▶▶ Awkward Git, replying to Caroline Watson, 1, #340 of 2327 🔗

Good for him.

This is what my wife and I plan as well.

186866 ▶▶▶▶ chris c, replying to Caroline Watson, 1, #341 of 2327 🔗

Yup. I have reason to believe I’m not going to live much longer and to be honest it’s a fucking relief.

If he HAD gone to hospital what would they have done? Euthenised him by starvation and called it the Liverpool Care Pathway?

185826 HoMojo, replying to HoMojo, 2, #342 of 2327 🔗

Are some more people managing to join up the dots yet? I keep on asking myself, why do they want to keep on testing, testing, testing? And give people an incentive to having the test by paying them? To get the numbers up, sure. But why do they want to get the numbers up when these positives aren’t actually ‘ill’? To lock us up. But why? To cover up their incompetence? Really? By demonstrating more incompetence? And then you look at one of the most draconian lock downs on the planet, with virtually no virus at all, but the alleged reason for the lockdown and maybe you begin to ask yourself ‘surely something’s not right here? But I’ve always been reluctant to be associated with those conspiracy theorists. But then again….’ https://www.youtube.com/watch?feature=share&v=R8OMTkmyKEA&app=desktop

185838 ▶▶ chaos, replying to HoMojo, 7, #343 of 2327 🔗

Thje great reset isn’t a conspiracy. Boris and Biden and Big Teeth in NZ and the Imran Khan guy and other wankers all use the WEF slogan build back better. All talk of bicycles and windfarms and digital ID in the wake of covid. The great reset has been mentioned more than once by Boris, Charles.. and been in more than one mainstream media source. You could have linked to a more mainstream one e.g. Sky News Australia, Spectator Australia, Spiked, The Guardian, The Telegraph, Delingpole… Boris’ own speech in Greenwich in February. The Lockstep document was published a decade ago. In plain sight. It’s what they do. Somewhat occultist. Hidden yet in plain sight. Like PNAC. Only I supported PNAC. Better American hedgemony than Chinese. Better the devil you know.

185888 ▶▶▶ leggy, replying to chaos, 1, #344 of 2327 🔗
185932 ▶▶▶ HoMojo, replying to chaos, 2, #345 of 2327 🔗

I know it’s not a conspiracy but there are those reluctant to believe that what is going on can actually happen because it just seems too ‘sci-fi’ and no-one wants to appear gullible. I wasn’t sure what was going on in March but by about end of May I was convinced of it. And as every day passes, with unbelievable scenarios like that in Melbourne, it seems more and more obvious to me, yet people are still in denial. Pretty sure Toby is still in the ‘incompetence is the explanation’ group.

186035 ▶▶▶▶ leggy, replying to HoMojo, #346 of 2327 🔗

It’s clearly a conspiracy. What it isn’t is a conspiracy theory.

185829 Basics, 1, #347 of 2327 🔗

It looks to my untrained eye that the Spire of doom on the graph to-the-moon toppled forwards. The ‘forgotten/excelled’ numbers pushed into the future to lie on top of the following week.

Has there been an official announced resolution to the lost 16,000? How were they added to the numbers?

185832 Janice21, replying to Janice21, 2, #348 of 2327 🔗

Cant help but think of that gentleman Captain Tom Moore who did that walk to raise money for the NHS……..if only he knew!!!!

185842 ▶▶ Achilles, replying to Janice21, 7, #349 of 2327 🔗

Credit to him for getting up and doing something for what he believed in but shame on those who through this lockdown are probably throwing away every 24 hours the equivalent of what he raised in total.

185854 ▶▶▶ Eddy, replying to Achilles, 1, #350 of 2327 🔗

There was also a woman aged 100 doing 500 stand-ups from her chair. That’s some farting.

185845 ▶▶ stefarm, replying to Janice21, 10, #351 of 2327 🔗

Is he still walking??

A wonderful bit of brainwashing propaganda and for what a duet with Michael ball and an interview with cunty balls Piers Morgan.

186505 ▶▶▶ JamesDrebin, replying to stefarm, 1, #352 of 2327 🔗

That duet was so incredibly painful to listen to. Not just because it sounded objectively horrible – it was the mawkish, fawning tone that marked it out as yet another deliberately emotionally manipulative exercise. It was like X-Factor sob-story chav-bait on steroids. Yuck.

185886 ▶▶ leggy, replying to Janice21, 4, #353 of 2327 🔗

Haven’t the Government used him today for some more propaganda? Advertising 1/3 off railcards for ex-servicemen? Thought he’d been made a honourary Colonel too.

185833 Graham, replying to Graham, 2, #354 of 2327 🔗

I was encouraged by the article in the Daily Mail about Nelson’s letter, but I wish they would at least try to get their facts right on matters that, though not important to the argument, make them seem silly. They describe “the letter on yellowing parchment” then give a picture showing a letter on off-white paper. I suppose to the DM any type of old paper is “parchment”.

185841 ▶▶ Dan Clarke, replying to Graham, #355 of 2327 🔗

Who wrote the article, was it Sam or Liam?

185834 Dan Clarke, 1, #356 of 2327 🔗

This is nothing to do with a low mortality virus and The only way to predict the future is to create it.

185836 merlin, replying to merlin, 3, #357 of 2327 🔗

When will tory brexiteers ( or Farage) realise that starmer/johnson dreamteam will not deliver brexit. A government of national unity is more likely.

185847 ▶▶ Eddy, replying to merlin, 5, #358 of 2327 🔗

The UK now officially a one party state from yesterday.

186617 ▶▶ Cranmer, replying to merlin, #359 of 2327 🔗

It’s possible that the Tories are pushing ahead with Brexit because it could make a useful excuse in the future as to why the British economy has collapsed. It wasn’t the Lockdown, it was Brexit.

185846 Dan Clarke, replying to Dan Clarke, #361 of 2327 🔗

Well according to the DM, the teams are The Sage and The Hawks.

186289 ▶▶ Nigel Sherratt, replying to Dan Clarke, #362 of 2327 🔗

aka The Band

185848 Basics, 3, #363 of 2327 🔗

Always impressive to see above the line variety, accuracy, skill and diversity. Today, finally, I can pick a hole in something.

It is written, ‘Even SAGE admits they’re making it up as they go along.’

Now, it may be subjective to say but that is one lofty ‘Even’. I suggest SAGE have mired themselves and the reputation of wider critical scientific thought from the start.

SAGE don’t deserve that ‘Even’. They deserve no repect. Particularly when one considers the evils of SPI-B.

185852 Awkward Git, replying to Awkward Git, 10, #364 of 2327 🔗

Had an answer back from Morrison’s about their HSE breaches:

“Thank you for contacting us.

We will be following Government guidelines to keep our customers and staff safe.

Kind regards “

So I thought screw it, stir up some shit:

Thank you for the answer even if it does not address the real issue and is quite pathetic.

Couple of points for Morrison’s legal department and top management:

1 – guidelines and guidance have no force in law in England and are unenforceable

2 – businesses must do a risk assessment of their own complete with research and proof the mitigations are appropriate, proportionate and will work as “I was just following guidelines” is not an acceptable defence

3 – Health and Safety legislation is paramount as it is an Act of Parliament and the Coronavirus legislation is a Statutory instrument.

4 – the company is putting the health and lives of it’s staff at risk due to HSE the breaches (no briefing, lack of risk assessment, lack of training and so on) I highlighted and they are now liable for an investigation and fines if any of the staff become ill and make a complaint

5 – it is not as simple a matter as saying “Government says it is law for staff to wear a mask”. Government know this and they also know about point 3 above which is why the “in close contact” is in the S.I. – the onus and responsibility now rests with the company to prove what is “in close contact with customers” by risk a assessment plus it gives the company a way out. All the company has to do is say “our staff are not in close contact with customers at any time, no masks required”.

6 – Government cannot be held to account for any illnesses or deaths of staff due to the policy as they have included a get out clause – their defence “the company did not do a full and proper risk assessment, made staff and customers wear a mask when they did not have to, ignored exemptions and so on, don’t look at us judge not our fault”.

Regards”

Found this quote today:

“Never underestimate the power of a few committed people to change the world. Indeed, it is the only thing that ever has.”
~ Margaret Meade

186531 ▶▶ Paul M, replying to Awkward Git, 1, #365 of 2327 🔗

Sock it to ’em. I do hope they have done the necessary face fit tests too given that masking is PPE. This should be in their risk assessment. Also, there are studies/comments surfacing regarding a rise in lung/face/mouth infections and ill health from mask (or face covering) wearing. I agree that employers certainly would be liable in cases where wearing such things resulted in ill-health and, as you have stated, cannot fall back on ‘we were following guidelines’.

185853 Tom Blackburn, 4, #366 of 2327 🔗

What I am enjoying – whatever people’s opinions – is that they are referring to source documents when coming to conclusions. Nobody, and I mean NOBODY is willing to unquestioningly accept spoon-fed info from Pfeffel.

185857 Awkward Git, 2, #367 of 2327 🔗

Kier Starmer – only MP in this sitting of Parliament asked to join the Trilateral Commission.

Found this on a Labour supporting site:

https://labourheartlands.com/sir-keir-starmer-the-establishment-candidate-the-labour-leadership-race-and-the-trilateral-commission/

I guess even his own party don’t like his links to it.

185858 Eddy, replying to Eddy, 1, #368 of 2327 🔗

FOUR people under 20 have died of covid since March without any underlying medical problems.

185877 ▶▶ Lockdown Truth, replying to Eddy, 10, #369 of 2327 🔗

My money would be on those being undiagnosed heart conditions anyway. 12 young people under 35 die this way every week in the UK! That would be nearly 400 since March.

The partner of a colleague of mine died suddenly and they had to send their heart to Italy for a test to confirm. I bet they just stick Covid on the death certificate for an eastbound life in some cases.

185918 ▶▶ Caroline Watson, replying to Eddy, 8, #370 of 2327 🔗

A few years ago, a colleague in her thirties died suddenly of ‘flu. If she had an underlying condition, she wasn’t aware of it. Obviously it was terribly sad for her family but things like that have always happened. These people are trying to abolish death!

186630 ▶▶▶ Cranmer, replying to Caroline Watson, #371 of 2327 🔗

Indeed – the only ‘pandemic’ is the inability of modern man to face his own mortality.

185860 Nobody2020, replying to Nobody2020, 12, #372 of 2327 🔗

Not sure if I’ve posted this before but it may help some people who are finding things mentally tough:

There was a study done in mice whereby one group was fed at regular intervals and another at irregular intervals, then the food was stopped. The group that was fed regularly started showing distress when food didn’t arrive as expected. The other group carried on as normal. It’s thought that the irregularly fed group just considered it the normal course of events as there would be no expectation of getting fed at any particular time.

Most people probably like routine, it provides comfort knowing things will happen as expected. Few people will like to be on constant alert not knowing what is around the corner.

So when things happen that break our routines it can be a little distressing (like for the regularly fed mice). Everything changes and if it’s a slow gradual change then we adjust with it and hardly notice. However if it’s a quick dramatic change then it puts us immediately on alert.

Consider being less regimented in life and accept that things can change. That’s not to say you can’t change back in future but maybe by being a bit more random in certain aspects of life then it may help when changes inevitably come.

185997 ▶▶ Jpeg, replying to Nobody2020, #373 of 2327 🔗

I appreciate this, thank you 🙂

185861 Jules, replying to Jules, 6, #374 of 2327 🔗

NI governed by psychos. Four weeks should finish their economy once and for all. I wonder if the army will be on the streets to keep order? It worked so well last time.

185865 ▶▶ Eddy, replying to Jules, 3, #375 of 2327 🔗

All bought and paid for. Treason.

185924 ▶▶ Ewan Duffy, replying to Jules, 4, #376 of 2327 🔗

So many in NI are on the State payroll that they won’t notice it and if they do, they will just bleat “Peace Process” over and over until London bungs them some more money.

185864 RickH, replying to RickH, 7, #377 of 2327 🔗

The summary of SAGE minutes reviewed in “ SAGE advice – Whitty vs. No. 10 – Triangulation issues ” is interesting.

… but not for any scientific insights, of which there are none in any meaningful sense.

Instead we see a group that has been mainly notable for the poor quality of its advice seeking to maintain a finger hold on shreds of credibility by rehearsing already discredited arguments whilst ducking the key revelation – that Covid was never the plague that was billed, and that focus needs to be on getting society back to normal functioning.

The issues are cloaked in the absurd ‘health’ v. ‘economy’ duality which, as we know is a false opposition believed only by simpletons and numpties.

That the politicians are – far too late – recognising that decisions are in the realm of politics is a small step forward. But the ‘neither one nor t’other’, weak footling compromise by the cabinet is not really much of an advance. We are still deeply in the mire of a deeply misconceived analysis and the damaging measures that result.

185868 ▶▶ RickH, replying to RickH, 8, #378 of 2327 🔗

… and I note this :

It is nonsense for Hancock to compare SARS-CoV-2 to malaria, measles and Aids they are completely different types of virus.”

… and this is the guy who is in immediate charge of this shit-show? Totally bereft of even the most basic insight – as was shown in his ignorance about PCR testing.

Scottie !!! Where are you?

185876 ▶▶▶ matt, replying to RickH, #379 of 2327 🔗

Cf my various rants on this topic today and yesterday

185878 ▶▶▶ John P, replying to RickH, #380 of 2327 🔗

Who is that quotation attributable to?

185889 ▶▶▶▶ RickH, replying to John P, #381 of 2327 🔗

It’s from the commentary on Hancock’s utterances (above)

185870 ▶▶ Will, replying to RickH, 2, #382 of 2327 🔗

We are but, now that Starmer has broken cover, there is a clear incentive for Johnson and the Tories to start downplaying the danger of the virus. Something which is already being evidenced in the Telegraph and Mail this morning with strong anti SAGE articles. I wonder whether Starmer will come to reject backing another lockdown, I strongly suspect he will unless we see a tsunami of deaths which you and I both think is unlikely.

185884 ▶▶▶ RickH, replying to Will, 2, #383 of 2327 🔗

The trouble is – to be a pessimist – both Johnson and Starmer now have a vested interest in keeping up perceptions of a ‘lethal’ virus and the Fear narrative, whatever actually happens.

185898 ▶▶▶ steve_w, replying to Will, 1, #384 of 2327 🔗

This is a perfect opportunity for Boris to do a Sweden. Ask every SAGE member if they are in favour of lockdowns or not. If they are – sack them – they are anti-science WHO disregarding lunatics

186637 ▶▶▶▶ Cranmer, replying to steve_w, #385 of 2327 🔗

Good point. The WHO u-turn on lockdowns is one of the few pieces of good news I have heard recently. Not because I have an ounce of respect for the WHO, but because they tend to be held up as shining beacons of truth by the globalist authoritarians who run things in this country.

185867 John P, replying to John P, 7, #386 of 2327 🔗

Yes, I think Starmer is motivated by the opinion polls, which I personally don’t believe are representative of public opinion. Certainly there is little enthusiasm from people I know for another lockdown.

Both my parents and one of my sisters have holidays planned this week. I know they are not in favour of more lockdowns. They’ve already had to cancel holidays this year.

I sent via e-mail a clip of Nabarro (of the WHO’s) piece – in which he rages against lockdowns to Andrew Neil – over to my MP, who is a Labour cabinet member.

Despite giving him a piece of my mind earlier this year, my MP again seems to be on “speaking” terms with me and is answering my e-mails. (I have met him in person.)

It does seem to take a week or two for him to respond though, so he may not receive my latest until next week.

I don’t hold out much hope of it making a difference, but it may at least reduce his confidence in lockdowns as a policy.

185885 ▶▶ Tom Blackburn, replying to John P, 8, #387 of 2327 🔗

Starmer has misjudged this entire episode (and the political value he can exploit from it) very, very badly. This is from someone who voted for him in the leadership election – I don’t think I’ll ever vote Labour again now.

185909 ▶▶▶ Caroline Watson, replying to Tom Blackburn, 7, #388 of 2327 🔗

And me. I rejoined to vote in the leadership election but left because he wouldn’t condemn the misogyny against women fighting to keep men in frocks out of female only spaces. If I hadn’t, I’d have left over this. He is listening to the public sector unions and ignoring the working class.

186008 ▶▶ Mayo, replying to John P, #389 of 2327 🔗

Yes, I think Starmer is motivated by the opinion polls, which I personally don’t believe are representative of public opinion.

They pick up the general sentiment. And several polls were virtually spot on in the last GE.

185869 kf99, replying to kf99, 5, #390 of 2327 🔗

In better news Salvage Hunters is back tonight, first time since all this started. Hope it hasn’t gone ‘covid’.

I love the way it celebrates proper craftmanship and practical engineering skills. A world away from the PPE graduates and mainstream media that’s ruining everything.

185899 ▶▶ KBuchanan, replying to kf99, #391 of 2327 🔗

Agree,it’s the only terrestrial telly worth watching.

186112 ▶▶ arfurmo, replying to kf99, 1, #392 of 2327 🔗

Why sell to Drew for £1000 so that he can sell for £3000 when ebay or similar might have got you £2000? Always puzzled me that.

186648 ▶▶▶ Cranmer, replying to arfurmo, #393 of 2327 🔗

I also love the way Drew buys a table for, say, £50, and Alex the French Polisher replaces the legs and the top, taking 100 hours to make what is basically a new table (like Trigger’s Broom) and then Drew says ‘great, I reckon I can get at least £100 for it now!’ With a grasp of economics like that, maybe he should be in government!

186642 ▶▶ Cranmer, replying to kf99, #394 of 2327 🔗

Thanks for the tip – it’s one of my favourite programmes. Although I prefer the spin off series, ‘The Restorers’, as I find it more interesting to watch Drew’s old junk being restored than Drew pulling it out of sheds and haggling for it!

185873 Tim Bidie, replying to Tim Bidie, 2, #395 of 2327 🔗

So there we have it, the leader of the political party responsible for so much of the shambles that goes to make up the Democratic Socialist Big State Britain of today…..intent upon making it even worse……

If nothing else, the Prime Minister is lucky in his enemies….

185956 ▶▶ RickH, replying to Tim Bidie, 2, #396 of 2327 🔗

Yawn.

More reality denial.

Doesn’t really help to peddle simple -minded political allegiance as a diversion.

185880 PaulH, replying to PaulH, 25, #397 of 2327 🔗

Another excellent edition of “Sceptics”. But the longer this sinister pantomime goes on, the more convinced I become that there are powerful forces in the background driving this agenda on.

Why do I say this? Because no matter what arguments and evidence is produced in places like this to show that we could go back to normal, it is all like water off a duck’s back to those in authority. The scales are hopelessly tilted against the Gupta’s and Heneghans.

And everything that the so-called “conspiracy theorists” (is anyone still laughing at David Icke now?) have warned about since March is unfolding before our eyes. “Lockdown” then muzzles, and it is obvious from what Hancock says that soon it will be coerced vsccines then health passports.

It is like they are reading off some nightmarish script that goes way above their pay grade. Freedom will soon be a thing of the past in Johnson’s shiny new technocratic dystopia.

185891 ▶▶ John P, replying to PaulH, 11, #398 of 2327 🔗

the longer this sinister pantomime goes on, the more convinced I become that there are powerful forces in the background driving this agenda on.

Yes, I know, and woe-betide any of us who dare to take issue with this!

I wrote a huge long comment about the fallacy of this a couple of days ago.

All you are doing – whether you realise it or not – is letting the guilty party off the hook.

The guilty party being Johnson’s government.

I think some people here would be happy for Johnson, Hancock and their cabal walk free at their trial and instead rage against Bill Gates.

Thank God it’s not 1945 or Hitler could have walked away scot free.

JOHNSON AND HIS GOVERNMENT ARE LEGALLY (AND IN FACT) RUNNING (RUINING) THIS COUNTRY. NO-ONE ELSE.

185903 ▶▶▶ HoMojo, replying to John P, 6, #399 of 2327 🔗

You don’t exonerate the lieutenants because the generals give the orders.

185906 ▶▶▶ PaulH, replying to John P, 9, #400 of 2327 🔗

I try keep an open mind – and believe me , I would love to be completely wrong about this.

As for Johnson and his cabal, don’t worry about them. Nuremberg showed once and for all that “following orders” is no defence at all.

They are definitely on the hook for the devastation that they have caused.

185920 ▶▶▶▶ RickH, replying to PaulH, 3, #401 of 2327 🔗

Mmmm … the key to Hitler’s defeat and the trail leading to Nuremberg was Russia, and the squeeze from two directions.

Where’s our ‘Russia’?

Actually – Where’s our western front??

185951 ▶▶▶▶▶ Julian, replying to RickH, 2, #402 of 2327 🔗

Trump?

186002 ▶▶▶▶▶▶ Mayo, replying to Julian, #403 of 2327 🔗

He’d better get on with it pretty quickly then. He’s only got until Nov 3rd. I’m afraid it’s not looking at all good for him at the moment.

186201 ▶▶▶▶▶ Nick Rose, replying to RickH, #404 of 2327 🔗

Or any front for that matter. There’s not even been a Gallipoli or Dunkirk.

185919 ▶▶▶ Telpin, replying to John P, 3, #405 of 2327 🔗

Couldn’t agree more. It is THIS government that is choosing to issue a plethora of regulations by edict (SIs) with no attempt to justify them evidentially still less to carry out any regulatory impact assessments. Lay the blame where it lies.

185921 ▶▶▶ Dan Clarke, replying to John P, 4, #406 of 2327 🔗

Under orders, I can remember reading that when Johnson was informed of what was on the cards, he said, ‘we wouldnt fall for it’, obviously told we/he had no choice and so the compliance began with the first obedient lockdown.

185943 ▶▶▶ Jonathan Palmer, replying to John P, 3, #407 of 2327 🔗

As far as I know no one on here who leans to the conspiracy side wants Johnson off the hook.
And your analogy is wrong,Hitler is the orchestrater.Johnson is a Gauleiter.Metro Mayors are concentration camp commandants

186047 ▶▶▶ RichT, replying to John P, 3, #408 of 2327 🔗

It is becoming harder to deny the attempts by such as the World Economic Forum, to capitalise on this whole nasty event. It is very much in their interest to keep us in a state of panic, so that they can push their whole Great Reset and Fourth Industrial Revolution agenda upon us.

This kind of takeover has been tried before.

In the heat of the Great Depression during the 1930s, prominent scientists and engineers proposed a utopian energy-based economic system called Technocracy that would be run by those same scientists and engineers instead of elected politicians. Although this radical movement lost momentum by 1940, it regained status when it was conceptually adopted by the elitist Trilateral Commission (co-founded by Zbigniew Brzezinski and David Rockefeller) in 1973 to be become its so-called “New International Economic Order.”

Technocracy rising : the Trojan horse of global transformation by Patrick Wood

The name might of changed but the agenda is the same.

see also

https://www.technocracy.news/looking-backward-technocrat-told-ohio-residents-in-1938-that-utopia-lie-straight-ahead/

186208 ▶▶▶▶ Nick Rose, replying to RichT, 2, #409 of 2327 🔗

There were lots of totalitarian ideas floating around in the 30s. It doesn’t mean they were taken seriously. Every crisis has those pushing an agenda and this is no different. Doesn’t mean they’ll get their way. Remember anything new MUST be better than what went before, or it will fail. Even the Nazis needed 14 years of chaos before coming to power. Even then that was by mistake.

186320 ▶▶▶▶▶ RichT, replying to Nick Rose, #410 of 2327 🔗

I agree, the Technocracy movement lost momentum in the 40s due to the economic recovery and then the 2nd world war. But please do not underestimate the power of the WEF, they have many friends in high places. Most relevant to us are Matt Hancock and Devi Sridhar.

Whilst our main point of attack must be debunking the governments poor startegy we still need to ask #whyaretheydoingthis?

185923 ▶▶ AngloWelshDragon, replying to PaulH, 4, #411 of 2327 🔗

I am not laughing at David Icke. We would get far more traction with the man in the street if he hadn’t attached himself like a limpet mine to the cause. frankly if David Icke didn’t exist, the NWO would have had to invent him.

185942 ▶▶▶ PaulH, replying to AngloWelshDragon, 5, #412 of 2327 🔗

In the past I generally viewed him as a bit of a harmless crank, nothing more. And I know a lot of sceptics get annoyed with him, as they think he damages the cause, but I doubt he does much harm.

What I have noticed is that since March the government have appeared to be doing whatever they can to validate his theories.

185945 ▶▶▶ Jonathan Palmer, replying to AngloWelshDragon, 4, #413 of 2327 🔗

The problem with Icke is that although he speaks a lot of sense it’s mixed up with a lot of nonsense.

185999 ▶▶▶▶ RichT, replying to Jonathan Palmer, 1, #414 of 2327 🔗

I think he has got most of his accurate info from Patrick Woods work, he has been investigating “Technocracy” for years. Patrick comes across as a very sensible and sane man, unlike David.
please visit his website and also watch some of his Youtube videos.
https://www.technocracy.news/

186213 ▶▶▶▶ Nick Rose, replying to Jonathan Palmer, #415 of 2327 🔗

Just summed up every conspiracy theory ever there! Thank you

185987 ▶▶▶ RichT, replying to AngloWelshDragon, 1, #416 of 2327 🔗

David Icke has been earning a decent living for years, most of his ‘research’ is just copying other peoples work. So Icke has been right about some of what he says, but tends to pad out with a lot of BS. You are right that his envolvment does not help the cause.

186193 ▶▶ Nick Rose, replying to PaulH, #417 of 2327 🔗

Yes, I’m still laughing at David Icke. Sorry if you’re a fan.

186281 ▶▶▶ Mark, replying to Nick Rose, #418 of 2327 🔗

That Mark might be a fan, but I’m not. And I’m the usual Mark here.

186358 ▶▶ Edward, replying to PaulH, 1, #419 of 2327 🔗

I’ve not read Icke’s scribblings other than what I’ve seen reported, but the “lizard people” thing which is often used to discredit him could have been a figure of speech and not meant to be taken literally. Similar to the saying about Trump: his supporters take him seriously but not literally, his opponents take him literally but not seriously.

185881 mhcp, replying to mhcp, 21, #420 of 2327 🔗

I’m all for Lockdown II provided all the public servants will donate their salaries to the private sector and business owners for 6 months. So no money for you great “servants” of the people. So noble. So stunning and brave.

Also politicians should bring a sleeping bag and stove for prolonged living in the Houses of Parliament.

185894 ▶▶ steve_w, replying to mhcp, 5, #421 of 2327 🔗

Rishi has tried to help but the effect of free money is just to make people happy to lockdown

185907 ▶▶▶ Dan Clarke, replying to steve_w, #422 of 2327 🔗

They will keep reducing it, until the out of work have a, what they believe to be, a sustainable level.

185895 ▶▶ KBuchanan, replying to mhcp, 18, #423 of 2327 🔗

All valid arguments, the whole thing is middle class (full or large % of pay) to work at home online as against working class impossible to work from home as plumber,builder,van drive, shop worker etc etc. I suppose you could say NHS workers can’t work from home either. Frankly though I am so sick of the masses of “Health workers” happy to go along with this charade I honestly want to throw a brick at houses with the thank you NHS signs on them. For context I am a 54 year old female who is not usually violent!

185900 ▶▶▶ mhcp, replying to KBuchanan, 10, #424 of 2327 🔗

My missus is a nurse and also does agency work. While I don’t want to bite the hand that feeds me, a wake-up call needs to be made and the best place is in the pocket.

A lot of people who have always worked in the public sector or who are permanent employees have no idea what it means to build a company or small business. Which consists of something like 80% of our economy.

Madness.

185946 ▶▶▶ Two-Six, replying to KBuchanan, 2, #425 of 2327 🔗

The NHS death cult rainbows

186739 ▶▶▶▶ Cranmer, replying to Two-Six, #426 of 2327 🔗

To be fair, a lot of those rainbows are looking distinctly shabby and faded now, and many have been taken down. In my village a lot of them got replaced by VE Day 75th Anniversary decorations. I haven’t seen any new NHS decorations for a long time.

185950 ▶▶ RickH, replying to mhcp, #427 of 2327 🔗

I despair at those falling into the Johnson ‘divide and rule’ trap of setting up the bone-headed duality of public v. private. It’s as stupid as falling into the Fear trap.

185973 ▶▶▶ KBuchanan, replying to RickH, 4, #428 of 2327 🔗

A good point but it does stick in the craw that NHS staff had discounts and preferred shopping hours while delivery drivers ( many of whom will have young families) get nada! I don’t have delivery drivers among my friends and family but I can clearly see when some get the shitty end of the stick.

185890 NorthumbrianNomad, 16, #429 of 2327 🔗

I’ve always wondered why Keir Starmer always looks into the camera as if he’s about to burst into tears and confess.

Now I know.

185902 Frank Garrett, 9, #430 of 2327 🔗

Remember ‘the great reset’ proposed by the World Economic Forum. This is what they want, less travel for the plebs, guaranteed government income, crippling taxes to pay for it.

185910 Awkward Git, replying to Awkward Git, 3, #431 of 2327 🔗

I think we should all use this form to ask Wankcock how he thinks malaria and AIDS are the same as measles and covid-19:

https://contactus.dhsc.gov.uk

185947 ▶▶ Awkward Git, replying to Awkward Git, 13, #432 of 2327 🔗

Put my questions in, they give you 3000 characters so you can let rip:

Mr Hancock, our illustrious Secretary of State for Health said yesterday in his speech about herd immunity that “Many infectious diseases never reach herd immunity, like measles and malaria”.

Malaria is caused by an infected mosquito biting the individual and cannot be passed human to human.

Can he please explain to the nation how malaria and AIDS are similar to flu and how herd immunity does or does not works with them?

This one statement shows how ignorant he is of medical or science matters and is unfit to hold the position he is in.

Can he also explain the following:

1 – Department of Health and Social Care Reference FOI-1240596 answer stated that a positive PCR test means nothing medically.

The actual quote: “SARS-CoV-2 RNA means the RNA is present in that sample at that point in time. It does not mean that the patient has the novel coronavirus (COVID-19).”

So why the continued nonsense that a positive test warrants shutting down huge swathes of the population and economy?

2 – Department of Health and Social Care Reference FOI-1240596 answer gave a link to a document that in conclusion stated that the PCR tests being used are unreliable, had high false positive rates, could not be verified against an actual confirmed case of covid-19 and had not been verified in a medical or hospital setting.

So basically as admitted by the DHSC answer Reference FOI-1240596 you are using tests that are “unreliable” to say the least, have no reference standard to double check the accuracy against and that have results that means nothing medically.

So why the continued nonsense that a positive test warrants shutting down huge swathes of the population and economy?

3 – A quote by CMO Whitty on 21st July 2020:

“If you look at the R, and the behaviours, quite a lot of the change that led to the R going below one occurred well before, or to some extent before, the 23rd, when the full lockdown started.”

So why the continued nonsense of increasingly totalitarian, draconian and nonsensical restrictions being imposed and the shutting down huge swathes of the population and economy when it has been shown that more frequent and washing with soap and hot water, cough and sneeze etiquette and staying at home for a few days if you feel ill was working prior to March 23rd 2020?

4 – Nowhere has it been shown, no real-life studies show that one the past 2000 years of human history lockdowns work nor does mask or face covering wearing work to stop the spread of a virus.

Why does he and his team of “experts” believe they will when virtually every independent researcher and scientist worldwide who is not connected to Government teams or groups or the vaccine industry is proving they do not?

I look forward to Mr. Hancock’s answers in the national media and Parliament soon.”

I attached the FOI answer referenced for him to read and digest.

185913 AngloWelshDragon, replying to AngloWelshDragon, 14, #433 of 2327 🔗

Between them Sunak and Starmer have shot poor Boris’s fox. He wanted a circuit break now so he could end lockdowns in December to a fanfare of “Boris saves Christmas” headlines. But Rishi put his foot down on that one so Starmer has started agitating for a circuit break lockdown at half term. If Boris caves and introduces one Starmer will (assuming it works) then claim he was the one who saved Christmas.

Note: I’m assuming nobody reading this believes that a circuit break will do anything other than kick the can down the road. We may be released from our hovels on Christmas Day to play socially distanced football on the boarded up high street before being chased back into our homes by the covid Stasi where we shall remain locked down from January through to at least March!

185949 ▶▶ Julian, replying to AngloWelshDragon, 2, #434 of 2327 🔗

Depending on what you think the ultimate goals are, this will either go on until there is a vaccine or forever (and a vaccine may take forever).

186745 ▶▶▶ Cranmer, replying to Julian, 2, #435 of 2327 🔗

Yes. The goalposts have been constantly changed. First things were going to be back to normal in three weeks, then twelve, then by the summer, now it’s all ‘2021’ which is gradually moving further away as well. People don’t seem to realise that the machinery is in place for this to continue indefinitely now. It’s a ‘heads I win tails you lose’ situation.

187204 ▶▶▶▶ chris c, replying to Cranmer, 1, #436 of 2327 🔗

I think a lot of people are still expecting to go back to “normal” one day, just not as soon as they first thought. It hasn’t really sunk in yet that this is it, forever.

185914 Basileus, replying to Basileus, 6, #437 of 2327 🔗

The full transcript of the Dr Reiner Fuellmich video on Crimes against Humanity is available here:

https://www.globalresearch.ca/video-crimes-against-humanity-the-german-corona-investigation/5725795

186019 ▶▶ captainbeefheart, replying to Basileus, #438 of 2327 🔗

I don’t think this should be trusted. I mean what would the Germans know about mass subversion and treason?

185915 John P, replying to John P, 72, #439 of 2327 🔗

Peter Hitchens “on fire” this morning:

My projections on the British economy suggest a short ‘circuit-breaker’ in which all Ministers and MPs who have failed to oppose this destructive madness should be put on Universal Credit for the rest of their natural lives.

Hancock and Johnson *are* letting unemployment rip. Hancock and Johnson * have* let cancer and heart disease rip. Hancock and Johnson *have* let family separation and callous cruelty rip. Never forget it. Justice will eventually catch up with these buffoons.

185926 ▶▶ Ozzie, replying to John P, 3, #440 of 2327 🔗

Please could you provide a link to this?

185927 ▶▶ Tenchy, replying to John P, 1, #442 of 2327 🔗

Superb. Where was it – available yet online?

185928 ▶▶ Stephanos, replying to John P, 7, #443 of 2327 🔗

Personally, I would confiscate all their property and sell them and their families and their children to the fourth generation into slavery.

185939 ▶▶ Telpin, replying to John P, #444 of 2327 🔗

On what forum was he speaking

185922 Ozzie, replying to Ozzie, 32, #445 of 2327 🔗

A student that I teach has called in sick today with COVID symptoms and is awaiting test results. The ironic thing is that this student wears a mask all day (SE Asian background), in all classes (the only one in my classes that does) and outdoors as well. The mask that she generally wears is one of those tight fitting black ones (with no gaps around the edges). The student sits away from the rest of the class in the classroom.

I wonder how many more of these cases are around that prove that mask wearing is useless?

185944 ▶▶ Janice21, replying to Ozzie, 19, #446 of 2327 🔗

I am actually beginning to think masks actually spread the virus even more. If Covid is spread by droplets from the mouth, then constantly touching your face to put the mask on and off then touching doors, supermarket items, surfaces etc, then a person with Covid is actually spreading it more? I’m no scientist but just a thought!

185965 ▶▶▶ Tenchy, replying to Janice21, 10, #447 of 2327 🔗

Here’s the thing. We strongly suspect masks don’t stop the virus, or at best have a small effect. However, people wearing masks simply don’t anti-social distance at all. Comparing the two stupidities, I’d say ASD would be more effective – though in the overall scheme of things, only marginally – than face nappies. So the nappies probably do lead to more infection.

185992 ▶▶ Basics, replying to Ozzie, 3, #448 of 2327 🔗

Carehome work friend has been sent home with sore throat. Told to carry out the test themselves. Cannot return to work without positive test.

They themselves blame the Flu shot. Two weeks off in isolation? No. Just as soon as the Covid test comes back negative they can return to work, with the Flu…?

Utterly blind nonsense

186164 ▶▶▶ Bella Donna, replying to Basics, 1, #449 of 2327 🔗

You’d be better off not having it. I’d like to know the percentage of people becoming sick after having the flu vaccine. I’ve never had the flu and I would certainly not have the flu vaccine!!

186005 ▶▶ stefarm, replying to Ozzie, 4, #450 of 2327 🔗

Of course, that’s why we were told to wear them, to make people ill and spread germs.

186171 ▶▶▶ Bella Donna, replying to stefarm, 1, #451 of 2327 🔗

It’s more power to the governments elbow, more throat and chest infections the more they can impose authorianism. Stop wearing masks is the only answer. Politicians only wear them in front of the cameras!

185929 AngloWelshDragon, replying to AngloWelshDragon, 4, #452 of 2327 🔗

I’d be most interested to know the political leanings of all members of SAGE and not least Graham Medley and Matt Keeling from Scientific Pandemic Influenza Group on Modelling (SPIM). After today, I think we can all guess.

185940 ▶▶ RickH, replying to AngloWelshDragon, 3, #453 of 2327 🔗

Their political leanings are not the issue. As we know, traditional political definitions are beside the point in this shit-show. It’s to do with much more personal character flaws, real-world experience and grounding in scientific rigour.

185979 ▶▶▶ AngloWelshDragon, replying to RickH, 3, #454 of 2327 🔗

Agreed but I think it’s interesting these two seem to be tag teaming with Starmer.

186175 ▶▶▶ Nick Rose, replying to RickH, 1, #455 of 2327 🔗

And the UK’s tragedy is the scientific illiteracy of the political class.

185967 ▶▶ Censored Dog, replying to AngloWelshDragon, 2, #456 of 2327 🔗

One member of SAGE is a registered Communist Party member

185978 ▶▶▶ AngloWelshDragon, replying to Censored Dog, #457 of 2327 🔗

I know about her.

185931 Mr Bee, replying to Mr Bee, 23, #458 of 2327 🔗

A common definition (often attributed to Einstein but disputed) of insanity is that it is repeatedly doing the same thing & expecting a different outcome. We have had a national lockdown, local lockdowns, local restrictions, the three tiers, masks & hand sanitiser everywhere & social distancing. Now we have the proposed ‘circuit breaker’, which no doubt is only a matter of days away. Nothing has stopped the spread of the virus. Are these clowns insane or am I? Nothing has stopped the spread of the virus or is likely to do. It is here & we cannot ‘control’ or ‘defeat’ it. We just have to learn to deal with it in a sensible way & get on with life as with every other virus. I despair.

185968 ▶▶ DJ Dod, replying to Mr Bee, 5, #459 of 2327 🔗

Mr Bee, you’re not alone. I’m tearing out what little hair I have left over this madness.

186009 ▶▶▶ Jonathan Palmer, replying to DJ Dod, 8, #460 of 2327 🔗

Once you accept it’s not about a virus then it is easier

185969 ▶▶ DRW, replying to Mr Bee, 6, #461 of 2327 🔗

The virus is just a smokescreen at this point.

186177 ▶▶ Nick Rose, replying to Mr Bee, 1, #462 of 2327 🔗

Being seen to be doing something.

187224 ▶▶ chris c, replying to Mr Bee, #463 of 2327 🔗

William Farr was right all those years ago. Basically the virus has followed a Farr curve everywhere wih some variation probably according to local factors. Meanwhile we are told that the lockdown worked so well that we need another one, which obviously means the lockdown DIDN’T work. And they tell us facemasks are our salvation despite the infection rate, sorry positive test rate, increasing since they were mandated. So obviously we are not yet wearing them in enough places, everywhere outdoors will be next, then in our homes, then there are gloves, and goggles . . . Hope Simpson was right as well looking at vitamin D vs seasonal infections like flu. So much real knowledge squandered in the face of an agenda.

Hat Mancock (as someone mispronounced him) is still following Ferguson, lock down and wait for the vaccine to save us. Covid zero, carbon zero, human zero

185933 Luckyluke1976, replying to Luckyluke1976, 14, #464 of 2327 🔗

Fellow skeptics,
As of last night, Holland is no longer a country that values its freedom. Because of a highly doubtful increase in “cases”, the pubs/bars/restaurants/clubs/theaters in the whole country will be shut down completely, for at least 4 weeks. Some major carnavals scheduled to take place in 2021 have already been cancelled! This has never happened before, including during the German occupation! Most controversially, and one issue where I admired the Dutch stubbornness, masks will be made compulsory when legal technicalities (i.e. a small thing called the Dutch Constitution!) are dealt with.
Shops have already started to implement the ” law”, although it was specified that it is not legally enforceable yet. Any fellow Dutch residents can comment on this? Is there any workaround, like the exemptions in the UK? Or are we headed either for an exclusively online (me) or zombielike muzzled experience?

185941 ▶▶ Silke David, replying to Luckyluke1976, 4, #465 of 2327 🔗

I read on Monday as headline from the Independent, I think, that The Netherlands want to follow Belgium and not make policies on account of positive tests. Must have beer wrong then.
Sad.

185955 ▶▶ Jonathan Palmer, replying to Luckyluke1976, 10, #466 of 2327 🔗

Funny how all the incompetent
Governments around the world want to cover up their incompetence with the same 4 week lockdown.

185934 Stuart, 1, #467 of 2327 🔗

The Scientific Panzer Influenza Group has a moot point, in my opinion.

Certainly, 3000 early deaths among the Covidites, Lockdown Luvvies and Great Resetters would save the lives of 107,000 everyday citizens, if not far more.

185935 RickH, replying to RickH, 12, #468 of 2327 🔗

Another passing thought.

The key policy issues – all except masks – are well covered in today’s issue. Well done for that ‘sticking to the knitting’.

The review is interesting in revealing what an utter failure government and SAGE have been, creating the worst of all possible worlds, whilst the virus has managed its own fate unhindered.

There is nothing touched on (above), from lock-ups, through T &T to vaccines that have not been woefully (and wilfully) misconceived.

… and yet the insanity (as defined by Einstein) continues unabated, with irrelevant spats about what degree of uselessness should come next, and the opposition and media joins in to play the same game of ignoring the key fact – that the emperor is stark bollock naked.

186015 ▶▶ Harry hopkins, replying to RickH, 3, #469 of 2327 🔗

‘that the emperor is stark bollock naked.

I always thought that King Canute was fully clothed?!

185936 Basics, 8, #470 of 2327 🔗

For anyone who missed the breakfast posting:
Ian Brown
·
18 Sep
NEW TRACK LITTLE SEED BIG TREE OUT NOW PLEASE SHARE
https://ditto.fm/little-seed-big-tree

https://youtu.be/gOHn6KurHE0

Ian Brown earlier gave support to Liverpool:

BiG UP LiVERPOOL! they know full well if they can break you they can break anywhere! #STANDFiRM #ONELOVE

https://mobile.twitter.com/ianbrown

185952 FiFiTrixabelle, replying to FiFiTrixabelle, 28, #471 of 2327 🔗

Quote of the day so far from my 15 year old son. “That labour leader guy is a complete numbnut with a capital N”. Made me smile on an otherwise depressing day.

185970 ▶▶ Rowan, replying to FiFiTrixabelle, 8, #472 of 2327 🔗

Sums Starmer up very concisely.

186149 ▶▶▶ Bella Donna, replying to Rowan, 1, #473 of 2327 🔗

They’re all numbnuts in my view!

186270 ▶▶ Nigel Sherratt, replying to FiFiTrixabelle, 5, #474 of 2327 🔗

Reason to be proud, excellent parenting! One of my proudest moments was my 16 year old daughter’s comment when Blair became PM “He’s creepy”. Spot on and prescient.

185958 Rowan, replying to Rowan, 7, #475 of 2327 🔗

Starmer is playing Mr Nasty to Bozo’s Mr not quite as Nasty, This allows the Tories to introduce all kinds of infantile measures and still appear to be reasonable. Well done Starmer. Does he know what he is doing and if so is he just an establishment placeman who has been imposed on Labour?

186027 ▶▶ RickH, replying to Rowan, 6, #476 of 2327 🔗

is he just an establishment placeman who has been imposed on Labour?”

Not so much ‘imposed’ as finessed.

Anyone who’s been awake (i.e. immune to MSM narratives) over the last few years, the media assault on Corbyn was unprecedented in its dishonesty and deviousness. It was obvious that it was co-ordinated, and originated in common establishment sources.

The campaign came to fruition at the last GE, when it was obvious that Corbyn would have to go.

Whilst we can argue about Corbyn in terms of leadership qualities, and even the fairly ordinary centre-left policy agenda , the real problem for the establlishment interests was that he was not captive – and had had remarkable success in re-invigorating the Labour Party as a genuine, wide, member-based political entity (against the wishes of an administration still influenced by Blair and establishment connections).

All this was dangerous to establishment interests – and so – long story short – we now have Starmer as a safe pair of hands in these terms, leading a compliant PLP still very much in thrall to the Blair era (like the administration of the Party) , and lacking individuality and muscle.

Thus the net result : no opposition – just a safe alternative should the plebs get restless.

185959 T. Prince, 3, #477 of 2327 🔗

Corruption in Government? Who’d a thunk it……….this is what’s commonl;y known as taking the p*ss

https://www.youtube.com/watch?v=LnrSpCO6dWM

185960 zacaway, replying to zacaway, 28, #478 of 2327 🔗

Brilliantly searing comment from Allison Pearson’s article mentioned in the roundup:

To be fair to Baroness Harding, the poor woman has only been given £12.6 billion to come up with a workable NHS tracking system. With that amount, you could have paid every single elderly and vulnerable person in the UK £60,000 to shield themselves in the Bahamas and used the change to recompense students for their non-existent university experience.

Indeed.

186001 ▶▶ OKUK, replying to zacaway, 6, #479 of 2327 🔗

That would be much more sensible policy for sure!

185961 Tim Bidie, replying to Tim Bidie, 13, #480 of 2327 🔗

Just as Sweden shows us that lockdowns are fundamentally stupid, so Japan gives the lie to those who say it is impossible to protect the elderly.

‘Japan has recorded 1,225 deaths from covid-19, the disease caused by the coronavirus, compared with about 180,000 in the United States. In Japan, 14 percent of the deaths have been in elder-care facilities. That is compared with more than 40 percent in the United States, despite a lower proportion of U.S. seniors living in nursing homes.

Fewer than 1% of Americans live in nursing facilities, compared with 1.7% in Japan.’

How do they do it?

‘Japan’s elderly care facilities have taken great care in protecting the elderly, not just from this virus but from norovirus, influenza and other germs.’

‘…the idea is to keep the infection out in the first place.’ (!)

‘Access to the second floor, where residents live, is very closely controlled, with even close family members excluded’

“The very basic principle of elderly care is washing your hands at each step of your work: Take care of someone, wash your hands, do another job, wash your hands. But now it is even more thorough.

Perhaps surprisingly, staffers don’t usually wear face masks. It makes it harder to communicate with elderly patients who may be suffering from dementia.’

‘….huge debt of gratitude to staff members who have basically put their own lives on hold so they don’t bring the virus in….’They have hardly been anywhere else except here, and just commute between their homes and work,”

‘“We tend to have less diabetes, less obesity, and these kind of risk factors seem to be heavily related to the severity of the disease,”

https://www.washingtonpost.com/world/asia_pacific/japan-coronavirus-elderly-death-rate/2020/08/29/f30f3ca8-e2da-11ea-82d8-5e55d47e90ca_story.html

Hmmm…….nosocomial infection and co-morbidities absent……..this is not complicated…

At the very least, the state health service should consider voluntary BCG vaccination for the elderly:

‘In addition to the clear effect of BCG vaccination on infections in general, the most important observation was that BCG could mainly protect against respiratory infections: BCG-vaccinated elderly people had 75% fewer respiratory infections than the elderly who received placebo.’

https://pubmed.ncbi.nlm.nih.gov/32941801/

186000 ▶▶ OKUK, replying to Tim Bidie, 4, #481 of 2327 🔗

All well and good in its own way. But do we really want to deprive elderly people of family contact, hugs and kisses on a permanent basis? Won’t that demoralising state of affairs impact negatively on their health, often hastening their demise.

186061 ▶▶▶ BeBopRockSteady, replying to OKUK, 1, #482 of 2327 🔗

Yeah. That’s the thing for me too. It should really be a decision for them too. Of course it should.

186759 ▶▶▶ Cranmer, replying to OKUK, #483 of 2327 🔗

I think a lot of the problem stems from the fact that middle aged (and younger) policy makers assume that elderly people with co-morbidities and/or dementia in care homes are ‘just like them’. They don’t understand that somebody in that condition cannot, like them, reasonably expect another 30 or 40 years of life so there is no point ‘protecting’ them if it makes their lasts months or years miserable.

185962 wat tyler, 6, #484 of 2327 🔗

Why does Will Jones again repeat the bullshit that the polls show the public want stricter measures and more lockdown ? It’s a good job i’m not in the conspiracy camp because i notice he repeats it often along with a increasing number of defeatist commentators on here . Everyone knows polls have been way out on Brexit and the last former elections both here and places like America and Australia ,me and others have pointed out on here that with over 5 million public sector workers and many others on furlough the chance of an extended or new holiday with pay is appealing and are surely the people voting in the polls. I don’t personally know one single person ,even the pro mask people iv’e spoke to who say they want another national lockdown .Are you your family and friends clamouring for one ? because i can’t see it . And even supposing i’m completely wrong and most people did want it ,why on earth would we repeat it and propagate it ? Imagine you’re back in world war 2 would you keep saying the Germans are winning and everybody supports them and its all doomed ,no of course you wouldn’t .What you do is encourage your own side . We need to stop the game playing because things are serious and the freedoms that generations fought and died for are being stripped away so lets stop being defeatist because giving up is what the other side want .Everyone of us needs to decide today either in small groups or as individuals what we can do to further the cause and end the lockdown .Whatever you do will be a help and make us stronger and will take away the gloom and make you feel better. So come on chaps and ladies lets make future generation proud of us .so that when our grand children living in a free society look back on us ,they remember with tears in their eyes and pride in their hearts that we against all odds never gave up or gave in .

185964 mjr, replying to mjr, 34, #485 of 2327 🔗

so today went to Aldi. Not masked of course. Noted a notice not to buy more than i needed (don’t panic buy). Everyone masked. My favourite assistant on till unmasked and agreeing it is all bullshit.

Then went for a walk. Passed the test centre they have set up in the car park to the country park. Fence all the way round. Walked from the footpath up the steps to car park to have a look. A constant stream of cars coming in. Drivers being tested. If you are fit enough to drive you aren’t ill!

Then i attracted the interest of the bouncers. In black with yellow jackets. Bear in mind i am some yards from the fence which is 30 yards from where the activity is taking place, and on public land.
Lady comes over .. Asks if i have come for a test. I said no . Asked what i was doing there? Just having a look. This is private. No, its a public park. People are having tests. I know!.
She didnt know what to do. Turned around walked the 30 yards back to the main entrance muttering to her colleagues.

They are very sensitive about this aren’t they?

185985 ▶▶ KBuchanan, replying to mjr, 6, #486 of 2327 🔗

Lol do not look behind the curtain!

185986 ▶▶ Two-Six, replying to mjr, 9, #487 of 2327 🔗

Yes very touchy indeed, it seems to be pretty universal. These test centre people have a lot to hide and they know it.

People are incredible paranoid about being filmed and nearly everybody thinks it is illegal to film people in a public area. It’s not.

I used to hear a lot about this in my old life as a drone enthusiast. Actually there was strong anti drone propaganda before the government brought in some swinging new laws that pretty much shut down all flying of model aircraft and drones.

It got so bad that I would be harassed for legally flying my drones just about everywhere from the brainwashed sheeple. “ARE YOU FILMING? YOU CAN’T DO THAT”….
I actually just gave up trying to fly them as did almost everybody that I knew who was into them as well. the new rules totaly killed what was a very interesting SAFE and fun thing to do enjoyed by thousands of people.

The new rules introduced statutory instruments with fines if you did fly anything over 250 grams in weight without a “licence”.

All this was done in the interests of safety but there have been almost no accidents that resulted in injury with drones or model aircraft. One or two death involving model helicopters when people flew them into their heads/necks and a fair few drone/face propeller/fingers incidents but certainly no real risks to real aircraft.

The drone debacle was like the covid meltdown in many ways. The public propagandised to hell then tons of stupid laws brought in on the back of the brainwashing.

185996 ▶▶▶ Tenchy, replying to Two-Six, 10, #488 of 2327 🔗

Yes, I remember the “Gatwick drone”. It was never found, and if it existed at all, it’s a dead cert it was a police drone. And remember how the scum dealt with that totally innocent couple?

186020 ▶▶▶▶ Two-Six, replying to Tenchy, 8, #489 of 2327 🔗

That was a massive hoax to cover up for a crash in the airports critical booking baggage software that would have cost the airport operator a huge amount of money. They fabricated the whole thing and ALSO huge contracts were paid out to a few companies for anti drone defence systems, of which we hear NOTHING about now. Sounds familiar?

This kind of thing:
https://www.gov.uk/government/news/dasa-awards-2m-contracts-to-counter-hostile-drone-threats

What they really wanted was a pan European track n trace mobile phone app drone surveillance system they called “Uspace” where you have to log into to mission command and submit your flight plan then this flight plan would be authorised by central HQ. All other users of the airspace under 400 feet would then be notified of your drone “mission” and also you would be ordered to land your or “abort your mission” if say an air ambulance or police helicopter was operating in your area.

A totally mental solution for a non problem. Sound familiar?

As far as I know this mental “uspace” thing has fizzled out and come to nothing.

Also the privatisation of the lower airspace was very much the goal. Charging for priority acess to the lower airsoace to say Amazon or Pizza hut for drone deliveries.

I said many times to my fellow dronsters that this was Tyranny and that people should not register thier aircraft and not comply but EVERYBODY did.

Now the hobby is almost decimated.

186022 ▶▶▶▶▶ mhcp, replying to Two-Six, 1, #490 of 2327 🔗

Not to mention that a drone weighs much less than a goose or other bird. And aeroplanes are built to deal with them.

186033 ▶▶▶▶▶▶ Lockdown_Lunacy, replying to mhcp, 1, #491 of 2327 🔗

Err, aeroplanes can usually (but not always) ‘deal with’ birds yes, but often with significant cost due to inspection/repair requirements.

187237 ▶▶▶▶▶▶▶ chris c, replying to Lockdown_Lunacy, #492 of 2327 🔗

I heard a hysterical but almost certainly untrue story, they fired a chicken from an air cannon into a newly developed aircraft. It shot through the windscreen and embedded itself into the back of the cockpit. Next time they decided the chicken shouldn’t be frozen.

186160 ▶▶▶▶▶▶ Nick Rose, replying to mhcp, 1, #493 of 2327 🔗

Bird strikes usually involve more than one bird, but one with any size to it can destroy a jet turbine. It only needs to break one blade to trigger a chain reaction and force an engine shutdown

186062 ▶▶▶ PoshPanic, replying to Two-Six, 2, #494 of 2327 🔗

Yeah, drones became public enemy number one, which culminated in a case of mass hysteria at Gatwick. It was quite interesting talking to people who had become so afraid and paranoid about them, but actually had no knowledge of them, apart from what they’d seen in the media.
When I took time to explain the risks and how useful they were to us in solving a lot of problems ( as well as saving lives! ), they usually changed their position.

186389 ▶▶▶ Edward, replying to Two-Six, 2, #495 of 2327 🔗

Some years ago there was a bit of fuss about photography, with private security often displaying their ignorance of the law and some police not much better. As I do some amateur urban photography I took to carryjng around a bit of paper stating the legal position – nowadays I do the same with the Law or Fiction guide to mask exemption.

185989 ▶▶ Fingerache Philip., replying to mjr, 1, #496 of 2327 🔗

Insecurity takes many forms.

185994 ▶▶ stefarm, replying to mjr, #497 of 2327 🔗

Yes, I posted something further down, some videos from test centres

https://www.youtube.com/watch?v=QQmjKYWiGco

185995 ▶▶ Bart Simpson, replying to mjr, 2, #498 of 2327 🔗

Rather dodgy if you ask me. Makes you wonder what they’re trying to hide.

185971 Cheezilla, 1, #499 of 2327 🔗

Some useful stats from a comment to the Comment Central article:

A very quick search ( gov.uk and statista) reveals that there were recently 3.37 million people over 80 in the UK.
If we take it that nearly all the ~40k deaths were in this age range then it would mean that the vast majority of our old folk are surviving and will survive this virus – only 1 in 80 may die.
The media and the gov. seem intent on telling them and us that they will all die – Nonsense.
If those over 70 are included (5.65 million + 3.37 million = ~9 million) then the proportion (1 in >200) who die is even tinier.
Then if we put this in the perspective of how many die every year in the UK normally ~650 thousand – most of whom are in these age ranges – and would have a high likelihood of dying any way – often from flu and/or pneumonia, then we see how unbalanced the gov., the SAGE (was ever a name less deserved?) and the media.
This should be related to the deaths of the yet-to-be-born (207,000 in 2019). The statistics for death in the UK never includes this number!
Every graphical presentation should show the deaths attributed to the virus alongwith total death rates and those from heart, cancer, dementia, other respiratory, AND pre-born deaths. Otherwise there is no proper perspective.
https://www.statista.com/st
https://www.ons.gov.uk/peop

185980 Basics, replying to Basics, 6, #500 of 2327 🔗

Local rag Live reports

“Gutted Edinburgh eatery Scran forced to close after being told they are ‘not a cafe’

“Scran have shared their devastation after an Environmental Health officer ‘demanded they close while customers were still dining'”

“Initially, cafes with a license [no legal definition] were told they would also have to close, however the next day Nicola Sturgeon confirmed they would be allowed to open as long as alcohol was not sold.

“Speaking to Edinburgh Live, a staff member from Scran explained that after this news, they had “double checked everything” and continued to welcome in customers under the new opening hours.

“”She [Enviro Officer] wouldn’t leave until our customers left and we closed the shop.

“The officer then went on to not caring about a word we said and ended up walking away before we even got a chance to get her details.”

“Edinburgh locals quickly came to Scran’s defense, with one customer commenting: “You are literally the definition of a cafe”.

“Another replied “what a joke man, you could not be more of a cafe”.”

185988 ▶▶ stefarm, replying to Basics, 3, #501 of 2327 🔗

Fuck sake.

186023 ▶▶ jb12, replying to Basics, 5, #502 of 2327 🔗

Why can’t these people just tell the ‘officer’ to fuck off? I just don’t get it; it is a choice between going out of business or not.

185991 Bart Simpson, replying to Bart Simpson, 17, #503 of 2327 🔗

Labour from the word go have always wanted harder lockdowns so Starmer calling for a national lockdown shouldn’t surprise us.

What surprises me is that it’s clear that Labour have not learned anything from their crushing defeat last year. By advocating another lockdown, they’re complicit in the economic Armageddon that’s coming.

More than anything this should prove to everyone once and for all that Labour hate this country and would want nothing more than the Carthaginian destruction of the UK – politically, economically, socially.

Traitors the lot of them!

186011 ▶▶ OKUK, replying to Bart Simpson, 2, #504 of 2327 🔗

Yes – Carthagian indeed. If SAGE recommended salting of our fields to control Covid, Starmer, Hancock and the rest would back it.

186104 ▶▶▶ Bart Simpson, replying to OKUK, #505 of 2327 🔗

Exactly. They’re being led by junk science and are too thick to realise it.

186012 ▶▶ wendyk, replying to Bart Simpson, 4, #506 of 2327 🔗

And it most certainly will not win back the lost ‘Red Wall’ so eagerly written about in the MSM.After all, it’s the Red Wall areas which are already experiencing the most hardship.

Starmer has always struck me as a typical slippery opportunist, ever ready to issue ambiguous sound bites, take the knee, and waffle unconvincingly about, for example, the persecution of Darren Grimes, while advocating yet another closure of UK plc.

He’s another Blair type figure: all shine and no substance.

His dismissal of the mounting evidence about the rape gangs in Yorkshire, Shropshire,Lancashire and Oxfordshire while DPP should not be forgotten.

These overpaid apparatchiks are a national disgrace; we can only hope that more MPs will dig deep to find some moral courage and join the 42 rebels.

I’m utterly disgusted.

186025 ▶▶▶ OKUK, replying to wendyk, 9, #507 of 2327 🔗

He kneels before extremism: XR, BLM, Islamofascists and the Far Left – now the extreme wing of the Lockdown Lunatics. The man is a walking appeasement machine.

186041 ▶▶▶▶ jakehadlee, replying to OKUK, 9, #508 of 2327 🔗

He is indeed – he embodies weakness, even in the way he holds himself. I hate BoJo and think he is clown, I hate the Tories and think they have betrayed us all. But I can’t even be bother to hate Starmer – he’s a non-entity, he’s not even relevant, he’s not worth wasting hate on.

186051 ▶▶▶ A. Contrarian, replying to wendyk, 6, #509 of 2327 🔗

Yes he’s slimy. The kneeling was what did it for me.

186108 ▶▶▶ Bart Simpson, replying to wendyk, 3, #510 of 2327 🔗

Agree. The Red Wall have seen through him and his lot, I seriously doubt they will ever forgive and forget Labour’s betrayal of the working class especially from the 1990s, their toadying up to the EU and allowing freedom of movement to decimate communities.

Starmer is pure Metropolitan elite and only sees the world through that narrow prism. Anything outside the Westminster and Islington bubble doesn’t interest him.

186016 ▶▶ mhcp, replying to Bart Simpson, 1, #511 of 2327 🔗

Pure belief in Lysenkoism

186110 ▶▶▶ Bart Simpson, replying to mhcp, 3, #512 of 2327 🔗

Indeed. This lot are not only economically illiterate but also historically and scientific.

In other words, not fit for public office.

186031 ▶▶ RickH, replying to Bart Simpson, 6, #513 of 2327 🔗

Traitors the lot of them!”

Starmer and the PLP are pathetic – but I think that the Tories are actually the leaders in the traitor stakes, and are certainly the lead agent in the ‘destruction of the UK.’ And have been for a while.

186084 ▶▶▶ Bart Simpson, replying to RickH, 4, #514 of 2327 🔗

The entire political establishment in my eyes are traitors. Doesn’t matter what party they are.

186089 ▶▶▶▶ wendyk, replying to Bart Simpson, 2, #515 of 2327 🔗

Quite agree; they’re all awful, with a very few exceptions.

186034 ▶▶ jakehadlee, replying to Bart Simpson, 3, #516 of 2327 🔗

I think Labour is finished as a political force. The future struggle will be between the moderate and right (if that term means anything anymore) Conservatives, who may end up splitting into two parties when the death of any alternative opposition is confirmed.

186055 ▶▶▶ BeBopRockSteady, replying to jakehadlee, 2, #517 of 2327 🔗

I think this is true. What we are witnessing is the last cries of Labour as a significant force, especially in their ability to provide a credible counter narrative to the government. As an opposition should.

They’ve no choice but to take the poisoned challenge of harsh lockdown zealousy because they can’t go back. They’ve presented nothing of merit throughout this mess and continue to do so. To try and now maybe look at the data, question the narrative in a meticulous way would be impossible for them. The turning circle just couldn’t handle a vehicle of that size.

186119 ▶▶▶ Bart Simpson, replying to jakehadlee, 2, #518 of 2327 🔗

I think so as well. Labour have lost their raison d’etre a long time ago, they’ve become a part of the upper middle class elite and are basically reduced to fighting irrelevant battles and are even more out of touch than the aristocracy of the past.

Hence why I think they’re desperate to cling on to their current client voter base because they know they’re finished.

186069 ▶▶ Nick Rose, replying to Bart Simpson, 1, #519 of 2327 🔗

And the Brexit Party standing in the wings. Apparently standing in the local elections.

186003 Harry hopkins, replying to Harry hopkins, 60, #520 of 2327 🔗

No masks in my courtroom!

Yesterday, someone I know appeared in court on a minor traffic offence. It should never have reached this stage but it did. At the start of proceedings the Judge firmly instructed all present in the courtroom to remove their masks with the words ‘I won’t have masks in my courtroom—-remove them!

I find this encouraging. Not only because he probably thinks that mask wearing is a load of boloney and is being used as a tool of social control (I say this because if he had bought into the Covid nonsense, and been brain washed as a result, he most certainly would have insisted on masks—-the example of the funeral director of last week sticks in my craw!).

The other reason of course is that a courtroom, of all places, is a place where truth and lies crash together head on. There can be no doubt that the face is a reflection of our inner selves and that judges and the like rely on ‘facial language’ as part of their armoury when trying to decide innocence and guilt. I can’t imagine how any judge could preside over a room full of masked bandits, not least with the suppression of clear and audible speech that this would entail.

So full marks to the judge. On this ‘evidence’ it would appear that courtrooms at least, are a beacon of sanity.

186018 ▶▶ p02099003, replying to Harry hopkins, 2, #521 of 2327 🔗

Was that magistrates or crown court? If the latter it could set a precedent.

186032 ▶▶▶ Harry hopkins, replying to p02099003, 1, #522 of 2327 🔗

It was a minor offence (no one was hurt) and one that should have been settled between insurance companies. I have this information first hand, from the source, and they referred to the ‘Judge’. Other than that I cannot say.

186156 ▶▶▶▶ mjr, replying to Harry hopkins, 1, #523 of 2327 🔗

usually matters of motor insurance liability will be dealt with at County Court

These are the courts covid guidance instructions
They specifically refer to a requirement to wear masks . Hence people will have been wearing them but i guess a judge can do what he wants in his courtroom

186162 ▶▶▶▶▶ captainbeefheart, replying to mjr, -1, #524 of 2327 🔗

So they could just lean over the bench and shoot someone then. They don’t have to follow any statue laws at all.

186028 ▶▶▶ matt, replying to alw, 1, #526 of 2327 🔗

The first one is interesting. Not a great advert for masks, but it’s another reason for the “it doesn’t stop you catching it, it stops you passing it on” thing. You can prove whether someone who catches it wore a mask; you can’t prove that they caught it from someone who was also masked.

186042 ▶▶▶▶ BeBopRockSteady, replying to matt, 1, #527 of 2327 🔗

You can’t prove that at all anyway, though I also expect that kins of comeback. Taking it back to the famous hamster study then, does that mean they conducted it on the basis of the masked hamsters had SARS-CoV-2 infections, while the umaksed did not. And the masks prevented them getting it?

Such a 2020 sentence that.

186068 ▶▶▶▶▶ matt, replying to BeBopRockSteady, 1, #528 of 2327 🔗

The “masked hamster” study was nothing of the sort. They didn’t mask the hamsters, they strung up mask material between the hamsters’ cages. It was in effect yet another mechanistic engineering study that proved only that a hamster’s breath is unlikely to be strong enough to make it through a piece of cloth that’s some distance away from the hamster.

186139 ▶▶▶▶▶▶ BeBopRockSteady, replying to matt, #529 of 2327 🔗

Yeah. I know that actually. I call it the hamsters in masks study out of contempt.

https://fightcovid19.hku.hk/hku-hamster-research-shows-masks-effective-in-preventing-covid-19-transmission/

186043 ▶▶▶▶ A. Contrarian, replying to matt, 2, #530 of 2327 🔗

Exactly. They’ll just say they only caught it because someone else wasn’t wearing a mask.

186120 ▶▶ captainbeefheart, replying to Harry hopkins, -8, #531 of 2327 🔗

Have you thought about reporting this to the police?

186127 ▶▶ captainbeefheart, replying to Harry hopkins, -12, #532 of 2327 🔗

If anyone dies due to Covid 19 because of the irresponsible actions of this judge, technically, the judge will be guilty of manslaughter.

186166 ▶▶▶ Will, replying to captainbeefheart, 1, #533 of 2327 🔗

I imagine the judge might fancy his chances of getting off….

186004 Basics, replying to Basics, 7, #534 of 2327 🔗

Edinburgh coronavirus experts disagree as one claims herd immunity ‘critical’ to defeating pandemic

Prof Mark Woolhouse disputed claims by health secretary Matt Hancock who said herd immunity was a “flawed goal”

https://www.edinburghlive.co.uk/news/edinburgh-news/mark-woolhouse-devi-sridhar-herd-19100951

Prof Woolhouse told the PA news agency: “Going forward, we would expect more people to be exposed at some stage or another and that immunity would be important, whether natural or through a vaccine.

“Herd immunity is the way this thing ends, one way or another, it is critical to what happens to Covid-19 in the long term.

186013 ▶▶ Basics, replying to Basics, 2, #535 of 2327 🔗

And yes that is one viscious slimy disgusting propaganda piece from Edinburgh live. Wretched. See those eyes of Sridhar in the accompanying picture. Human warmth, intelligence or something else?

Don’t forget BBC local democracy reporters are on the staff of EL.

186010 John Stone, 1, #536 of 2327 🔗

We are having a lot of flannel about herd immunity from Tedros and government ministers. Of course, most viruses circulate without the WHO calling on them to be eliminated. If they declare war on them the results may not straightforward. For instance, the attempt to eliminate measles and mumps means that people over 55 or so retain immunity (old fashioned herd immunity) because they had the diseases as children but the effects of the vaccines wear off so young adults and middle aged people mostly won’t have it any more. There must be a considerable concern that we have a large population that does not have herd immunity particularly with measles and that we could get dangerous mutations which could make Covid look like a picnic. If this was to happen it will be blamed on “antivaxxers” but it will be the direct result of six decades of vaccine policy:
https://www.bmj.com/content/367/bmj.l6926/rr-1

186017 OKUK, replying to OKUK, 7, #537 of 2327 🔗

On balance good that Starmer has gone full on Himmler. Ultimately will help us extricate ourselves from this mess.

186030 ▶▶ Jonathan Palmer, replying to OKUK, 2, #538 of 2327 🔗

Please explain because I just see it as closing Parliament as an avenue to end this

186052 ▶▶▶ Kev, replying to Jonathan Palmer, 2, #539 of 2327 🔗

Politicians are the problem, not the solution – as things stand right now.

186063 ▶▶▶▶ Jonathan Palmer, replying to Kev, 1, #540 of 2327 🔗

Short of a revolution then how can you change things

186092 ▶▶▶▶▶ Bella Donna, replying to Jonathan Palmer, 1, #541 of 2327 🔗

A Revolution is the only way forward, nothing else is working!

186159 ▶▶▶ Will, replying to Jonathan Palmer, #542 of 2327 🔗

Because any increase in positive cases and deaths will be seen as a victory for Starmer and a failure by Johnson. The government is now incentivised to reverse project fear, minimise positive cases and consequently covid deaths. The intention since March has been to manufacture a scenario in which the government can claim credit for “beating” the virus, Starmer’s intervention makes the accomplishment of that “victory” all the more urgent.

186036 ▶▶ A. Contrarian, replying to OKUK, 1, #543 of 2327 🔗

I’m not sure, won’t the left and the press and eventually the public just agitate for it more and more until government “give in”? Especially as cases and deaths will inevitably continue to rise over the winter.

186021 captainbeefheart, 4, #544 of 2327 🔗

I’ve got a solution to fuel poverty for pensioners.

If we lock them up for 6 months, it will be warm again. Problem solved!

186037 alw, #545 of 2327 🔗

Please sign and share.
http://chng.it/g688Sf7wqN

186039 The Filthy Engineer, replying to The Filthy Engineer, #546 of 2327 🔗

Scare story of the day in case it hasn’t already been posted:

https://www.bbc.co.uk/news/health-54526660

186049 ▶▶ Bella Donna, replying to The Filthy Engineer, 1, #547 of 2327 🔗

It seems everything is down to Covid. No other illness exists. I think they are trying to drive us mental, the thing is its working! 😩

186150 ▶▶▶ James, replying to Bella Donna, 2, #548 of 2327 🔗

I think they are trying to drive us insane. They might actually be insane themselves. We might be witnessing the birth of the ‘cult of the insane’. If this is a plan then the people behind it must be insane, for only the insane would come up with a plan to systematically terrorise the entire planet into obedience in the face of a threat that does not really exist.

186050 ▶▶ Julian, replying to The Filthy Engineer, 2, #549 of 2327 🔗

The story itself says it is the first case of its kind, and that it happens (rarely) with flu too.

For the BBC to publish this kind of thing, given where we are, given that they are a public service broadcaster, and don’t have to sell ads through clicks, is beneath contempt and a clear indication they are following a line

186072 ▶▶▶ jakehadlee, replying to Julian, 8, #550 of 2327 🔗

Having worked as a journalist and editor at the BBC during two other ‘pandemics’ I will give them credit that they aren’t following a line other than that imposed by higher editorial staff for a few reasons:

1) The BBC doesn’t need paid clicks, but the mentality is the same (I was specifically told by our senior editor that our priority was audience numbers, not responsible journalism when disputing our coverage)

2) The editorial staff almost all have the same background and politics, and it is very establishment and very contemptuous of anything that smacks of populism, and they think scepticism is populism – largely because they equate it with Trump.

3) Since the trouble they got into with David Kelly (largely caused by one journalists arrogant lack of procedure) they have been terrified of anything approaching investigative reporting of government policy. When I was there, there was actually a serious high-level discussion about doing no investigative reporting ever again. That was shot down, thankfully, but the fear is real. They are terrified of getting it wrong and giving the government a chance to go in for the kill. The irony of course being that they have abandoned their post when most needed, and now I am sure that many people like me who were once passionate supporters of public service broadcast would gladly see the whole rotten enterprise torn down and buried for ever. I cancelled my licence over their cowardice on this and I suggest everyone here does the same.

I loved my time working there, but it is not what it was and it’s time for it to die.

186274 ▶▶▶ The Filthy Engineer, replying to Julian, 2, #551 of 2327 🔗

Exactly and on my own anecdotal evidence, a few years ago now I had really nasty cold that turned into a really nasty sinus infection that caused the cranial nerve in the right side of my face to become inflamed/trapped. Result: Bell’s Palsey. I thought I was having a stroke. Anyway, antibiotics and corticosteroids cleared it up in a few weeks and everything back to normal.

186185 ▶▶ mjr, replying to The Filthy Engineer, #552 of 2327 🔗

“Doctors could find no explanations for his hearing problem, other than his recent Covid-19 illness.”

So existing asthmatic who was intubated, and needed a blood transfusion, and who conveniently had a covid test on admission that fortunately showed a positive .. so we can blame everything on covid.

186040 Bella Donna, replying to Bella Donna, 9, #553 of 2327 🔗

Starmer trying to outdo Bozo for idiot of the year!

186045 ▶▶ Kev, replying to Bella Donna, 8, #554 of 2327 🔗

Sturgeon still holding pole position for now, but a late charge on the outside from the NI government can’t be ignored.

The race to out-stupid each other is never ending

186077 ▶▶▶ Basics, replying to Kev, 3, #555 of 2327 🔗

Serious calls for Sturgeon to resign coming thick and fast over a matter of lying to parliament. Ministerial code prescribes resignation in such circumstances.

Essentially the idiot of the year podium might be ‘lance armstronged’.

186044 John P, replying to John P, 6, #556 of 2327 🔗

Nadine Dorries is a contender for the densest government minister award – and she has some very still competition:

“If herd immunity existed, measles and chicken pox would have been wiped out years ago. There is no such thing as herd immunity.”

Doh!

Jimmy Wales (American founder of wikipedia) commented :

If anyone wonders what has gone wrong in the UK, a good starting point would be scientific illiteracy in government.

He’s not wrong.

Ivor Cummins (the fat emperor) was more direct :

“The most moronic utterance this week – and there’s been stiff competition.”

Dorries still hasn’t taken her comment down. Breathtaking conceit and arrogance.

186048 ▶▶ Tee Ell, replying to John P, 7, #557 of 2327 🔗

She needs stringing up. She’s strong contender for the Diane Abbott Award in Stupidity here.

186082 ▶▶▶ MiriamW-sometimes-AlanG, replying to Tee Ell, 3, #558 of 2327 🔗

I’m not a fan but, be fair, Diane Abbott is not actively abetting the destruction of the country and increasing sickness and death by putting out dangerous lies. MW

186128 ▶▶▶▶ MiriamW-sometimes-AlanG, replying to MiriamW-sometimes-AlanG, 1, #559 of 2327 🔗

Oh dear, obviously heresy on here. 😉 MW

186234 ▶▶▶▶ Awkward Git, replying to MiriamW-sometimes-AlanG, 1, #560 of 2327 🔗

No, she is one of those genuinely, truly, honestly and totally incompetent and following her true nature.

186087 ▶▶ Bella Donna, replying to John P, #561 of 2327 🔗

We have a very low bar setting for our political class that’s why they don’t choose the private sector!

186091 ▶▶ captainbeefheart, replying to John P, #562 of 2327 🔗

I hate having this pillock as my MP. I’ve never voted for her, but even if I did, I’d still want her to be strung up like the rest of them.

186158 ▶▶ Bart Simpson, replying to John P, #563 of 2327 🔗

Standards are very low and her comment betrays the over all stupidity of our political class.

186264 ▶▶ The Filthy Engineer, replying to John P, 1, #564 of 2327 🔗

Dorries should know better: She originally trained as a nurse!

186046 JHuntz, replying to JHuntz, 6, #566 of 2327 🔗

Labour supporting this just demonstrates how corrupted both our parties are. This is a Globalist cause and the parties must toe the line.

186053 ▶▶ John P, replying to JHuntz, -1, #567 of 2327 🔗

Do you want Johnson and his government to avoid jail?

JOHNSON AND HIS GOVERNMENT ARE LEGALLY (AND IN FACT) RUNNING (RUINING) THIS COUNTRY. NO-ONE ELSE.

They are 100% responsible.

186059 ▶▶▶ Jonathan Palmer, replying to John P, 7, #568 of 2327 🔗

True but it doesn’t negate the fact that they are following a blueprint

186065 ▶▶▶ JHuntz, replying to John P, 2, #569 of 2327 🔗

I’d happily lock them up and throw away the keys. I find it equally as deplorable though that we do not have an opposition.

186054 Basics, replying to Basics, #570 of 2327 🔗

Here is the latest National Records for Scotland report, next one due in November -they are switching from weekly to monthly because you know why.

https://www.nrscotland.gov.uk/statistics-and-data/statistics/statistics-by-theme/vital-events/general-publications/weekly-and-monthly-data-on-births-and-deaths/deaths-involving-coronavirus-covid-19-in-scotland

Key Findings

As at 11th October, there have been a total of 4,301 deaths registered in Scotland where the novel coronavirus (COVID-19) was mentioned on the death certificate.

The first mention of COVID-19 in a registered death certificate was the week beginning 16th March 2020.
Of the total number of deaths registered in week 41 (5th to 11th October), there were 25 where COVID-19 was mentioned on the death certificate, an increase of 5 from the previous week (28th September to 4th October). Deaths involving COVID-19 are at a slightly higher level now than in July and August, but much lower than at the height of the pandemic.

47% of COVID-19 deaths registered to date related to deaths in hospitals. 46% of deaths were in care homes and 7% of deaths were at home or noninstitutional settings.

After adjusting for age, people in the most deprived areas were 2.1 times more likely to die with COVID than those living in the least deprived areas.

Of those who died with COVID-19 between March and September, 92% had at least one pre-existing condition. The most common main pre-existing condition among those who died with COVID-19 was dementia and Alzheimer’s disease (31%), followed by ischaemic heart disease (13%).

Age-standardised death rates (adjusting for the age-structure of the population) were 43% higher for men than for women (168 vs 118 per 100,000 population for deaths occurring in March – September).

186079 ▶▶ Bella Donna, replying to Basics, #571 of 2327 🔗

If the doctor is getting paid for ever supposed Covid death then we’re all be dying from Covid.

186056 Mabel Cow, replying to Mabel Cow, 38, #572 of 2327 🔗

At what point did the government of the United Kingdom decide that we needed them to save us from the perils of life, however remote the risk?

Was there a moment when the public requested this help? Was it the formation of the welfare state, or the creation of the NHS? Did it happen later, perhaps in the wake of 9/11? I’m genuinely interested in people’s thoughts.

I for one do not feel the need for the government to hold my hand through life. I just want them to enforce a reasonable (and small) set of laws to ensure that we can function as a society with killing each other. And nothing else. I want to be served by them, not ruled by them.

186064 ▶▶ CGL, replying to Mabel Cow, 11, #573 of 2327 🔗

I said this to my MP a couple of months ago. Their job may be to warn us of any potential risks but to take it upon themselves to take control of our lives to protect us is way beyond their remit.

186073 ▶▶▶ Bella Donna, replying to CGL, 12, #574 of 2327 🔗

I think it’s apparent this has nothing to do with the virus its about controlling us.

186066 ▶▶ Bella Donna, replying to Mabel Cow, 21, #575 of 2327 🔗

I want the government to get the hell out of my life and stay out!

186085 ▶▶ Dan Clarke, replying to Mabel Cow, 14, #576 of 2327 🔗

Same with all the virtue signalling, including muzzles. I want no one protecting me.

186094 ▶▶▶ CGL, replying to Dan Clarke, 15, #577 of 2327 🔗

If someone says to me I’m doing it for you I will reply “well I am specifically asking you not to!”

186231 ▶▶▶▶ fiery, replying to CGL, 4, #578 of 2327 🔗

Great reply. I certainly don’t want anyone protecting me.

187049 ▶▶▶ Bart Simpson, replying to Dan Clarke, #579 of 2327 🔗

Hence why that NHS advert “I wear one to protect you. Please wear yours to protect me” is an abomination and a lie.

186090 ▶▶ A. Contrarian, replying to Mabel Cow, 6, #580 of 2327 🔗

Couldn’t agree more. This level of control or responsibility is beyond their remit. But more and more people seem to expect protection from everything. I think it’s all part of the litigation culture and excessive health and safety.

186168 ▶▶ PatrickF, replying to Mabel Cow, 3, #581 of 2327 🔗

The elites patronise the plebs. We are the unthinking, lumpen, blobs, who need protecting from ourselves and protection from them.

186416 ▶▶ Edward, replying to Mabel Cow, 3, #582 of 2327 🔗

There wasn’t a single moment, it was a long slide towards dependency.

186067 John Galt, replying to John Galt, 23, #583 of 2327 🔗

Does anyone have videos or first person reports of what’s going on in care homes or with the elderly?

The whole “it’s worth it to save just one life” thing is winding me up, because it’s an appeal to emotion that’s easily opposed when you’ve got elderly people who are literal prisoners at the moment. I feel like bombarding some of these people with what’s happening.

I’ve recently seen this video of a woman singing to her mother through a closed care home window:

https://www.youtube.com/watch?v=pcPMDkmKnH0&ab_channel=DianeMayhew

The video of a man being told to stop comforting his mother at the funeral of his father:

https://www.youtube.com/watch?v=zhV4oWthRas

This woman whose father is severely declining because he can’t see his family or even his wife who lives in the same care home (this is quite distressing):

https://twitter.com/talkradio/status/1314551428493574150

And this image:

comment image

If we could put together a bunch of these I think it could be quite helpful.

186083 ▶▶ Dan Clarke, replying to John Galt, 5, #584 of 2327 🔗

Heartbreaking. Can’t help with any personal info, did the rules change to allow visitors into care homes now, its extremely concerning.

186099 ▶▶ Victoria, replying to John Galt, 7, #585 of 2327 🔗

Breach of human rights

186319 ▶▶ nocheesegromit, replying to John Galt, 3, #586 of 2327 🔗

That interview made me shake with rage. Anyone who supports these policies after listening to that… I don’t even have the words for them.

186507 ▶▶▶ Sylvie, replying to Steve, 1, #588 of 2327 🔗

https://parliamentlive.tv/Event/Index/6fb9ecbd-ab26-49d8-9a9f-dba49b605f05
See also yesterday’s Commons Select Committee, witnesses giving evidence about how carers and their respective mother with dementia, and a mentally handicapped daughter have been coping (or not) with lockdown. Hard to listen to.

186070 Tenchy, replying to Tenchy, 6, #589 of 2327 🔗

It beggars belief (again). This from The Telegraph live feed:

Time circuit breaker with Christmas holidays, advisers say

Prof Medley added that any circuit-breaker should ideally be timed with school holidays to minimise disruption to education.

“So, half-term or potentially over Christmas,” he said. “You could even potentially add a week to the Christmas school holidays and potentially get some kind of three-week break, but the whole point is to reduce the prevalence before you actually have to do it.

“The reason that the lockdown (in March) worked, is because it separated households. “And that’s essentially what we’ve got to do is to make sure that the transmission doesn’t go from household to household, and two weeks is the minimum time.”

Prof Medley said thousands of deaths could be prevented up to January with a circuit-breaker but it was accurate to say that did not necessarily translate into lives saved in the long term.

The modelling paper written by Prof Medley and colleagues sets out that deaths could possibly reduce for the rest of the year from about 19,900 to 12,100. Hospital admissions could be reduced from 132,400 to 66,500.

A limited lockdown, with schools and shops open but hospitality venues closed, could potentially cut deaths to about 15,600, they said.

Prof Medley said lives would undoubtedly be saved through the NHS not becoming overloaded and by the health service being able to continue with other routine care, such as cancer treatments.

He agreed that several short circuit-breaks until a vaccine or better treatments arrived could also save lives in the long run.

“If you know there’s a vaccine coming and treatments are going to get better, which they probably are, then yes it will save lives,” he said.

Consider the last-but-one paragraph. So there you have it. Lockdowns ad-infinitum if this chump gets his way.

186143 ▶▶ bucky99, replying to Tenchy, 4, #590 of 2327 🔗

Yay, three weeks at home with the kids in the middle of winter with nothing for them to do?! Where do I sign up…? 🤦‍♂️

186161 ▶▶ stewart, replying to Tenchy, 3, #591 of 2327 🔗

This is problem.

Someone can just say that lockdown worked, when all the evidence shows the opposite, it gets put on a national paper, and the idea becomes more entrenched.

It really is the case that a lie repeated a thousand times eventually just becomes an accepted truth.

186252 ▶▶▶ peter, replying to stewart, 2, #592 of 2327 🔗

Welcome to the Covid Hoax

186167 ▶▶ Recusant, replying to Tenchy, 1, #593 of 2327 🔗

How do we know that cases went down in March due to lockdown rather than some other factor? The weather, or the effect of sunlight vitamin D levels, or some other factor? The causation that is assumed because of the correlation between lockdown and covid deaths seems like a statistics 101 mistake.

186197 ▶▶ Achilles, replying to Tenchy, #594 of 2327 🔗

What is insidious is the use of a specific number like 15,600 to imply accuracy when in fact it is just guesswork at best (albeit with some mathematical calculations underneath). Of course they get around accountability with the use of the word “potentially” but they are well aware that it is likely to be interpreted as fact. It is disingenuous, bad science and downright dangerous.

186232 ▶▶ CGL, replying to Tenchy, 1, #595 of 2327 🔗

Prof Meddlesome

186865 ▶▶ Richard Pinch, replying to Tenchy, #596 of 2327 🔗

I have just read the Medrxiv preprint and as I rather suspected, the model says nothing about saving lives in the long run. All that happens is that the “circuit break” postpones infections and deaths. Indeed, the model assumes that after the break, they continue to rise again at exactly the same level as before. This is nothing but “flattening the curve” as we had it the first time round. To say that the mode predicts saving any number of lives at all by January, or any other fixed date, is correct but irrelevant, unless you believe that something is going to happen on that future date that will change the dynamics of the infection.

186075 alw, replying to alw, 11, #597 of 2327 🔗
186382 ▶▶ FlynnQuill, replying to alw, 5, #598 of 2327 🔗

Great rebuttal by a true scientist at the top of her game. Unlike the thick corrupt totalitarian liar like Hancock. How dare he stand there and tell complete lies and half truths. Just what are his medical qualifications? Is he just making this shit up himself or is somebody spoon feeding him this bollocks?. Well, he can get away with it as most of the MPs are as thick as he is and will never try and find out the truth..

186078 John P, replying to John P, -5, #599 of 2327 🔗

I’m not coming back to this comment, but I have a question for those (and there seem to be many here) who keep insisting that the situation in the UK is not the fault of British politicians, but that they are instead obeying the orders of shadowy globalists (presumably Gates and Soros, etc)

What is is that you think these people have on the government? Why would they be following someone else’s orders?

Does Gates have a pee-pee tape on Johnson? (As the Democrats alleged – with no evidence – that Putin had on Trump in the US?)

Why should Johnson follow the orders of “globalists”?

Johnson and the other British politicians are 100% responsible for this disaster. No one else. I am not a fan of Gates. I do not want forced vaccines. But he is not running the UK!

Gates has money. He may be able to buy influence. But he does not have an army at his command. If Johnson wanted to invade or bomb a country he could do so. Gates couldn’t.

If you think Gates and his ilk are running the show, then I’m sorry, but I think you are unhinged.

186086 ▶▶ John Galt, replying to John P, 11, #600 of 2327 🔗

Please give it a rest. Everyone is well aware you don’t believe it’s a global situation, you don’t need to keep reiterating it day after day, post after post.

186088 ▶▶ Nick Rose, replying to John P, -3, #601 of 2327 🔗

You’re probably wasting your time asking! Regarding politicians, stupid does as stupid does

186093 ▶▶ Toby Pierides, replying to John P, 2, #602 of 2327 🔗

A promise of untold riches!

186095 ▶▶ Basics, replying to John P, 7, #603 of 2327 🔗

The Fourth Industrial Revolution’
The 2017 Matt Handcock speech you didn’t know about. On the UKGov website.

https://www.gov.uk/government/speeches/the-4th-industrial-revolution

“…And I’m delighted to speak alongside so many impressive colleagues who really understand this, and alongside Professor Klaus Schwab who literally ‘wrote the book’ on the 4th Industrial Revolution. Your work, bringing together as you do all the best minds on the planet, has informed what we are doing, and I’m delighted to work with you. …”

What do you think of that?

186098 ▶▶▶ Ossettian, replying to Basics, 2, #604 of 2327 🔗

“What do you think of that?”

Brave Sir Robin has already said that he’s running away.

186101 ▶▶ Janice21, replying to John P, 6, #605 of 2327 🔗

I think there are different variations of us lockdown sceptics and what we believe. I am unsure about the whole Gates and vaccine thing but be have to unite as lockdown sceptics no matter what and respect one another.

186147 ▶▶▶ CGL, replying to Janice21, 2, #606 of 2327 🔗

Me neither but it is all so surreal I can’t count anything out these days. The most surreal thing was Bozo talking about windmills – whoever would have thought that!!!!

186107 ▶▶ Two-Six, replying to John P, 7, #607 of 2327 🔗

Lol, seriously look. It’s not just Gates but he is a huge player, it’s not just the rockefella foundation, it’s not just the UN. it’s not just the WEF, it’s not just big pharma, it’s not just big tech , it’s not just almost every other country in the world doing the same covid meltdown
Do you see?
Yer its all about Boris and the cabinet and the rest of the UK government.

186118 ▶▶ Crazy Times, replying to John P, 8, #608 of 2327 🔗

Where you are wrong, is that he does have an army at his command. It’s just a very different type of army than the one you are used to. It’s not soldiers in uniforms. It’s scientists in lab coats, academics in positions of “authority” and the leaders of groups such as the WEF and the WHO, while also having the ability to pop up on television for interviews and to spout his nonsensical views, seemingly whenever he desires.

Just look at the flow of money.

Our own Dim Witty through LSHTM received a grant of £31m.
He’s funded the WHO over $1.5bn.
He’s funded GAVI over $3.1bn.
Klaus Schwab has boasted of being on first name terms with Bill Gates and he’s been a constant staple of the WEF for years.

Why Bill Gates is even given any notice at all is solely down to money – he has absolutely no qualifications whatsoever – NONE. Let alone any medical, biological, scientific or epidemiological qualifications.

186154 ▶▶ stewart, replying to John P, 4, #609 of 2327 🔗

So your argument can be boiled down to this: Those who command armies and can “bomb a country” have more power than those who don’t. And those with weaker or no armies cannot really influence and manipulate those with bigger armies.

Religions have had huge influence without standing armies – or very limited ones.

The idea that influence is only achieved through brute force is rather simplistic and infantile.

Doesn’t mean that Gates is running the show. But he could still have an enormous amount of influence without commanding a standing army. And in fact clearly does.

186352 ▶▶ charleyfarley, replying to John P, #610 of 2327 🔗

Nick Clegg.

187192 ▶▶ wat tyler, replying to John P, -1, #611 of 2327 🔗

You’re right Johnson, the government and their advisers are to blame .Everything else is just letting them off the hook .There’s no hidden hand stopping him changing course tonight .But he won’t because he’s a cowardly ignorant fool and will know his time in power will come to an end .

186080 Jay Berger, replying to Jay Berger, #612 of 2327 🔗

The intellectual scepticism about ‘herd immunity’ is justified, and actually shared by a certain Mr. Tegnell.
Equally true is that without various immunities existing, there can’t ever be a vaccine.
Obvious is that lockdowns (and masks) didn’t and don’t work, that they are actually harmful with regard to lumiting infections and illnesses, and a sheer catastrophe, if all their collateral danage was included in
their assessment.
The suggestions of the GBD are therefore absolutely correct, as the Swedish experience shows, but its reasoning is also indeed flawed.
Not that it matters.
They and the sheep are hellbound on taking us down with them.

186096 ▶▶ Victoria, replying to Jay Berger, 2, #613 of 2327 🔗

Indeed. Herd immunity was coined by the vaccine industry to motivate enough people to get a vaccine. Interesting development now that they play down the herd immunity concept. I wonder why?

The good thing is that there is no need for ‘herd’ immunity in Covid. Most of us have already been exposed to SARS viruses and our t cells have memory of them and will fight covid viruses should we get exposed to them. In addition, our immune systems will protect us against the onslaught. The more optimal your immune system the better protected you will be.

186114 ▶▶▶ BeBopRockSteady, replying to Victoria, #614 of 2327 🔗

Hold on this seems to be a confusion in terms of classification of the term herd immunity.

So we can have immunity, T cells etc. However, it doesn’t mean a threshold can be reached that sees transmission of a virus become simply endemic and low level due to less ability to spread?

186123 ▶▶▶▶ stewart, replying to BeBopRockSteady, #615 of 2327 🔗

No, we don’t have herd immunity to the flu virus (which is actually an ever changing organism). We still get infected, many of us do, anyway. But most of us can cope with the infection.

I think herd immunity implies the absence of infection altogether.

186141 ▶▶▶▶▶ Nick Rose, replying to stewart, 1, #616 of 2327 🔗

You are unlikely to catch flu twice. A lot of “flu” is often something else.

186179 ▶▶▶▶▶▶ Alan P, replying to Nick Rose, 1, #617 of 2327 🔗

Not true. Flu mutates so you catch a different strain. It’s an influenza virus. Covid 19 or SARS cov 2 is a coronavirus. These tend not to mutate as quickly as influenzas and rhino viruses.

186295 ▶▶▶▶▶ BeBopRockSteady, replying to stewart, 1, #618 of 2327 🔗

So the fact that someone gets infected with SARS-CoV-2, and, in many cases develops an immune response, does that not lead to increased population immunity? And, the crucial question, would this be better done in the least vulnerable groups rather than locking down economies and destroying them? As the GBD suggests.

The overall goal is to reduce lives lost as a whole. Surely immunity plays a role here? The herd argument is a question. Of how much.

Sure, it can mutate. But does that always happen in one direction, i.e. that the next strain is just as virulent?

186115 ▶▶▶ stewart, replying to Victoria, 5, #619 of 2327 🔗

What seems rather apparent after seeing governments and health officials around the world flailing around imposing random measures based on half-baked ideas is exactly how little we actually know about microorganisms and their spread in humans.

We haven’t really advanced much in the last 150 years.

186949 ▶▶▶ Richard Pinch, replying to Victoria, #620 of 2327 🔗

Herd immunity was coined by the vaccine industry to motivate enough people to get a vaccine.

If so, they were playing a very long game. The term dates back at least to 1920, when L.P. Beechy published a paper “ Abortion Disease in Cattle ” in Bulletin of the Ohio State University Agricultural College Extension Service vol.XVI

The most important factors in herd management as affecting the control of abortion disease are 1. Giving immediate attention to all symptoms. 2. Providing sanitary quarters. 3. Control of breeding activities. 4. Retention of heifer calves. 5. Retention in the herd of otherwise profitable cows. 6. Herd immunity. 7. Isolation of aborting cow. 8. Proper disposition of fetus and its membranes. 9. Disinfection of quarters. 10. Attention to feeding.

Herd Immunity.-The tendency of abortion disease is to run its course and gradually subside unless new, susceptible animals are introduced into the herd. The part that immunity plays in abortion disease is not thoroly understood. It cannot be said that a herd becomes absolutely immune, but practical experience has clearly established the fact that a herd will acquire a degree of immunity or tolerance of the disease not possessed by it when the disease first appeared. Establishing a so-called herd immunity can be accomplished by expert treatment of aborting cows and raising heifer calves instead of replenishing a herd by the purchase of mature cows. The establishment of herd immunity is a very effective method of reducing losses in infected herds. Not infrequently the disease abates as quickly as the onset was sudden.

186250 ▶▶ Mark, replying to Jay Berger, 4, #621 of 2327 🔗

Don’t know why you have such a fixation on trying to discredit the concept of herd immunity, but it’s not really open to question. It’s more of an evident fact about reality and the way our immune systems interact with pathogens. In most cases, once you’ve had a particular disease you are very unlikely to get it again for a while, and that fact in and of itself makes herd immunity a direct consequence..

You can argue about when and to what extent it applies in particular cases, or you can try to create a definition of it that is unachievable (such as zero infections), in order to use as a “straw man”, but general scepticism about it as a concept is intellectually questionable and of little use at the best of times. At the present time, it’s downright counterpoductive, as simply giving ammunition to the panickers and lockdowners.

186251 ▶▶▶ Nic, replying to Mark, #622 of 2327 🔗

Handjob denied herd immunity exists ,can you believe it I mean ffs

186081 mhcp, 4, #623 of 2327 🔗

A while back there was a movie called The Age of Stupid with the late Pete Postlethwaite.

It was all about a world that hadn’t dealt with the “climate crisis” with a man in 2055 looking back on the world.

It seems the Stupid is already here.

In the Philippines there was a famous senator called Miriam Defensor Santiago. She had some brilliant quotes put in a book called Stupid is Forever and then a sequel called Stupid is Forevermore.

“All professionals in our country need to pass a government exam. Only a politician does not need any kind of preparation to practise”

Another:

There is no substitute for a reputation.
It is like virginity: once lost, it can never be recovered.”

186097 THE REAL NORMAL PODCAST, 2, #624 of 2327 🔗

The next pod will be out SOON! Vaccine madness!

186102 Awkward Git, replying to Awkward Git, 2, #625 of 2327 🔗

Found on the EU patents Office website from 2015:

https://worldwide.espacenet.com/publicationDetails/biblio?II=0&ND=3&adjacent=true&locale=en_EP&FT=D&date=20200903&CC=US&NR=2020279585A1&KC=A1

A method is provided for acquiring and transmitting biometric data (e.g., vital signs) of a user, where the data is analyzed to determine whether the user is suffering from a viral infection, such as COVID-19. “

How did they know what something would be called 5 years before it was “discovered”?

Video about it no longer available – what a surprise:

https://www.youtube.com/watch?v=V1N_oKcqhYA

But this non-English one does:

https://www.youtube.com/watch?v=8V32yA9wUvQ

https://silview.media/2020/10/04/atomic-bombshell-rothschilds-patented-covid-19-biometric-tests-in-2015-and-2017/

186109 ▶▶ BeBopRockSteady, replying to Awkward Git, 2, #626 of 2327 🔗

I am giving this sort of stuff a wide bearth. Those patent records can be edited as time goes by. They maybe had patented a PCR test and added tie CV-19 reference later so it would be more appealing and show up in searches.

Obviously the Rothschikd name is a little errrrrrrrrr controversial

186131 ▶▶▶ Awkward Git, replying to BeBopRockSteady, -1, #627 of 2327 🔗

But an almost identical patent in the US in 2017 by the same person?

I agree it doesn’t prove much by itself but the coincidences are mounting up.

186170 ▶▶▶ Tenchy, replying to BeBopRockSteady, 1, #628 of 2327 🔗

I think you are 100% right here. I’ve worked on similar databases. The records have been updated with a new description. Nothing sinister.

186227 ▶▶▶▶ Awkward Git, replying to Tenchy, 1, #629 of 2327 🔗

Glad someone knows how these things work.

Reading the 2017 article and links it looks like it was written and patented back then and it then sits in the background until the publish date comes along which was September 2020.

It’s a bit like there is a few years where the people who patented it can make some money, tweaks etc before it becomes public and others can make similar systems.

186967 ▶▶▶▶▶ Richard Pinch, replying to Awkward Git, #630 of 2327 🔗

The filing date of the “Covid” patent is 03 Sept 2020. It claims a “priority date” of 13-Octo-2015 by reference of a related patent. To quote an EPO source

The priority date is the first date of filing of a patent application. It is essential for determining whether any subsequent application for the same invention can still be assessed as novel. It also makes it possible to determine whether the subject-matter of a patent application is prior art on a particular date. The priority date is, however, not necessarily the same as the filing date.

In this case, it seems that the 2015 patent “System and method for using processing and displaying biometric data” was the invention and the 2020 patent claims its applicability to Covid.

186105 p02099003, replying to p02099003, 8, #631 of 2327 🔗

I put this as a comment on our “local” newspaper website (Leicester Mercury) and it has been marked awaiting moderation now disabled!
“Content disabled again LM why??
R T-PCR positive or with symptoms?
These are the questions you should be asking using FOI, these are the important numbers.
How many patients are there in Glenfield/LRI with definite diagnoses of Covid19 excluding patients who have tested postitive for SARS-COV-2 virus but are ill from from the virus covering the period 4th July 2020 to 14th October 2020 stratified into weeks and also by age?
How many people have died with a definite diagnosis of covid19 excluding people who have just tested positive for the virus?”
This is after the following comment was disabled
More fearmongering from the local press. These are RT-PCR test results not genuine cases.
These are the questions you should be asking, not simply parroting numbers from another website.
Use the FOI to ask the questions
How many patients are there in Glenfield/LRI with definite diagnoses of Covid19 excluding patients who have tested postitive for SARS-COV-2 virus but are ill from from the virus covering the period 4th July 2020 to 14th October 2020 stratified into weeks and also by age?
How many people have died with a definite diagnosis of covid19 excluding people who have just tested positive for the virus?

186136 ▶▶ bucky99, replying to p02099003, 5, #632 of 2327 🔗

But that would be like, journalism…

186106 DRW, replying to DRW, 21, #633 of 2327 🔗

The worst thing about this is that a second lockdown has been planned since the first. They knew prevalance would increase in the autumn, as all colds do, and with mass dodgy testing they could generate the numbers required. Actual context dosen’t matter when the sheep just keep swallowing scary MSM headlines and soundbites. After some inconvenient pushback over the past month, Smarmer is now playing tag-team to get it over the line. Meanwhile, the big players are confident enough in the smokescreen to openly reveal their true objectives.

186133 ▶▶ Nick Rose, replying to DRW, 2, #634 of 2327 🔗

Then they are going to be disappointed. The tide has turned.

186282 ▶▶▶ DRW, replying to Nick Rose, 1, #635 of 2327 🔗

Is it? Round here, I just see an obedient flock of sheep.

186972 ▶▶▶▶ Cranmer, replying to DRW, 2, #636 of 2327 🔗

I think that’s still the case ‘on the ground’. But when you get popular TV presenters like Richard Madeley speaking out against the regulations, I think it means that things are starting to change.

186169 ▶▶ PoshPanic, replying to DRW, 1, #637 of 2327 🔗

They knew then the dates of the US elections. I was unconvinced, when I read somewhere back in March, that a lot of this panic was related to bringing down Trump. As we get nearer the date however, I’m now convinced this is part full blown culture war/part complete fuck up.

Boris actually said in the summer, he hoped things would improve after November.

Question is, what happens next?

186307 ▶▶▶ DRW, replying to PoshPanic, 1, #638 of 2327 🔗

The US vote is the ultimate litmus test, they need them on board to pull their plans off. Trump winning again will will be a massive blow, hence the increasingly desperate attacks.

186343 ▶▶▶ Awkward Git, replying to PoshPanic, #639 of 2327 🔗

You might enjoy listening to this lot:

https://www.youtube.com/user/X22Report/videos

Not sure how legit or sane he is and cannot vouch for his credentials or anything else but some of what he says gives me hope even if it is false hope.

186196 ▶▶ John Galt, replying to DRW, 5, #640 of 2327 🔗

Yep. They’ve been talking about a second wave since March, so it was obvious they were going to manufacture one.

I was unsure how they’d play it in regards to numbers – my assumption was they’d just lump in flu cases with corona, put that number as the big headline, and then only differentiate at the very end of the article, but it turns out that the test is so unreliable, it’ll just pick up flu as covid anyway!

186287 ▶▶▶ DRW, replying to John Galt, 1, #641 of 2327 🔗

As well as dog hair and a pavement.

186116 Awkward Git, replying to Awkward Git, 3, #642 of 2327 🔗

Maybe a bit off topic but why socially distance cars?

https://nypost.com/2020/10/12/biden-speaks-to-30-cars-of-supporters-at-ohio-drive-in-rally/

Can cars catch covid-19?

Can covid-19 travel through metal and windows to infect passengers?

Hell of a virus if it can do that.

But if he is supposedly going o win the US election then I would have thought more than 30 would have trend up.

On no-one at this rally:

https://www.waynedupree.com/2020/10/biden-harris-az-campaign-event-empty/

or were they all socially distancing as well?

186121 ▶▶ John Galt, replying to Awkward Git, 17, #643 of 2327 🔗

Can cars catch covid-19?
Yes.

You may laugh but my car caught covid-19. It stopped working, wouldn’t move from the driveway and started demanding that all other cars stay home too.

186132 ▶▶▶ bucky99, replying to John Galt, 4, #644 of 2327 🔗

Coughed & spluttered a bit before starting, too?

186135 ▶▶▶▶ Fingerache Philip., replying to bucky99, 2, #645 of 2327 🔗

My car has never had any taste.

186153 ▶▶▶▶▶ Sam Vimes, replying to Fingerache Philip., 1, #646 of 2327 🔗

My dog’s got no nose…

186302 ▶▶▶▶ calchas, replying to bucky99, #647 of 2327 🔗

The government has made it illegal to examine a car engine to find out what is (really) wrong ith it.

186203 ▶▶▶ Tom Blackburn, replying to John Galt, 1, #648 of 2327 🔗

Bit worried – Think my car may have Covid but is asymptomatic

186246 ▶▶▶ Nigel Sherratt, replying to John Galt, #649 of 2327 🔗

Perhaps it’s just a bit hungover.

186173 ▶▶ PoshPanic, replying to Awkward Git, #650 of 2327 🔗

My car’s always suffered from long covid

186383 ▶▶ Mel, replying to Awkward Git, #651 of 2327 🔗

My step daughters school have banned cars dropping kids off in the car park, because …. covid.

Wha??

186385 ▶▶▶ DRW, replying to Mel, 1, #652 of 2327 🔗

In September, my council was saying drop pupils off by car if possible.
In October, they were saying actually don’t because of severe congestion around schools.

186636 ▶▶ Basics, replying to Awkward Git, #653 of 2327 🔗

Social distancing concerns have repeatedly been used to pull the plug on various drive-in events. In truth I suspect ticket sales for the events have been non existant and so the projects pulled.

186978 ▶▶▶ Cranmer, replying to Basics, #654 of 2327 🔗

Let’s face it, Covid has been used a charter for jobsworths and life-haters.

186117 Mrs issedoff, 6, #655 of 2327 🔗

I have taken my car into the dealers this morning for its service. You couldn’t go into the office but had to be met outside for the hand over, you can however go into the office (muzzled of course) to pick up the keys when it is done. Another example of the ludicrous rules where Covid is concerned, it knows when a car is being brought in or picked up!. My husband will go in to pick up the keys, as I won’t wear a mask and can’t bring myself to be civil. I wouldn’t have used them if it hadn’t been for the fact that the service was part of the deal when I bought the car.

186122 Nigel Sherratt, 1, #656 of 2327 🔗

Ya may be a noisemaker, spirit maker
Heartbreaker, backbreaker
Leave no stone unturned
May be an actor in a plot
That might be all that you got
’Til your error you clearly learn …

Now, there’s a woman on my block
She just sit there as the night grows still
She say who gonna take away his license to kill?

186124 Cristi.Neagu, replying to Cristi.Neagu, 15, #657 of 2327 🔗

As i have been saying for a while now, just because the Tories have done an absolutely disastrous job handling this pandemic, it doesn’t mean Labour is any better!

186189 ▶▶ The Spingler, replying to Cristi.Neagu, 4, #658 of 2327 🔗

Though Corbyn voted against the government last night, defying his party who were told to abstain. Strange times!!!!

186199 ▶▶▶ Julian, replying to The Spingler, 4, #659 of 2327 🔗

I wasn’t and am not keen on J Corbyn for many reasons, and clearly Labour for various reasons are quite pro-lockdown, but I am beginning to think we may have been better off with Corbyn as PM. I think he has more spine than the PM.

186228 ▶▶▶▶ Mark, replying to Julian, 1, #660 of 2327 🔗

Absolutely not. Corbyn is and has all along been a full on panicker, referring to herd immunity as “eugenics” (the sure sign of a true knob).

Jeremy Corbyn: government lectured me about herd immunity

186204 ▶▶▶ Miss Owl, replying to The Spingler, #661 of 2327 🔗

As did Diane Abbott, to be fair to her.

186980 ▶▶▶ Cranmer, replying to The Spingler, #662 of 2327 🔗

The only Corbyn I’d vote for is Piers.

187173 ▶▶▶ SweetBabyCheeses, replying to The Spingler, #663 of 2327 🔗

I don’t find it odd. He’s just one of the few MPs who actually votes the way he believes.
Everyone on here decrying the MSM should take a moment to actually look at JC and consider whether their antipathy towards him is not just what the media MSM wanted you to think.
For starters, he couldn’t have been more obviously a Euro Skeptic without defecting to UKIP.

186125 Simon S, 7, #664 of 2327 🔗

Please would you stop using “cases” when you actually mean “positive test results”? If I want to know about “cases” I can just look at the Guardian or in fact any other MSM! Thank you!

186126 Dan Clarke, replying to Dan Clarke, 4, #665 of 2327 🔗

How does a 4th industrial revolution correlate to what is going on now? Can only think the controls are to stop riots when people realise that their jobs will go forever and a basic rate to live on is what’s on offer.

186129 ▶▶ Nick Rose, replying to Dan Clarke, 2, #666 of 2327 🔗

They were talking about the 4th industrial revolution long before anybody had heard of covid

186144 ▶▶▶ Dan Clarke, replying to Nick Rose, 1, #667 of 2327 🔗

Yes, so moved on to how to do it, presumably. Talking about climate change too before Covid, and how to solve it.

186653 ▶▶▶▶ Basics, replying to Dan Clarke, #668 of 2327 🔗

Global warming has been about since at least 1994 Rio Earth Summit (?). Global cooling in the 1970s was scientifically ‘proven’. I forget what we were doing in the 1980s, what it a litter pick?

186183 ▶▶▶ Cicatriz, replying to Nick Rose, 1, #669 of 2327 🔗

Yes, the company I work for are involved with it.

We’ve been talking about it since 2015/16 from memory.

186209 ▶▶ Cicatriz, replying to Dan Clarke, 3, #671 of 2327 🔗

4th industrial revolution is just a term used to cover further progression towards distributed systems requiring less and less human intervention. We’ve been on this course for some time, obviously, however various technologies (AI, IOT, AR, VR) are converging to accelerate the process.

I’ve been of the thinking for a while that we’re moving towards Universal Basic Income controlled by social credit systems. Enough politicians and think tanks have been talking about this over the past five or six years it shouldn’t be too controversial.

As far as current events are concerned, I think many technocrats view this as an opportunity to act as a catalyst or accelerant.

186216 ▶▶ PoshPanic, replying to Dan Clarke, 1, #672 of 2327 🔗

Maybe this is where the Singularity begins?

https://en.wikipedia.org/wiki/Technological_singularity

186220 ▶▶ zacaway, replying to Dan Clarke, 2, #673 of 2327 🔗

Well, my office just sent around the following survey. Notice how it segues from Covid into environmental issues, and none of the options are “no thanks, it’s a load of bollocks”. The goal presumably being to get this Green Wave outfit a justification for lobbying the company for various changes (presumably, filtered though the globalists’ agenda).

https://www.surveymonkey.co.uk/r/GWSurvey01

Looks like Green Wave is a political lobby group for Biden in the US:
https://thehill.com/policy/energy-environment/519272-green-groups-launch-green-wave-2020-initiative-to-boost-competitive

Here they are, got an award for

global solution helping acheive the UN’s Sustainable Development Goals.

https://www.greenwave.org/

186134 John P, replying to John P, 42, #674 of 2327 🔗

The leader of the opposition: (Sir) Iain Duncan Smith, Tory MP for Chingford and Wood Green talking to Julia Hartley-Brewer on Talk Radio:

https://twitter.com/MPIainDS/status/1316288595590885376

“This is not a circuit breaker. This is a business breaker.” Former Conservative Party leader Sir Iain Duncan Smith says Keir Starmer’s circuit breaker lockdown is “naked political posturing.”

Damn right.

186335 ▶▶ jakehadlee, replying to John P, 6, #675 of 2327 🔗

Christ – what world do we live in when Iain Duncan Smith is the clearest head in the room. In an age of giant problems, we are being led by intellectual pygmies. Has there ever been a lower-grade bunch of dribbling morons in a position of power than in the world right now. It’s Generation Fuckwit

186436 ▶▶▶ Edward, replying to jakehadlee, 3, #676 of 2327 🔗

He was one of the least effective Tory leaders, but that was more down to a lack of leadership ability – his views on most things have been fairly sound.

186137 chaos, replying to chaos, 23, #677 of 2327 🔗

The average age of “covid deaths” in the UK is around 82.
The average life expectancy in the UK is around 81.
Who are we still kidding?

186200 ▶▶ JHuntz, replying to chaos, 2, #678 of 2327 🔗

I always thought it was the median age at 82? Not that it makes much difference.

186350 ▶▶▶ thinkaboutit, replying to JHuntz, #679 of 2327 🔗

I think the median and average are very similar. I did look it up once but can’t remember the figures.

186146 Fingerache Philip., replying to Fingerache Philip., 31, #680 of 2327 🔗

Now let me get this right; if you have a drink in a pub, the virus will get you but if you have a “substantial” meal with that drink, it won’t.
I’m going to lie down now for a while.

186176 ▶▶ chaos, replying to Fingerache Philip., 3, #681 of 2327 🔗

I have seen the future. Felatio and cunnilingus are against the law. The future’s not bright. No one gets laid.

186198 ▶▶▶ zacaway, replying to chaos, 3, #682 of 2327 🔗

They are fine as long as you both wear a mask. Off to the gimp shop…

186288 ▶▶▶ Fingerache Philip., replying to chaos, 1, #683 of 2327 🔗

Apart from Bojo.

186186 ▶▶ Janice21, replying to Fingerache Philip., 7, #684 of 2327 🔗

It cant get you if you buy alcohol in an off licence or supermarket before 8pm, but if you dare buy alcohol after that time, Covid can get you!

187159 ▶▶ SweetBabyCheeses, replying to Fingerache Philip., 1, #685 of 2327 🔗

I can’t believe our supposed Libertarian PM is legislating on how hearty my supper has to be! What if I just want an omelette? Soup? Sometimes I just feel like Rice Krispies 😭

186151 Suitejb, replying to Suitejb, 2, #686 of 2327 🔗

You can get a circuit breaker on Amazon for £4.29. Am I missing something?

186155 ▶▶ Lockdown_Lunacy, replying to Suitejb, 3, #687 of 2327 🔗

I wish someone would open Matt Hancock’s circuit breaker…

186174 ▶▶ chaos, replying to Suitejb, #688 of 2327 🔗

That circuit breaker will be Chinese. It could be missing something.

186660 ▶▶ Basics, replying to Suitejb, #689 of 2327 🔗

That’ll be a cheap one shipping from China.

186152 chaos, replying to chaos, 8, #690 of 2327 🔗

They WILL call all the extra suicide and cancer etc deaths covid deaths. Look at how mnany ‘cases’ there are. It’s obvious.

186181 ▶▶ Janice21, replying to chaos, 3, #691 of 2327 🔗

I agree, I reckon they are still falsifying death certificates.

186669 ▶▶▶ Basics, replying to Janice21, 1, #692 of 2327 🔗

Combining flu and covid reporting and switching reporting to monthly instead of weekly seems to be curious. Less granular data, to use their phrase. Why that.

186157 Fingerache Philip., replying to Fingerache Philip., 18, #693 of 2327 🔗

Isn’t it amazing that every member of the “general public” when interviewed either say that they agree with the latest lockdown measures or say that they should be more severe; strange that, ain’t it.

186187 ▶▶ Tom Blackburn, replying to Fingerache Philip., 3, #694 of 2327 🔗

It has become unsafe to air one’s views unredacted. But, you must understand, there is no conspiracy.

186206 ▶▶▶ Fingerache Philip., replying to Tom Blackburn, 3, #695 of 2327 🔗

A good old saying goes:”Never believe anything that you are told and only half of that what you see”

186268 ▶▶ Country Mumkin, replying to Fingerache Philip., 1, #696 of 2327 🔗

Bad cop or very bad cop. That’s the options that have been presented to them. Starmer (or Whitty) vs Johnson. there’s no good cop option.

186165 chaos, replying to chaos, 6, #697 of 2327 🔗

lol The Flid Dum MP Munira Wilson calling for diversity in lockdown track and trace i.e. Polish, Pakistan, local accents, etc track and tracers. We’re fucked.

Meanwhile.. China is back to growth.

This opinion was designed and engineered in the UK but made badly with some shitty electrolytic capacitors in Creepy Tiny Winky China.
186172 ▶▶ sam, replying to chaos, 5, #698 of 2327 🔗

https://www.youtube.com/watch?v=GeykREAlYSg
Sky news Australia has woken up

186214 ▶▶▶ leggy, replying to sam, 4, #699 of 2327 🔗

They’ve been sceptical for months. Breath of fresh air compared to the UK joke of a media.

186194 ▶▶ JHuntz, replying to chaos, 1, #700 of 2327 🔗

Do these cunts do anything but virtue signal. A part from a few university loons no one cares about diversity.

186202 ▶▶ NorthumbrianNomad, replying to chaos, 5, #701 of 2327 🔗

Letting all those coughing grandmothers with dual nationality fly in from Pakistan for their free NHS treatment in April was presumably also a diversity initiative.

186178 Tim, replying to Tim, 16, #702 of 2327 🔗

Meanwhile, WHO chief Tedros Ghebreyesus was also dismissive of herd immunity on Monday ….. “Herd immunity is achieved by protecting people from a virus, not by exposing them to it, ” he said.

This is the exact opposite of the truth. Is this man rally the head of the WHO? If so, what hope do we have?

186188 ▶▶ OKUK, replying to Tim, 9, #703 of 2327 🔗

A quite astonishing statement! A bit like the head of the IMF saying “wealth is created by printing money not through useful economic activity”.

186192 ▶▶▶ zacaway, replying to OKUK, 5, #704 of 2327 🔗

I can believe the head of the IMF would say that. Welcome to the end of the Age of Reason.

186211 ▶▶▶▶ NorthumbrianNomad, replying to zacaway, 1, #705 of 2327 🔗

I thought she already had. It’s the tacit orthodoxy, anyway

186240 ▶▶▶ THE REAL NORMAL PODCAST, replying to OKUK, #706 of 2327 🔗

HA! Great comment bro.

186262 ▶▶ mhcp, replying to Tim, 1, #707 of 2327 🔗

Herd immunity, or general immunity is like progressive overload but for the immune system.

You adapt and get stronger depending on exposure.

Most of Nature follows this pattern until the continued exposure at higher and higher levels results in diminshed returns.

Stupidity on the otherhand gets stronger the more you do it

186283 ▶▶ Ruth Sharpe, replying to Tim, #708 of 2327 🔗

I had to read the statement by him twice! It does not bode well.

186344 ▶▶ Victoria, replying to Tim, #709 of 2327 🔗

Another way to try and wriggle out of the coming Class Action Law suit by Dr. Reiner Füllmich / ACU.
Germany’s Extra-Parliamentary Corona Investigative Commission Launching a Class Action Suit Against Corona Criminals
 https://www.globalresearch.ca/germany-extra-parliamentary-corona-investigative-commission-launching-class-action-suit-against-corona-criminals/5725633

186346 ▶▶ Victoria, replying to Tim, #710 of 2327 🔗

.Another way to try and wriggle out of the coming Class Action Law suit by Dr. Reiner Füllmich / ACU.

.Germany’s Extra-Parliamentary Corona Investigative Commission Launching a Class Action Suit Against Corona Criminals
https://www.globalresearch.ca/germany-extra-parliamentary-corona-investigative-commission-launching-class-action-suit-against-corona-criminals/5725633

186180 Cheezilla, 1, #711 of 2327 🔗

Here’s a fascinating look at the historical (and geological underpinnings of the N/S Divide that are so evident at the moment.

https://unherd.com/2020/10/england-has-always-been-two-nations/?tl_inbound=1&tl_groups%5B0%5D=18743&tl_period_type=3

186182 Fingerache Philip., 4, #712 of 2327 🔗

Forget the circuit breaker, what we want is a Bypass valve to divert us back to sanity.

186184 Crazy Times, replying to Crazy Times, 7, #713 of 2327 🔗

Around 25 used coronavirus swab tests were mistakenly handed out to students yesterday as part of a local testing scheme.

Wow… just wow…

https://www.dailymail.co.uk/news/article-8838763/Council-hands-USED-Covid-testing-swab-kits-mistake-students.html

186190 ▶▶ Fingerache Philip., replying to Crazy Times, 1, #714 of 2327 🔗

Well, “BUY ONE, GET ONE FREE”

186195 ▶▶ Miss Owl, replying to Crazy Times, 2, #715 of 2327 🔗

Gotta keep those infection rates up. We’re after top tier payouts.

186221 ▶▶ PoshPanic, replying to Crazy Times, #716 of 2327 🔗

Bet that’s the tip of the iceberg

186224 ▶▶ bucky99, replying to Crazy Times, 1, #717 of 2327 🔗

They’d be all fine if it was mine they’d reused.

186191 Miss Owl, replying to Miss Owl, 2, #718 of 2327 🔗

It’s interesting that Prof Bhattacharya says that “… contact tracing may make an outbreak worse.”

I read the article, but I couldn’t see where that was explained further. Unless he meant that people just aren’t telling contract tracers anything. But then, how would that make an outbreak worse? It would just be a case of it is what it is. Can anyone explain?

And while I’m in questioning mode, is there any country other than Sweden where the national response is being led by non-politicians?

186218 ▶▶ Cicatriz, replying to Miss Owl, 1, #719 of 2327 🔗

I agree with you. The only thing I can think of is that it causes risk compensation by people assuming there is a system in place that works.

I do think that is a genuine argument (one of many) against masks, but I’m less conviced where T&T is concerned.

187153 ▶▶▶ SweetBabyCheeses, replying to Cicatriz, #720 of 2327 🔗

Possibly because it is pointless to quarantine healthy people? And may also make things worse as you’re stuck indoors with others 24/7? In some households people don’t actually see each very often!

186205 p02099003, replying to p02099003, 1, #721 of 2327 🔗

Temporary mortuary to be set up in Nottinghamshire
https://www.bbc.co.uk/news/live/uk-england-nottinghamshire-54479215

186210 ▶▶ Paul, replying to p02099003, 5, #722 of 2327 🔗

More fear project propaganda and the masses will lap it up.

186269 ▶▶ Tenchy, replying to p02099003, 2, #723 of 2327 🔗

They set one up at Teesside Airport during “the wave” – but it wasn’t needed.

186294 ▶▶ Ceriain, replying to p02099003, 2, #724 of 2327 🔗

We got all this crap at that start. Temporary morgue in Hyde Park, etc.

All scaremongering bollocks!

186322 ▶▶ Basileus, replying to p02099003, #725 of 2327 🔗

It states:

In April, Nottinghamshire’s local authorities set up a similar site at an industrial unit in Mansfield during the outbreak, which fortunately was not used and has been “decommissioned”.
Councillor Sally Longford, the deputy leader of the city council, said: “The Mansfield facility… was deemed too large and costly when thankfully it turned out the government projections for death rates had been overly pessimistic.
“It was therefore agreed to set up a smaller facility… in the event of a second wave coinciding with annual winter pressures resulting in excess deaths.”

Well, they are hardly going to need this one are they?

186207 charleyfarley, replying to charleyfarley, 26, #726 of 2327 🔗

Just visited my daughter whose friend works in a care home. The friend has told my daughter that they have been told to record all deaths as covid deaths to avoid an autopsy/further investigation.

Quelle surprise!

186215 ▶▶ leggy, replying to charleyfarley, 6, #727 of 2327 🔗

I really don’t understand how people cannot see through it all.

186321 ▶▶▶ zacaway, replying to leggy, #728 of 2327 🔗

I think they are just not looking. If you only get your news from the BBC and don’t ask questions, they just don’t know this is going on – and probably will struggle to believe it even if you try to tell them.

186494 ▶▶▶▶ Neil Hartley, replying to zacaway, 2, #729 of 2327 🔗

I’ve got friends, neighbours and family who just watch the BBC News and aren’t inclined to look elsewhere for information. I try to help them understand what’s going on but they just don’t want to know and would rather try to ignore it until it’s gone away. Intelligent people too, but sadly non-inquisitive at best and ignorant at worst.

186223 ▶▶ James Leary #KBF, replying to charleyfarley, 5, #730 of 2327 🔗

They aren’t doing autopsies on Covid deaths – by order.

186235 ▶▶ l835, replying to charleyfarley, 2, #731 of 2327 🔗

I believe many Muslim deaths are treated similarly.

186236 ▶▶ Nigel Sherratt, replying to charleyfarley, 1, #732 of 2327 🔗

Assumed that was happening for a while, ever since the system was changed to create this perverse incentive. Good to have confirmation from source.

186239 ▶▶ THE REAL NORMAL PODCAST, replying to charleyfarley, 6, #733 of 2327 🔗

Mate, which nursing home? We’re doing a bit of a ring around and want to speak to a few NH’s about how this is all going.

186303 ▶▶▶ GiftWrappedKittyCat, replying to THE REAL NORMAL PODCAST, #734 of 2327 🔗

Good on you. I hope you get the info into the public domain if you get someone willing to speak out whilst protecting their anonymity of course.

186253 ▶▶ captainbeefheart, replying to charleyfarley, 4, #735 of 2327 🔗

Anyone who is told to commit fraud should not do it, but I can see why so many people would. They can just be pointed to the millions of unemployed people who are totally struggling and be told – this might be you if you disobey orders.

Similar things happened during the holocaust.

186217 Profound chap, replying to Profound chap, 7, #736 of 2327 🔗

Just wondering whether anyone else is considering cancelling media subscriptions based on Covid fear mongering?

Mine is the fT. Used to love that paper, it is excellent on so many fronts but how can I finance the fear it spits out.

186233 ▶▶ l835, replying to Profound chap, 5, #737 of 2327 🔗

Cancelled my tv licence last week. Won’t be renewing the News Yorker’ subscription as it’s massively anti Trump and pro lockdown. (Not a Trump supporter, just want balance!)

186245 ▶▶ Victoria, replying to Profound chap, 5, #738 of 2327 🔗

Indeed. It is sickening!

Used to buy the the Telegraph on an adhoc basis – no longer.
Used to read DM headlines online – no longer.
Used to listen to Radio 2 in the morning – no longer (Absolute 80s is much better and more fun)
Used to watch BBC once in a while – making a point of not watching any BBC programs

186277 ▶▶ IsabelleG, replying to Profound chap, 2, #739 of 2327 🔗

Considering signing up to the Guardian. Pure comedy gold. Could use a chuckle in the mornings.

186301 ▶▶▶ Miss Owl, replying to IsabelleG, 5, #740 of 2327 🔗

For something to escape: check out Talking Pictures TV (Freeview 81 where I am): mad old films, mad old tv series, and NO NEWS WHATSOEVER.

Fabulous.

186338 ▶▶▶ Victoria, replying to IsabelleG, 1, #741 of 2327 🔗

Why on this earth would you like to give your money to the Guardian?

186306 ▶▶ steph, replying to Profound chap, 1, #742 of 2327 🔗

Yes, my Telegraph subscription cancelled. I’ll miss the one or two good opinion pieces from Allison Pearson, Sherelle Jacobs etc but for the most it was just good old scaremongering headlines straight from the Ministry of Truth and I’m not funding that.

186327 ▶▶▶ kenadams, replying to steph, 1, #743 of 2327 🔗

I just googled Allison Pearson, and the three first hits with images on the strap line at the top are her own latest tweet (fair enough), but then two tweets from other people calling her breathtakingly stupid and evil because of her attitude towards covid.

Same search in DuckDuckGo just reveals her own articles and one on her being banned from twitter.

Google really has been got at.

186328 ▶▶ jakehadlee, replying to Profound chap, #744 of 2327 🔗

Cancelled BBC licence, stopped reading Guardian (appalling news/opinion but best sports section in any paper, will miss it but not them)

186341 ▶▶ DRW, replying to Profound chap, 1, #745 of 2327 🔗

I’ve stopped reading two forums completely succumed to the hysteria. One of them even has an arsey muzzealot.

186379 ▶▶ kf99, replying to Profound chap, 1, #746 of 2327 🔗

When it all started(before this site even existed) I picked a Private Eye in smith’s to see what they’d make of it. Never again.

186445 ▶▶▶ Edward, replying to kf99, 3, #747 of 2327 🔗

I won’t be renewing my Private Eye subscription when it comes round in January. Not just their covid coverage, with a few exceptions it’s become too predictable and unfunny.

186482 ▶▶ annie, replying to Profound chap, 2, #748 of 2327 🔗

Cancelled DT, Cancelled National Trust.
Left church…

186495 ▶▶ Neil Hartley, replying to Profound chap, #749 of 2327 🔗

BBC

186656 ▶▶ Awkward Git, replying to Profound chap, 2, #750 of 2327 🔗

Cancelled TV licence and most club and magazine memberships that bang on continuously about it and the new green utopia and how we must obey.

187203 ▶▶ Bart Simpson, replying to Profound chap, 1, #751 of 2327 🔗

Cancelled my Times subscription – it was just becoming a propaganda rag. I miss Neil Oliver’s column though.

Have boycotted the MSM for years now.

And also have cancelled my National Gallery membership.

186219 Thomas_E, replying to Thomas_E, 77, #752 of 2327 🔗

Just had a business meeting on Teams (I’m in the office, everybody else at home as the TFL is NOT SAFE (eye roll). We were talking about this situation and I said a couple of skeptical facts out loud..Somebody then said, listen I know you are not one fo those covid deniers ae you? I know I should kept my mouth shut but I said well a virus that has a 99,98% survalibity rate and where the average age of death is higher than the normal lif expectancy is really not more dangerous than the flu….Tumbleweeds for about 40 seconds…people stopped breathing. I just laughed and continued the meeting like nothing happened.. I had enough, fuck them!

186226 ▶▶ Richard O, replying to Thomas_E, 21, #753 of 2327 🔗

Join the club. I do this every day, and my colleagues hate me for it.

186229 ▶▶▶ THE REAL NORMAL PODCAST, replying to Richard O, 8, #754 of 2327 🔗

This is gold! We do it all the time in our respective jobs!

186243 ▶▶▶▶ Julian, replying to THE REAL NORMAL PODCAST, 11, #755 of 2327 🔗

I wish I could but I am one of the bosses and feel like I should stay away from discussing controversial topics with staff.

But am familiar from other contexts with the open-mouthed reaction and with the pathetic inability to deal with someone who dissents from a narrative without using the word “denier” or “conspiracy theorist” – anyone who does so immediately goes down in my book as an intellectual pygmy who has already lost the argument.

186325 ▶▶▶▶▶ Thomas_E, replying to Julian, 24, #756 of 2327 🔗

My team and I have been in the office every single day of this Fakedemic…we are all key workers and I’m the manager. I say these things in very senior meetings because I just have had enough of this bullshit and will not listen to somebody who has basically been hiding in their house since March. I keep getting the ” you must be so brave ” talk all the time”. The reason ? Because I go to the office every day and take public transport? We have now made fear into a virtue and paranoia into a religion. My team know I don’t wear mask and don’t tolerate one in the workplace ( despite the new rules). What they do outside the office is their business. To be fair to them not one of them said they were scared or anything like it even during the height of this in April, May..

187220 ▶▶▶▶▶▶ Fingerache Philip., replying to Thomas_E, 3, #757 of 2327 🔗

Some people have actually said to me and my wife “Oh you are really brave and don’t you feel scared” for going for a cup of coffee.

186237 ▶▶ TJN, replying to Thomas_E, 6, #758 of 2327 🔗

That post has cheered me today! Good one.

186249 ▶▶ leggy, replying to Thomas_E, 6, #759 of 2327 🔗

I may have been guilty of regularly speaking similar things during the never ending sequence of Teams/Google Meets/Skype/Zoom calls.

186373 ▶▶ steve_w, replying to Thomas_E, 12, #760 of 2327 🔗

I usually say – ‘its just a cold’ and when I get the reply ‘colds dont kill 45,000 people’ I correct them and say ‘colds kill several hundred thousand per year in the UK – if you counted it in the same way as covid – although I tend to think both colds and covid are just complicating factors in deaths of old age’

186473 ▶▶ John Ballard, replying to Thomas_E, 7, #761 of 2327 🔗

You sound like me in the office….massive sceptic surrounded by a lot of people who are far from the worst (or they wouldn’t be here) but look at me like I’m mad when quoting the ONS weekly death rates every Tuesday !

187210 ▶▶ Bart Simpson, replying to Thomas_E, 2, #762 of 2327 🔗

I know how you feel. I must be the only sceptic in my work – every time I cite facts and the dire effects of lockdown, I’m always greeted with the following:

  1. but what about the second wave?
  2. cases are going up so we should lockdown harder
  3. people are so selfish
  4. if only people followed the rules this would be over

It’s reached the point now where they’re deaf to any reason and logic so I’ve come to the conclusion that only compulsory redundancy would wake them up.

186225 Steve Hayes, 4, #763 of 2327 🔗

latest iteration of the “cases down, lockdown working, cases up, more lockdown needed” strategy that can never be wrong.

The can never be wrong is a hallmark of pseudoscience.

186238 Richard O, replying to Richard O, 21, #764 of 2327 🔗

The leadership across the board have nothing to offer except a dystopian abyss. The “vaccine as the saviour” narrative is falling apart at the seams.

The choice we face is becoming increasingly stark: comply and face up to the end of our civilisation, or rebel. This point needs to be conveyed more and more aggressively to the people around us who are still under the spell.

186257 ▶▶ PoshPanic, replying to Richard O, 1, #765 of 2327 🔗

That’s pretty much the sum of it.

186241 Awkward Git, replying to Awkward Git, 8, #766 of 2327 🔗

Most terrifying thought for today:

After seeing an earlier comment about the SDP I went to their website to read it.

Ye gods, I may agree with them – truly frightening and strange times if that is the case.

186244 ▶▶ leggy, replying to Awkward Git, 5, #767 of 2327 🔗

Don’t worry, I found myself agreeing with UKIP yesterday.

https://www.ukip.org/the-results-are-in-authoritarianism-has-failed

186247 ▶▶ Cicatriz, replying to Awkward Git, 5, #768 of 2327 🔗

The SDP have been sensible on a few policy areas in recent years. They’ve basically found a niche by pitching themselves where labour should be.

186263 ▶▶▶ kenadams, replying to Cicatriz, 4, #769 of 2327 🔗

The SDP say lots of sensible stuff, and are, if not outright anti-lockdownists yet, certainly very close to it. Have a look at some of the articles on here: https://sdp.org.uk/sdptalk/

186265 ▶▶▶ kenadams, replying to Cicatriz, 8, #770 of 2327 🔗

And see this press release from their leader:

“The SDP today announces its opposition to the government’s new COVID-19 restrictions. We call on the government to instead adopt a sustainable public response to the pandemic, befitting the long-term challenges it poses.

The newly-unveiled restrictions demonstrate a failure by policymakers to adequately consider the long-term social and economic health of Britain. Alongside the harm inflicted upon the nation’s struggling hospitality industry, the new restrictions on social gatherings are set to indefinitely deprive many people of the collective experiences which are essential to their sense of belonging, purpose, and humanity.

Besides the long-lasting damage inflicted by the restrictions, these measures also threaten to permanently undermine the liberties and freedoms of the British people. The introduction of ‘COVID-19 Secure Marshals’, ostensibly to help local authorities support social distancing, represents a heavy-handed intrusion by the state into the lives of individual citizens.

“A considerate approach is needed in response to COVID-19,” says William Clouston, SDP Leader. “The government should encourage and enable the vulnerable to voluntarily shield themselves, while calling on the rest of the population to behave in a respectful, responsible and tolerant manner. The virus is here and may remain for some time, which means a ‘stop-go’ approach to opening and closing society is unsustainable and inappropriate.

“Furthermore, some restrictions on personal freedom are unacceptable in a free society. The threat of curfews, limits to social gatherings and the compelled wearing of face masks represent an unprecedented encroachment into the dignity and autonomy of Britons, which we fundamentally oppose. The government’s response to COVID-19 must be communitarian, not draconian.”

186333 ▶▶▶▶ Awkward Git, replying to kenadams, 2, #771 of 2327 🔗

Help – I’m turning into a SDP supporter!!!

186406 ▶▶▶▶▶ kenadams, replying to Awkward Git, 5, #772 of 2327 🔗

All that matters now is anti-lockdown or pro-lockdown. Nothing else is relevant.

186419 ▶▶▶▶▶▶ annie, replying to kenadams, 2, #773 of 2327 🔗

Utterly agree

186650 ▶▶▶▶▶▶ Awkward Git, replying to kenadams, 1, #774 of 2327 🔗

I’m just shocked after many years (I remember them being formed) I’ve actually agreed with them on something.

186336 ▶▶▶▶ Victoria, replying to kenadams, 2, #775 of 2327 🔗

Great start, I can support them on a temporary basis. However if they continue fighting for our rights and liberties and fighting against the lockdown nonsense, it might become more permanent.

186439 ▶▶▶▶▶ kenadams, replying to Victoria, 2, #776 of 2327 🔗

Why not join? I have, and I’ve attended (Zoom of course) meetings. You won’t be joining a group of full on lockdown sceptics, but many members are leaning that way, or at the very least are open to debate about the topic. And, it is a pool of people with at least a bit of political clout – although it is a very small party, the leader William Clouston does appear on Talk Radio and things.

186480 ▶▶▶▶▶▶ annie, replying to kenadams, #777 of 2327 🔗

I am coming your way…

186661 ▶▶▶▶▶▶ BJJ, replying to kenadams, 1, #778 of 2327 🔗

I thought they were all about identity politics, trans rights, hate speech, New Green Deal, fascists that is…

186672 ▶▶▶▶▶▶▶ kenadams, replying to BJJ, 1, #779 of 2327 🔗

They/we are anti all of those things. Really. Have a look at the website, particularly sdptalk. There are articles on there anti virtually everything you’ve just listed.

186242 fiery, replying to fiery, 5, #780 of 2327 🔗

This has probably already been posted as I don’t have time to read all the comments.
Imagewww.bbc.com › news › uk-england…
Web results
Used coronavirus tests handed out by mistake in Birmingham – BBC News
60 minutes ago — One student who was given a used kit said some people had opened and used the testing kits.

186293 ▶▶ The Filthy Engineer, replying to fiery, 5, #781 of 2327 🔗

It’s an absolute fucking joke! Not only have they just created a potential biohazard contamination problem they have also breached GDPR by revealing the names and addresses of other people who have had tests.

You couldn’t make this stuff up.

186248 Ricky R, replying to Ricky R, 13, #782 of 2327 🔗

Who else can’t wait 2, 3 or 4 weeks after the start of the “circuit breaker” when measures are extended as there are still too many cases. The fact people are falling for this again is unbelievable. Circuit breaker is just 3 weeks to flatten the curve with a PR friendly spin.

186256 ▶▶ Richard O, replying to Ricky R, 6, #783 of 2327 🔗

Obvious isn’t it? “Just 3 weeks to break the circuit” blah blah blah.

Less people are falling for it this time than in March, but still enough to ensure that it will be implemented regardless.

186258 ▶▶ Country Mumkin, replying to Ricky R, 2, #784 of 2327 🔗

Absolutely. I wonder if we can say to people… a friend of mine said to me the other day “insert your words above” what do you think? And see what they say. Take it away from ourselves saying it. It may be easier to open conversation with people if they feel they are having a conversation about someone else thoughts.

186299 ▶▶ Suitejb, replying to Ricky R, 2, #785 of 2327 🔗

Surely the purpose of a circuit breaker is that it is triggered by an event that threatens a whole system. Whatever triggered the circuit breaker is then mended/rectified and off the system goes until a completely different fault occurs. You don’t simply keep triggering the circuit breaker ad infinitude without trying to correct the cause.

186481 ▶▶▶ Edward, replying to Suitejb, 1, #786 of 2327 🔗

I’m not an electrician but I’m sure you’re correct. The computer equivalent is “Have you tried switching it off and on again?”, often said humorously but it’s a standard thing to try. The “circuit break” for Covid-19 would only work if it miraculously caused the virus to disappear, which of course it wouldn’t.

186254 Crazy Times, replying to Crazy Times, 38, #787 of 2327 🔗

It’s a cult. I’m now fully convinced. I went through a few places looking at the hallmarks / signs of cults & cult behaviour. How familiar are these?

1. Opposing critical thinking
– See the numerous academics/doctors being shutdown for questioning the narrative, showing other data.

2. Mind-Altering Practices Are Used
– The purpose of these activities is to suppress doubt. (see mask wearing). Therefore, if one person sees their friends and contemporaries participating in some sort of group chant or denunciation service, they’ll naturally want to be part of the crowd and participate as well. Going against the grain might not only be dangerous; it could be undesirable from a social standpoint as they don’t want to lose their friends.

3. Members Must Seek Permission Before Engaging in Certain Activities
– In addition to seeking permission, members must abide by the guidelines set forth by the leaders. Contact tracing, crazy rules that make no sense, etc.

4. The Group Is Elitist
– Essentially, this means that the group — and its leader — consider themselves to be the cream of the crop. They aren’t mere mortals; they’re on a special mission to save humanity. See Bill Gates or almost any other world leader hyping this up and promising to save us all.

5. The Ends Justify the Means
– How many times have we heard this now? How many are dying because of this insanity through suicide, cancer deaths, etc. but it’s some how framed as acceptable loss for the greater good.

6. A Strong Us vs Them Mentality
– See how they have framed COVID deniers, anti-vaxxers, or anybody that questions the narrative.

7. The Leader Is Not Accountable to Other Authorities
– There seems to be no accountability about anything throughout this, fuck up after fuck up. The chaos and mistakes keep stacking up with nobody being held to account.

8. Shame and Guilt Are Prevalent
– Exactly how people feel when they can’t attend a love one’s death, funeral or visit a loved one in a care home.

9. Group Members Must Cut Ties with Their Families
– Lockdowns have this one fully covered.

10. A Huge Time Commitment
– People have become obsessed with COVID, news watching, altering their behaviours, etc. It’s become a constant talking point and fixture of daily life.

11. A Requirement to Socialise with Fellow Members Only
– They’ve basically done away with socialising, but groups firmly in the COVID camp do seem to quickly ostracise anybody who doesn’t agree with things like masks, etc.

12. There Is Nothing Worth Pursuing Except the Group’s Goals
– Forget everything else. We must flatten that curve.

13. Fear and Dread
– Seen anything positive in the media in the last 8 months? Even if we get through this we have economic collapse & a long recession beckoning.

14. Separation from the Church
– How many churches and religious groups have been basically shutdown? My wife used to go to church every week, she hasn’t been since March.

15. They practice deception
– Deliberately withholding or distorting information, and/or lying. There’s just too much I could list here.

16. They minimise or discourage access to non-cult sources of information
– TV, internet, media have all been forced to not question anything and shoot down anything that questions the narrative. Actively blocking/hiding anyone or anything questioning this madness.

17. They make extensive use of cult-generated information and propaganda
– No comment necessary

18. They make the person feel that problems are always their own fault, never the leader’s or the group’s fault
– How many times have the government blamed the public for rising figures?

186259 ▶▶ calchas, replying to Crazy Times, 5, #788 of 2327 🔗

Yes – see the latest article on off-guardian from C J Hopkins.

186261 ▶▶ Richard O, replying to Crazy Times, 12, #789 of 2327 🔗

Which is why this is so dangerous. No amount of rational argument will persuade them to change their minds.

186271 ▶▶▶ captainbeefheart, replying to Richard O, 3, #790 of 2327 🔗

Once a critical mass of people are persuaded, the masters of the universe will probably commit an act of biological warfare and release an even more deadly strain.

“IT’S MUTATED!” everyone will scream. Most of the commentators here will switch sides, sites like this will be closed down – not really winnable this one is it?

This is of course pure fiction, they’d never do anything like that.

186285 ▶▶▶ Lockdown_Lunacy, replying to Richard O, 5, #791 of 2327 🔗

I’ve noticed that no matter what angle you try to take with these people, whether logical, emotional, statistical or economic they just don’t seem to hear you at all. It’s as though their responses are completely premeditated.

186292 ▶▶▶▶ Richard O, replying to Lockdown_Lunacy, 7, #792 of 2327 🔗

I have found exactly the same with the most brainwashed/zealous. I’m afraid we have to give these people up as lost.

There are however a substantial number in the “go along to get along” group that we can still get to. This is where we must focus our efforts.

186324 ▶▶▶▶▶ Lockdown_Lunacy, replying to Richard O, 2, #793 of 2327 🔗

Yes I agree. Disappointed in myself in that I wasted half my morning being called ‘selfish’ trying to persuade a zealot over social media, should know better by now but it’s hard to resist sometimes!

186340 ▶▶▶▶▶▶ Richard O, replying to Lockdown_Lunacy, 5, #794 of 2327 🔗

Sadly social media attracts the most zealous cult members of all. As this is information in the public domain, rather than an individual interaction, doing this is not a wasted effort. Disrupting their signal is important.

186948 ▶▶▶ Jay Berger, replying to Richard O, #795 of 2327 🔗

A change of course normally needs just 10-20% of the people who are opposed to the current course of action become active and gain traction- see climate change etc..
Barring that, politicians and the public can and will only be able to change their opinion and course of action after the
catastrophe(s) have occurred.
I expect those to be a combination of hyperinflation, debt defaults, unemployment/depression, concentration camps and vaccine deaths and damages.
Possibly many of them deliberately brought about, in particular sterilizations through these Frankenstein vaccines.

186278 ▶▶ merlin, replying to Crazy Times, 6, #796 of 2327 🔗

I agree with your analysis. I have brought some friends and family members to the sceptic side but there are a number of relatives of mine who are covid fanatics.
They happen to belong to religious cults and may find the pseudoscience and coercion of the covid cult soothing and appealing.

186298 ▶▶ Two-Six, replying to Crazy Times, 6, #797 of 2327 🔗

Yes it really is a cult. The mass public are brainwashed cultists. Check this out, it was posted by somebody else on here a while ago and I have re-posted it a few times. It’s that good. This brainwashing or cult indoctrination has been done “by the book”.

************************

Alexander Whorf (Posted on http://www.lockdownsceptics.org )

Uncanny parallels between what governments have done and Dr Singer’s research on religious cults. Those responsible should be held to account.

Tactics for Psychological Coercion (AKA “Brainwashing”) – Dr Margaret Singer (1921-2003)

1.     EXACT REPETITION
Techniques to increase suggestibility and ‘soften up’ the individual via hypnotic or other suggestibility increasing techniques such as extended audio drills, excessive exact repetition of routine activities.

2.     SOCIAL ISOLATION
Establishment of control over the victim’s social environment, time, and sources of social support through creating social isolation; removing contact with family and friends, as well as persons who do not share group-approved attitudes.

3.     INFORMATION CONTROL
Rejection of alternate information and separate opinions. Rules exist about permissible topics to discuss. Communication is highly controlled. An ‘in-group’ language is usually constructed.

4.     ALTER REALITY PERCEPTION
Make the person re-evaluate the most central aspects of his or her experience of self and prior conduct in negative ways. Efforts are designed to destabilize and undermine reality awareness, world view, and defence mechanisms.

5.     CONFUSE TARGET
Create a sense of powerlessness by subjecting the victim to intense and frequently confusing, conflicting actions and situations which undermine the victim’s self-confidence and judgement.

6.     PUNISHMENT
Creating strong, aversive, emotional arousals in the subject by reactions such as intense humiliation, loss of privilege, social isolation, social status changes, intense guilt, anxiety, and manipulation.

7.     CONFORMITY THREATS
Intimidate with group-sanctioned psychological threats. For example, it may be suggested that failure to adopt the approved behavior will lead to severe punishment or the reappearance of a prior physical illness.

186312 ▶▶▶ Richard O, replying to Two-Six, 6, #798 of 2327 🔗

This is exactly what has been done to us.

Thankfully we are strong enough to withstand the programming. Clearly, we are in a minority. It will be for future historians to ponder why so many surrendered to the cult.

186397 ▶▶▶▶ Mrs issedoff, replying to Richard O, 10, #799 of 2327 🔗

I agree Richard, it depends on personality type as to whether or not we are drawn into the cult and all its lies. I was thinking about myself and if I have always been one to fight against the tide, the answer was yes. As an example, I am a middle aged woman who according to lots of rubbish put out there, should have my hair cut short, wear frumpy clothes and sit knitting for the grand kids. I have long hair, wear what ever I like and still enjoy partying. Maybe a wishy washy analogy but you get my drift. I will fight against this crap to the end and stick my fingers up to those who feel they have a right to judge me.

186509 ▶▶▶▶▶ stefarm, replying to Mrs issedoff, 2, #800 of 2327 🔗

Hmm, have you got a boyfriend? If not I’ll take you out

186410 ▶▶▶▶ annie, replying to Richard O, 4, #801 of 2327 🔗

… and why we didn’t.

186510 ▶▶▶▶ JohnB, replying to Richard O, 3, #802 of 2327 🔗

Sod future historians. They surrendered because they watch (too much) telly and have given up thinking for themselves.

186300 ▶▶ Dan Clarke, replying to Crazy Times, 1, #803 of 2327 🔗

text book

186475 ▶▶ tonyspurs, replying to Crazy Times, 1, #804 of 2327 🔗

Like all cults this will end one way when the Cult leaders tell the cult members the only way to save themselves is to kill themselves at 8pm on their own doorsteps

186255 John P, 1, #805 of 2327 🔗

Today’s lockdown sceptics includes an amazing discovery: Dr Whitty bears an uncanny resemblance to Dr Beaker from Gerry Anderson’s Supercar! – Toby Young on twitter

Yes, Toby, but the Beaker puppet is much more lifelike don’t you think?

(just a joke!)

186260 wendyk, 5, #806 of 2327 🔗

https://www.dailymail.co.uk/news/article-8838727/Academics-circuit-breaker-study-admit-death-figures-estimated.htmlE

Yet another mea culpa from one of our circuit breaker specialists.

We should pull the plug on these circuiteers and their political poodles.

186266 Richard O, replying to Richard O, 10, #807 of 2327 🔗

https://metro.co.uk/2020/09/28/dr-hilary-jones-questions-whether-democracy-should-be-scrapped-to-fight-coronavirus-13336162/

Democracy has already been scrapped, so I’m not quite sure what the doctor’s point is here. At least it is a very clear public declaration of where the Covid Cult wants to take us.

186273 ▶▶ zacaway, replying to Richard O, 9, #808 of 2327 🔗

This is certainly bringing all the fascists out of the woodwork

186492 ▶▶ JohnB, replying to Richard O, 1, #809 of 2327 🔗

dr-hilary-jones-questions-whether-democracy-should-be-scrapped-to-fight-coronavirus

Democratic society questions whether Dr Hilary Jones should be scrapped/scraped/raped to fight crazy fascists.

186272 Ceriain, replying to Ceriain, 13, #810 of 2327 🔗

Are there any of the stats guys about?

Sorry for the long post, but there’s something been really bugging me for a while about the England admissions numbers and now that the new England NHS “October 2020 COVID Publication” spreadsheet is available from here: https://www.england.nhs.uk/statistics/statistical-work-areas/covid-19-hospital-activity/
I thought I’d have a closer look.

I’m really troubled by 2 statistics: these can be found on the Admissions Total tab and the Diagnoses Total tab.

The definitions for these 2 stats are as follows:

Admissions Total : Admissions – Number of patients admitted with COVID-19 (Last 24hrs)

Diagnoses Total : Diagnoses – Total number of inpatients diagnosed with COVID (Last 24hrs)

It seems to me that the Patients admitted to hospital number reported on the daily Gov.uk page: https://coronavirus.data.gov.uk/healthcare is made up of the total of these two figures.

I made a spreadsheet up using the numbers for September, and it appears (to me anyway) that the majority of the reported ‘ admissions ’ are from inpatients, i.e. people already in hospital. In some cases that figure is 3 to 4 times the number of people actually PHYSICALLY ‘admitted’ to hospital from outside.

I’ve attached a pic showing September. A couple of examples: (remember numbers are for the previous 24 hours, so I’ve corrected to the actual ‘admitted’ dates .)

September 28: Number of patients admitted with COVID-19 (Last 24hrs): 79

September 29: Total number of inpatients diagnosed with COVID (Last 24hrs): 231

September 29: Recorded admissions figure on Gove.uk: 310 (i.e. the sum of the 2 above)

**************************

September 19: Number of patients admitted with COVID-19 (Last 24hrs): 33

September 20: Total number of inpatients diagnosed with COVID (Last 24hrs): 204

September 20: Recorded admissions figure on Gove.uk: 237 (i.e. the sum of the 2 above)

***************************

This is true for the whole of September (and all previous months).

I hope you can all see where I’m going with this, but it looks to me that the ACTUAL ‘physical’ admissions number (i.e. people actually going into hospital with Covid-19) is dwarfed by the ‘fake’ admissions (i.e. patients already in hospital being tested positive, then being called ‘admissions’), sometimes by a factor of 4 or 5, or even more.

Can someone have a look and prove me wrong, please?

Because, if I’m not wrong, it’s one hell of a misleading ( to the point of downright lying ) figure to report daily. They are essentially passing off inpatient diagnoses as new admissions.

186290 ▶▶ Locked down and out, replying to Ceriain, 5, #811 of 2327 🔗

If you are correct (as I am sure that you are), this is pure dynamite. It needs Carl Heneghan to take a close look at it. If you can find his e-mail address somewhere (maybe Toby has) then I would send your findings to him and for verification.

186317 ▶▶▶ Ceriain, replying to Locked down and out, 4, #812 of 2327 🔗

I’m aware that Heneghan looked at the Daily Admission sheets as they were coming out and suggested something was amiss; I think he said a third were ‘fake. But with the monthly report it is clearer to see.

Huge caveat: I think my observations are correct.

186356 ▶▶▶▶ Ceriain, replying to mattghg, #814 of 2327 🔗

Thanks, matt. 🙂

I’ll wait till someone tells me I’m not talking rubbish first.

186425 ▶▶▶▶▶ Iansn, replying to Ceriain, 5, #815 of 2327 🔗

you are not talking rubbish

186792 ▶▶▶▶▶▶ Ceriain, replying to Iansn, #816 of 2327 🔗

Thanks, Ian. 🙂

186309 ▶▶ PoshPanic, replying to Ceriain, 1, #817 of 2327 🔗

Add to that, the numbers tested on admission, say A&E, who aren’t going in for respiratory conditions.

https://twitter.com/ClareCraigPath/status/1315966137499291649

186310 ▶▶ kenadams, replying to Ceriain, 9, #818 of 2327 🔗

I’m fairly certain this is correct. My wife and I are going into hospital tomorrow for a planned c-section, and we got covid tested (were made to) yesterday. So, if she is positive, she’ll be counted as a ‘covid patient’ despite having no symptoms, not being in hospital because of covid, and nothing about the visit on any level relating to covid.

186364 ▶▶▶ wendyk, replying to kenadams, 2, #819 of 2327 🔗

What about your new baby when he/she is born? Will your wife be able to establish crucial early contact with your newborn, or will the Covid Constraints interfere?

I hope not,for all your sakes.

Best wishes

186380 ▶▶▶▶ kenadams, replying to wendyk, 3, #820 of 2327 🔗

I’ll let you know after the weekend! In fairness, we didn’t get that for the first one either (pre-Covid obviously) for legitimate reasons because of lots of things going wrong and emergency surgery and stuff.

186430 ▶▶▶▶▶ wendyk, replying to kenadams, 1, #821 of 2327 🔗

Good luck to you both, and your new baby.

186405 ▶▶▶▶ annie, replying to wendyk, 3, #822 of 2327 🔗

Only an anecdote, but somebody told me about a woman in Belgium who ‘tested positive’ on entering the hospital for the birth of her baby, and when it was born they made her stay six feet away from it.

186426 ▶▶▶▶▶ wendyk, replying to annie, 1, #823 of 2327 🔗

Horrible!

186377 ▶▶▶ Ceriain, replying to kenadams, 5, #824 of 2327 🔗

Best wishes to your wife, and you, of course.

186311 ▶▶ calchas, replying to Ceriain, 4, #825 of 2327 🔗

The statistics have been deliberately and systematically presented right from the beginning in order to present the most frightening picture possible of Covid.-19.

Why should they stop now?

186313 ▶▶ Achilles, replying to Ceriain, 2, #826 of 2327 🔗

When analysing this data it is worth paying attention to the definitions (on the same page):-

• Number of patients admitted with COVID-19 in last 24 hours

Count in this data item any person admitted in the last 24 hours who was known to be positive at admission under confirmed COVID-19 patients (with age split)

• Number of inpatients diagnosed with COVID-19 in last 24 hours

Count any patient diagnosed between midnight (00:00:00) to 23:59:59 on the day before reporting (with age split). Only include first positive tests within the admission – so a patient should not count on this line for a second time if they have a repeat test within the same admission which is also positive. Do not include patients who were diagnosed positive prior to admission to hospital (ie exclude patients where the result of the test was known at admission – patients who were tested prior to admission, but whose results were not known until after admission should be included), or patients who were discharged, or died, before the diagnosis was made. Diagnosed in this context relates to the point at which the result is known to the trust.

• Estimated admissions

This is a derived figure, it adds those patients who are diagnosed with COVID-19 in hospital to those patients who were admitted to hospital with confirmed COVID-19. It represents a count of patients who, on a given day, have been added to the count of people in hospital with COVID-19. A worked example – the 74 patients in hospital who received positive test results on 4 July are assumed to have been tested on 3 July and it is at the point of testing that they become a patient in hospital with COVID-19. These 74 patients are then added to the 72 patients admitted to hospital with confirmed COVID-19 on 3 July to create an Estimated Admission figure of 146 for 3 July.

186342 ▶▶▶ Ceriain, replying to Achilles, 1, #827 of 2327 🔗

Thanks, Achilles 🙂

This is a derived figure, it adds those patients who are diagnosed with COVID-19 in hospital to those patients who were admitted to hospital with confirmed COVID-19. It represents a count of patients who, on a given day, have been added to the count of people in hospital with

COVID-19. A worked example – the 74 patients in hospital who received positive test results on 4 July are assumed to have been tested on 3 July and it is at the point of testing that they become a patient in hospital with COVID-19. These 74 patients are then added to the 72 patients admitted to hospital with confirmed COVID-19 on 3 July to create an Estimated Admission figure of 146 for 3 July.

Yes, I did read that. It still suggests to me that they are ‘massaging’ the numbers; or, at least using a very loose definition of ‘admissions. That’s why I asked for other opinions.

186381 ▶▶▶▶ Achilles, replying to Ceriain, 1, #828 of 2327 🔗

I’m sure they are too. Unfortunately they can hide so much in the definitions, the lag, etc. it can give you a headache trying to unpick it!

186401 ▶▶▶▶▶ Ceriain, replying to Achilles, #829 of 2327 🔗

Yup.

Again, thanks for the input. 🙂

186545 ▶▶▶▶ RickH, replying to Ceriain, 2, #830 of 2327 🔗

There is still an underlying problem, in that ‘confirmed Covid-19’ seems still to be relying on the notorious PCR positives, to the exclusion of other diagnosis routes.

186388 ▶▶ stefarm, replying to Ceriain, 3, #831 of 2327 🔗

It’s all bollocks mate (not your analysis v good btw) the wankers are fudging it to fit their contrived narrative.

The cards are stacked against us, the stats are meaningless, crap.

They know it and they know we know it.

The testing is crap, useless, a sham.

They are the best conmen going, that’s why they are in charge. They haven’t got this far by being honest. I wouldn’t buy a 2nd hand car off them.

Arthur Daley wankers.

186398 ▶▶▶ Ceriain, replying to stefarm, #832 of 2327 🔗

not your analysis v good btw

Thanks, appreciate that. 🙂

186411 ▶▶▶▶ stefarm, replying to Ceriain, 1, #833 of 2327 🔗

Credit where credit is due. You will tie yourself up in knots trying to make sense because there is no sense to it, that’s the point.

186415 ▶▶▶ Iansn, replying to stefarm, 4, #834 of 2327 🔗

As I posted yesterday, a local company received 37 test kits for the employees as requested by the MD. All the swabs were immediately placed in the phial without testing anyone and sent back in. All 37 diagnosed as positive. Is that not a fraudulent scandal???

186428 ▶▶▶▶ stefarm, replying to Iansn, 4, #835 of 2327 🔗

Yes, it stinks and it grinds my gears knowing we are being shit on.

186393 ▶▶ Ceriain, replying to Ceriain, 3, #836 of 2327 🔗

I should add that my point about looking into this is that, like everyone else, I’m sick of the lying; feeding the public with fake figures about ‘cases’; Covid deaths which aren’t Covid deaths, etc.

Now that the debate has moved on to hospital numbers and admissions, it has to be pointed out that this number is also fake. There is no way all these people being tested in hospital are being treated for Covid; to call them Covid admissions (regardless of the NHS definition of the word) is disingenouous, at best, and downright lying, at worst.

Remember, this ‘admissions’ figure (among others) is what Handjob and Bojo are using to drive policy right now. It’s also the figure the Beeb, et al. are spouting to the masses.

186434 ▶▶ nowhereman, replying to Ceriain, 1, #837 of 2327 🔗

I would send it to Deborah Cohen as well (deborah@drdeborahcohen.com). I have raised similar points with her previously, but without this level of data, she might take an interest in this data.

186536 ▶▶ RickH, replying to Ceriain, 1, #838 of 2327 🔗

I think you’re onto something there. I haven’t analysed it myself, since I have a healthy suspicion of all figures relating to Covid. But I think that the following CEBM item is relevant. Although couched in restrained evidential terms, the implications are far-reaching in terms of reported numbers from hospitals. :

https://www.cebm.net/covid-19/probable-healthcare-associated-infections-in-england/

There are so many potential layers of inaccuracy in this area that it’s almost impossible to untangle the truth of what is happening.

186620 ▶▶▶ Ceriain, replying to RickH, #839 of 2327 🔗

Thanks, Rick. 🙂

Yeah, I’ve read that; it may be the item I referred to above.

As I said above, Heneghan, et al looked at the Daily spreadsheets; the monthly report I used/referred to in my ‘analysis’ breaks the numbers down and shows the huge difference between actually physically being admitted to hospital, and virtually being admitted, i.e. already in hospital and getting a positive test result.

186881 ▶▶▶▶ Marialta, replying to Ceriain, 1, #840 of 2327 🔗

I worked in a Hospital ‘Rapid’ Discharge team in Brighton until I retired 3 yrs ago which covered A/E dept. Someone in A/E who went home that day or who stayed overnight on short stay Ward or medical assessment unit ( can’t recall exact time limit) was not counted as an Admission. This was crucial and would be good to know what’s going on now with definition of ‘admission’ ??

186801 ▶▶▶ Ceriain, replying to MRG, #842 of 2327 🔗

MRG, you’re a gem; I’ve been looking for that ‘beds scam’ link. I read something about it here on LS, but couldn’t find the link, so ta much, mate. 🙂

187625 ▶▶▶▶ MRG, replying to Ceriain, #843 of 2327 🔗

The last figure in the first article I cited, labelled “NHS England: COVID-19 admission & inpatient case load” , seems consistent with your numbers.

Best of luck.

186275 alw, replying to alw, 5, #844 of 2327 🔗

Re: False Positives and False Outbreaks
From a friend about his mother 101 years old!!!

“This concerns me regarding xxxx’s home
There are only 16 residents there and so far there have been no positive
tests, based on monthly testing, but I’m sure that statistically there could
well be a false positive cropping up sooner or later.

We haven’t been into the home since February so all we’ve been able to do is
wave through the window and have short simultaneous conversations on the
phone, which she can’t hear very well anyway.
I wonder if we’ll ever get the chance to give her a hug ever again”.

186280 ▶▶ John P, replying to alw, 4, #845 of 2327 🔗

I honestly don’t know how they can get away with treating people like this.

186304 ▶▶▶ alw, replying to John P, 6, #846 of 2327 🔗

It astounds me and where are the CQC in all this, their silence is deafening. Another useless quango.

186330 ▶▶▶▶ Awkward Git, replying to Awkward Git, 1, #848 of 2327 🔗

Forgot to say – the guidance is like the “ion close contact” callus for mask wearing by shop staff, a get out clause for Government and all blame can be put onto the individual care homes etc as they should have done a risk assessment for each individual and let the visit go ahead but they did not so the family should have challenged them.

All very sneaky and they always give themselves an out so the blame falls to someone else – companies, care homes, councils etc.

186479 ▶▶▶▶▶ JohnB, replying to Awkward Git, #849 of 2327 🔗

All very sneaky and they always give themselves an out so the blame falls to someone else – companies, care homes, councils etc.

Very sneaky indeed. Hopefully though, I can hear the judge at their trials saying “Inadmissible – off with their heads !”

186326 ▶▶ Bella Donna, replying to alw, 5, #850 of 2327 🔗

Ditto the same with my husbands mother. She’s 97 and I wonder if we’ll ever see her again. It’s inhumane what these b’stards are doing, they are psychopaths!

186396 ▶▶▶ annie, replying to Bella Donna, 3, #851 of 2327 🔗

Amnesty International gathered the evidence. Its report has been ignored.
But it will come up at Wancock’s trial.

186424 ▶▶▶▶ TJN, replying to annie, 2, #852 of 2327 🔗

Yes, I hope so. The bastards need to pay for this.

186276 steve_w, replying to steve_w, 12, #853 of 2327 🔗

everytime Labour gets a new useless leader, the ones from the past look like giants.

remember we missed Ed when Corbyn came in?

The tramp looks like an intellectual titan in comparison to Keir “forensic” Starmer

186284 ▶▶ John P, replying to steve_w, 9, #854 of 2327 🔗

“remember we missed Ed when Corbyn came in?”

Speak for yourself. I preferred Corbyn. To both of them.

Although I did not vote at the last election, I nevertheless would not have been upset had Corbyn won. (The alternative being this appalling clown we now have.)

Corbyn was a poor leader though. He should have guaranteed Brexit and he should have vigorously defended himself against the antisemitism smears.

186520 ▶▶▶ RickH, replying to John P, 1, #855 of 2327 🔗

I mostly agree with your analysis – except – why should he have ‘guaranteed’ Brexit? : he actually offered more real democracy (something we”re sadly now lacking) in a situation where the nation was divided, and Brexit was supported by a minority of the public – as opposed to the decisive 1970s vote.

But hey-ho – it’s a dead issue – now proven irrelevant to the key issues.

186753 ▶▶▶ Mark, replying to John P, #856 of 2327 🔗

I agree with you on preferring Corbyn to either of the Blairites. Not because I particularly agreed with him about anything much, but just because he seemed at least a believer in something, rather than a soulless Blairite.

Whether vigorously defending himself against the comical “antisemitism” smears would have done any good is questionable. They were coming from traitors within the Labour camp, fed by establishment organs, and all such smears are almost impossible to defend against in modern US sphere societies anyway.

Regardless, any and all Labourites facing that kind of dishonest smearing fully deserve what they get, since you do not get to the top in the Labour world of the past few decades without vigorously pushing the “racist”, “sexist” and “homophobe” smears as weapons against dissenters and dissenting opinions.

Hoist on his own petard.

186316 ▶▶ Bella Donna, replying to steve_w, 1, #857 of 2327 🔗

I was thinking the same. I doubt Corbyn would have made such a lash up.

186756 ▶▶▶ Mark, replying to Bella Donna, #858 of 2327 🔗

Pretty clear Corbyn would have been worse, as a true believer coronapanicker, on record as describing herd immunity as “eugenics”.

186279 nocheesegromit, replying to nocheesegromit, 17, #859 of 2327 🔗

I’ve added a chunk of stuff to my website including a rallying call to action on the ‘take action’ page. Please share amongst anyone you know – particularly non-sceptical folk and/or students.

https://covid19thelowdown.wordpress.com/

186286 ▶▶ Two-Six, replying to nocheesegromit, 3, #860 of 2327 🔗

go nocheese!

186318 ▶▶ kf99, replying to nocheesegromit, 2, #861 of 2327 🔗

Very good. Can I suggest the links should not open in a ‘new tab’. It makes it a bit less usable as you navigate. Some graphics to illustrate the statistical points would be really good as well (e.g. very large/very small side by side bars or piecharts).

Oh, and on hospitalisations, mention that Gov stats seem to ignore discharges. I think Carl H has raised this anomoly.

186331 ▶▶▶ nocheesegromit, replying to kf99, 1, #862 of 2327 🔗

Thanks for your suggestions!

186463 ▶▶▶▶ JohnB, replying to nocheesegromit, 1, #863 of 2327 🔗

Prefer ‘new tab’. Especially when I’ve taken ages to get to the right LDS comment ! 🙂

And on the Action tab, maybe links to KBF, SaveourRIghts, off-guardian, etc. ?

186470 ▶▶▶▶▶ nocheesegromit, replying to JohnB, 1, #864 of 2327 🔗

I’ve turned it off for now but you should be able to still access it in a new tab by right-clicking the link.

186347 ▶▶ DRW, replying to nocheesegromit, 1, #865 of 2327 🔗

Nice work.

186355 ▶▶ wendyk, replying to nocheesegromit, 1, #866 of 2327 🔗

Good for you!

186359 ▶▶ Richard O, replying to nocheesegromit, 1, #867 of 2327 🔗

This is excellent work, it really is.

186362 ▶▶ zacaway, replying to nocheesegromit, 1, #868 of 2327 🔗

Good effort! Might be good to add under the deaths section the estimated deaths due to lockdown (e.g. NHS not treating people etc), which I think was reported recently as around 74,000 (from Government’s own analysis). Can’t find the source now, anyone else know?

186363 ▶▶ John Galt, replying to nocheesegromit, 3, #869 of 2327 🔗

This is really great, I’ll forward it onto some people who are having trouble getting through to people they know.

One thing I’d recommend is to separate the bullet points. With all the underlining as well it feels a bit “wall of text”‘ish, if the bullet points were separated I think it would be easier on the eyes.

186435 ▶▶▶ nocheesegromit, replying to John Galt, 1, #870 of 2327 🔗

Thank you, I’ll edit to now.

186297 Mike, replying to Mike, 5, #871 of 2327 🔗

May have been posted, if so apologies..

https://www.geekwire.com/2020/experts-foresee-triumphs-tragedies-worldwide-quest-covid-19-vaccine/

Chock full of self important statements and quotes…one of my favourites;

“We’re going to probably see a lot of deaths,” said Lynda Stuart , deputy director for vaccines and human immunobiology at the Bill & Melinda Gates Foundation. “It’s going to be a great inequity and tragedy that will unfold.”

Also;

“I think that vaccines are going to have to be made free to the individual, to recipients,” Fuller said during a VIP session for Summit attendees. “There’s great motivation for that. You look at the great economic toll that COVID has had. I think that businesses, I think governments, I think they will all be very motivated to try to get this to as many people as possible.”

Just an teeny tiny fib there…I’m pretty certain it is the madness of our respective governments that has done the really damage.

186314 ▶▶ BeBopRockSteady, replying to Mike, 5, #872 of 2327 🔗

I think we will enter a decade at least of severe information warfare. Those that have been central to this have created a huge problem for themselves but they hold tremendous power. We see examples of rcebent attempts to ban alternative media and opinion, no more so than the temporary block on Google of the GBD. That’s just a taster.

They’ve clearly chose a side here, and it reality continues to show that the cure has been many magnitudes worse than the disease, they’ll use that power to cover their tracks, to hide sources, to invert public opinion in whatever way they can. They cannot turn back. Its a systemic reaction to the turning of real world events, I can’t see it being anything but a full frontal attack from here.

186337 ▶▶▶ BeBopRockSteady, replying to BeBopRockSteady, 3, #873 of 2327 🔗

Exhibit A: Add in a German magazine today

186386 ▶▶▶▶ annie, replying to BeBopRockSteady, 2, #874 of 2327 🔗

yukyukyukyukyuk

186441 ▶▶▶▶ Thomas_E, replying to BeBopRockSteady, #875 of 2327 🔗

Ein Volk, ein Reich, ein New World oder!

I’m sure it’s just a coincidence, conspiracy theory and not an all out attack on humanity!

186455 ▶▶▶▶ Miss Owl, replying to BeBopRockSteady, 1, #876 of 2327 🔗

Assume that’s meant to be a V-sign? The photo on my screen makes it seem as though she’s giving the finger to the whole thing?

186697 ▶▶▶▶ Ewan Duffy, replying to BeBopRockSteady, 1, #877 of 2327 🔗

https://www.bbc.com/news/world-europe-54537519

According to the BBC, it is an ad paid for by Visit Berlin. I have just sent Visit Berlin the following email (happy for others to copy and paste – address is hallo@visitBerlin.de )

The BBC (and other English speaking media) are reporting on the above ad.

I am quite happy to add Berlin to the list of locations to boycott permanently when this madness is over.

Perhaps you should remember that Berlin was the centre of a form of madness between 1933 and 1945, for which your nation has been apologising since.

186387 ▶▶▶ Richard O, replying to BeBopRockSteady, 1, #878 of 2327 🔗

A.k.a. World War 3.

186308 John P, replying to John P, 13, #879 of 2327 🔗

“China and Russia were among 15 countries elected to the UN Human Rights Council on October 13, drawing sharp criticism from rights groups and the United States over their abysmal human rights records.”

Hmm, well setting aside the dubious merits of the UN, Putin’s relatively free Russia ought to provide a half decent counterbalance to China’s oppressive authoritarianism.

(Don’t tell MI6 I said that. Russia’s still the “official” enemy.)

We in the West are hardly in a position to be bleating about human rights at present.

186332 ▶▶ HoMojo, replying to John P, 7, #880 of 2327 🔗

Quite, Julian Assange being at the top of a very long list really.

186334 Allen, replying to Allen, 32, #881 of 2327 🔗

First off quit playing in their game- these people have no intention of letting up and know damn well that Covid is a con and they are playing that con to get to their economic desires.

Do not enter their hall of mirrors by endlessly debating whether “cases” are going up, down or sideways. Everyone with half a brain knows the “case” game is rigged and devoid of real meaning.

Secondly how much of a f*ckwit can this Hancocks*cker actually be?

This tool for the modern-day Pharma-Tech robber barons says the following

Herd immunity is a flawed goal without a vaccine, even if we could get to it, which we can’t.

So I guess herd immunity isn’t so flawed with a vaccine. No doubt in Hanprick’s world we will all be golden and herd immunity will be bestowed upon us if only we pay the tithe to the Pharma Vaccine Vampires.

The second central claim is that we can segregate the old and the vulnerable on our way to herd immunity. This is simply not possible.

WTF is this technocratic tyrant talking about? We’re pretty much already there. It’s called care homes/nursing homes. You know those slow motion abattoirs where you sick f*cks profit off the misery of the elderly by segregating and isolating them massive amounts of toxic Pharma pills every day and stuff them into squalid living conditions.

But please tell us how much you care about the elderly and use that as emotional blackmail whilst you try to cover up and run away from the fact that you slaughter tens of thousands of these elderly in March/April and then used this for your hideous purposes.

These lying cynical bastards need to be on trial.

186354 ▶▶ John Galt, replying to Allen, 16, #882 of 2327 🔗

Do not enter their hall of mirrors by endlessly debating whether “cases” are going up, down or sideways. Everyone with half a brain knows the “case” game is rigged and devoid of real meaning.

This is exactly it. This is why I now skip Toby’s daily updates, because he still talks about “cases” like it’s a thing. “Oh, but cases are actually going down”, it’s completely irrelevant! Once you start debating the metric that they’ve thrown down then they’re always going to win. They can always manufacture more cases and then where’s your argument?

I’ve said before – always start the argument with “it’s nothing worse than a mild flu”. Everything you argue with should stem from this. Logically, there’s no way out of it. They’ll use appeals to emotion to argue back but there are plenty of examples from our side to counter this too.

186409 ▶▶▶ JHuntz, replying to John Galt, 4, #883 of 2327 🔗

The best part of it’s only a mild flu is the vitriol that you trigger in return.

186429 ▶▶▶▶ John Galt, replying to JHuntz, 2, #884 of 2327 🔗

Haha, do they get angry? I’m quite lucky in that no one I’m close to thinks it’s anything other than nonsense, so I haven’t really had to argue it with anyone yet.

186659 ▶▶▶▶▶ JHuntz, replying to John Galt, 3, #885 of 2327 🔗

Heavily triggers a coronaphobe. My family agree it’s a nonsense also.

186418 ▶▶▶ Allen, replying to John Galt, 8, #886 of 2327 🔗

Rule #1- don’t let your oppressors set the terms of the debate.

The discussions should be focused on the tactics and methodologies we should be exploring to convict these criminals- not to be in negotiations with them.

186433 ▶▶▶ Julian, replying to John Galt, 3, #887 of 2327 🔗

Yes, but once the general public realises that “cases” are nonsense, the government’s mechanism for controlling the public evaporates.

186451 ▶▶▶▶ John Galt, replying to Julian, 2, #888 of 2327 🔗

Agreed, talking about the nonsense of PCR tests etc is a good follow up, but I’d never start an argument on the basis of cases being low.

186404 ▶▶ Richard O, replying to Allen, 8, #889 of 2327 🔗

If herd immunity is a flawed goal, how did the human race survive until the 20th century?

186664 ▶▶▶ JHuntz, replying to Richard O, #890 of 2327 🔗

pure luck as we didn’t distance or mask up either.

186686 ▶▶▶ Sylvie, replying to Richard O, 1, #891 of 2327 🔗

By viruses, bacteria etc killing off the weak. Only the strong immune systems survived to reproduce into the 20th century.
Hence why Africa and similar countries have lower death counts from CV19. They have many fewer elderly and frail (fat, diabetic, high blood pressure, heart transplant and cancer survivors) available to succumb – some commentators suggest c. 50% of UK, US populations have these sorts of co morbidities.

186360 Sarigan, replying to Sarigan, 3, #892 of 2327 🔗

Time Magazine have a really concerted go at Sweden:

https://time.com/5899432/sweden-coronovirus-disaster/

186371 ▶▶ Sarigan, replying to Sarigan, 2, #893 of 2327 🔗

But perhaps more striking are the findings of a study published Oct. 12 in the Journal of the American Medical Association , which pointed out that, of the countries the researchers investigated, Sweden and the U.S. essentially make up a category of two: they are the only countries with high overall mortality rates that have failed to rapidly reduce those numbers as the pandemic has progressed.

Selective reporting, yes they are the two countries with higher figures but if you look down the table to the ‘low mortality’ countries, they have not reduced theirs by any significant amount if at all:


186462 ▶▶▶ Achilles, replying to Sarigan, 1, #894 of 2327 🔗

Of course missing the obvious point that a comparison of lockdown/not lockdown can not be made between countries by mortality rate. Mortality rate depends on the age & health make up of the country, the quality of it’s healthcare, the severity of previous flu seasons, which hemisphere it’s in, care homes, etc, etc. A whole wealth of factors. The only comparison you can really make is the shape of the mortality curve because, remember, that was what lockdown is supposed to be for. Flattening the curve! Sweden’s curve should look completely different if lockdowns have any major impact.

186760 ▶▶▶ swedenborg, replying to Sarigan, 1, #895 of 2327 🔗

I really can’t understand the comaparision.Swedn as a non lockdown country had a slower slope down with deaths than Spain. But when the second wave started in Spain enormous rise of cases and slower death would obviously decrease death in the second wave.That second wave has just started in Sweden from currently a very low death rate in Swednen.

186394 ▶▶ Julian, replying to Sarigan, 10, #896 of 2327 🔗

Calling what has happened in Sweden a disaster is patently absurd and 100% political

186402 ▶▶▶ DRW, replying to Julian, 4, #897 of 2327 🔗

If they mean the care home disaster, then it’s nothing that the UK and some US states haven’t done on a far worse scale.

186395 ▶▶ Nobody2020, replying to Sarigan, 3, #898 of 2327 🔗

I looked at the weekend football results and based on the data I concluded that teams that conceded the most goals tended to lose more often than teams that didn’t. The objective of every team should therefore be to not concede and it should be possible because some teams showed it was possible.

This is effectively what most of these comparison studies do and are not particularly useful.

Also seems conveniently timed to be more of a political attack than a scientific exercise.

186399 ▶▶ Lucan Grey, replying to Sarigan, 4, #899 of 2327 🔗

Bet they haven’t mentioned Peru or Belgium

186423 ▶▶ swedenborg, replying to Sarigan, #900 of 2327 🔗

This is really a hard hitting publication in the fight against GBD used for the US audience and also evidently pro mask.It has been done in conjunction with Tegnell/Gieseckes enemies in Sweden. They are almost discussing like the pandemic has ended just as the second wave will also affect the countries lauded in the article.

186431 ▶▶▶ BeBopRockSteady, replying to swedenborg, 1, #901 of 2327 🔗

It’s dripping in obvious bias. From one single table showing that mortality rates were high overall in Sweden (but continuing to improve in comparison to others where the crisis continues), they jump straight in. No kissing.

“Countries that locked down early and/or used extensive test and tracing—including Denmark, Finland, Norway, South Korea, Japan, Taiwan, Vietnam and New Zealand—saved lives and limited damage to their economies. Countries that locked down late, came out of lock down too early, did not effectively test and quarantine, or only used a partial lockdown—including Brazil, Mexico, Netherlands, Peru, Spain, Sweden, the U.S. and the U.K.—have almost uniformly done worse in rates of infection and death.”

There you have it. Correlation equals causation. SCIENCE

186501 ▶▶▶▶ RickH, replying to BeBopRockSteady, #902 of 2327 🔗

That puts it in the ‘pure propaganda’ bin.

186751 ▶▶ swedenborg, replying to Sarigan, #903 of 2327 🔗

Further interesting in the article a haste to speak about the second wave.This will affect all Euroean countries and compare Austria and Sweden in the second wave.Same size population.Austria lauded for low mortality lockdown etc now has 5 times more ICU adm than Sweden.Cases also more but cases always difficult to compare because of masstesting etc.Really which counts is deaths and ICU and at the moment the new wave in Central europe seems to be worse than i Sweden.We can only judge after the wave and Sweden will get its share but most interesting to compare with the others.

186366 Fingerache Philip., replying to Fingerache Philip., 7, #904 of 2327 🔗

In the future, will people be advised to have a test if they think that they have the flu,a cold,cough,hiccups,headaches(feel free to add your own minor ailments)?
Where would it end?

186390 ▶▶ Julian, replying to Fingerache Philip., 3, #905 of 2327 🔗

Yes they will and it wouldn’t/won’t. Possibly in a few years time the hysteria would burn itself out

186403 ▶▶▶ Fingerache Philip., replying to Julian, 1, #906 of 2327 🔗

Like the virus will,a lot sooner than that.

186498 ▶▶▶ BJJ, replying to Julian, #907 of 2327 🔗

They are still looking for the shoe bomber at Heathrow.

187117 ▶▶▶▶ SweetBabyCheeses, replying to BJJ, #908 of 2327 🔗

So the next one just put it in his y-fronts instead 😂

186412 ▶▶ Eddy, replying to Fingerache Philip., 4, #909 of 2327 🔗

What future?

186420 ▶▶ DRW, replying to Fingerache Philip., #910 of 2327 🔗

Biochips instantly detecting active viral prescence. Big money has already been poured into this.

187113 ▶▶ SweetBabyCheeses, replying to Fingerache Philip., #911 of 2327 🔗

Maybe? At some GPs surgeries in London you can’t register as a patient without an HIV test. They were incredulous when I refused. What I actually wanted to say was why would I subject myself to an invasive and stressful test for something that I am extremely unlikely to have since I have no symptoms nor any risk factors… but I allowed myself to be bullied into it.

186367 calchas, replying to calchas, 2, #912 of 2327 🔗

https://www.zerohedge.com/medical/public-humiliation-hitachi-develops-fish-bubble-enforce-social-distancing .

If a person violates the 2 meter rule, the fish “escape” the bubble and presumably the person is warned to change their behavior…”

186375 ▶▶ Fingerache Philip., replying to calchas, #913 of 2327 🔗

It will be mandatory to carry a tape measure around with you next.

186392 ▶▶ Fingerache Philip., replying to calchas, 1, #914 of 2327 🔗

Best of luck with that in Sainsbury’s then.

186369 stefarm, 1, #915 of 2327 🔗

Are this lot taking the piss??

https://youtu.be/vzVGsy1e2ao

186376 Peter Thompson, replying to Peter Thompson, 7, #916 of 2327 🔗

Ah the “circuit breaker ” which is only two…or three weeks.. Well the Glasgow circuit breaker has only 9 days to go , shall we see if its successful first ?

The only country in the world I know which has used the description ” circuit breaker ” which probably comes from some 1960 s epidemiology text book is Singapore. This ” temporary measure ” was actually tightened after 2 weeks and is largely still in effect.

https://en.wikipedia.org/wiki/2020_Singapore_circuit_breaker_measures

186384 ▶▶ annie, replying to Peter Thompson, 9, #917 of 2327 🔗

Yeah, and will it be two weeks here?
Like the last one was three weeks?

186391 Achilles, 14, #918 of 2327 🔗

It’s not a circuit-breaker it’s a resistance breaker. A slap-down to quell resistance, challenge apathy and obfuscate the data.

186400 JHuntz, replying to JHuntz, 5, #919 of 2327 🔗

So when does the economy go to sh$t or are we overreacting? Is the end of this month the last furlough payment? Why are we not seeing more of an unemployment impact or are the media just underreporting it?

I honestly don’t see people waking up until the job losses kick in.

186408 ▶▶ Richard O, replying to JHuntz, 2, #920 of 2327 🔗

Unemployment figures have been manipulated to suit the prevailing political agenda for decades. Expect nothing different now.

186417 ▶▶ John Galt, replying to JHuntz, 5, #921 of 2327 🔗

Ministers preparing for four million unemployed because of Covid crisis
 https://www.telegraph.co.uk/news/2020/10/01/ministers-secretly-preparing-4m-unemployed-due-economic-effects/

The end of this month is the end of furlough. I imagine they’ll just print more money and extend it, because like you say, until there are serious job losses this will just meander on.

There’s already lots of second hand evidence of people competing with thousands of other people for one job, or being unable to get basic jobs when previously it would have been easy.

We’ll see how it plays out, but they’ll try and avoid the situation as much as they can.

186825 ▶▶▶ Lisa from Toronto, replying to John Galt, 2, #922 of 2327 🔗

Our program here got extended. I was truly hoping the end of CERB (Canada Emergency Response Benefit) would wake up the sheeple, but it’s just transitioned to EI and has been extended to the end of September 2021. I suspect your government will keep going to the money tree as well.

186558 ▶▶ Awkward Git, replying to JHuntz, #923 of 2327 🔗

Economy been shit for years, the numbers being pumped out are like Fergusion’s modelling – totally fictitious and made up.

186414 Cecil B, replying to Cecil B, 8, #924 of 2327 🔗

Just got back from the beach. Is the pig dictator still ruining the country?

186471 ▶▶ CGL, replying to Cecil B, #925 of 2327 🔗

Yep. God I envy anyone who lives near a beach.

186422 Victoria, replying to Victoria, 16, #926 of 2327 🔗

Masks

“James Grundvig says the masks are the Swiss Army knife of the architects’ tool box;
1. They control people and make them subservient.
2. They allow AI face recognition software to identify people with masks on and off ;
3. They prevent full communication using facial expressions.

Dr. Russell Blaylock warns that not only do face masks fail to protect the healthy from getting sick, but they also create serious health risks to the wearer. The bottom line is that if you are not sick, you should not wear a face mask.

The end goal of masks is to make you fall

in line and to roll up your sleeves in the

>biggest biological experiment in history.

Dr. Russell Blaylock

“As for the scientific support for the use of face mask, a recent careful examination of the literature, in which 17 of the best studies were analyzed, concluded that, “None of the studies established a conclusive relationship between mask/respirator use and protection against influenza infection.” Keep in mind; no studies have been done to demonstrate that either a cloth mask or the N95 mask has any effect on the transmission of the COVID-19 virus. Any recommendations, therefore, have to be based on studies of influenza virus transmission. And, as you have seen, there is no conclusive evidence of their efficiency in controlling flu virus transmission,” concludes Blaylock.

Conclusion

Gary D. Barnett, writing about how the beauty of life is being destroyed by lockdowns and masks says, “All of this ugly absurdity now exists, but the most beautiful thing in life is also being destroyed before our eyes . That is the beauty of love and caring. It was once said that “love is a many splendored thing,” and that may be an understatement, as what more defines the human spirit than love? Today, people are wearing harmful and useless masks; they are told not to get close to any other; they are voluntarily, for the most part locking themselves inside home prisons and are not even allowed to work or be with co-workers. People are becoming unrecognizable zombies, frightened of all strangers, friends, and even family. Romance and passion are shunned and in some parts of the world forbidden due to this virus hoax, so many have acquiesced to this travesty, and now most all communication is via a cold and impersonal computer screen.

The idea of a robotic humanity without feeling now seems possible, and is even being promoted; and in some parts of the world, it is being actively sought. This insanity is no longer science fiction, but is on the verge of reality. No good can come from this horror.””

https://drsircus.com/general/final-words-on-masks/ [the webpage is always very slow to open]

186448 ▶▶ The Filthy Engineer, replying to Victoria, 10, #927 of 2327 🔗

While out on my five mile circular walk this lunchtime i noticed an older couple (maybe late 60s early 70s) cycling towards me. He maskless her masked up and we’re in the middle of rural England! Half an hour later is see them coming towards me again on my return leg of the walk. This time I notice that she has pulled the mask down over her chin and this time I notice, I kid you not, her face was a strange shade of grey, completely ashen almost like a corpse on a bike and I found myself wondering whether lack of oxygen uptake had led to that skin colouration.

186466 ▶▶▶ John Galt, replying to The Filthy Engineer, 2, #928 of 2327 🔗

Yep, she was grey for exactly that reason:

Your blood carries oxygen around your body, and when this is disrupted, you see a discoloration. The disruption may be to the flow of blood itself, which produces paleness or a gray tint to skin tone. When you experience a lack of oxygen, your blood may still be flowing, but it changes color.

186467 ▶▶▶ Ceriain, replying to The Filthy Engineer, 1, #929 of 2327 🔗

late 60s early 70s

I really can’t see how people that age can think wearing these things is a good idea.

186646 ▶▶▶▶ JHuntz, replying to Ceriain, #930 of 2327 🔗

That mob get all their news from the MSM. They’ve been conditioned into being sheep.

186588 ▶▶▶ Victoria, replying to The Filthy Engineer, #931 of 2327 🔗

exercise is contraindicated with masks = hypoxia

186458 ▶▶ Janice21, replying to Victoria, 9, #932 of 2327 🔗

I think this is what depresses me the most, the overall human interaction in society is eroding with mask wearing and making people suspicious that the majority of the population are diseased.

186486 ▶▶▶ Richard O, replying to Janice21, 4, #933 of 2327 🔗

Mask usage (especially outdoors) has been a very useful litmus test to identify the brainwashed/zealots.

186493 ▶▶▶▶ Janice21, replying to Richard O, 1, #934 of 2327 🔗

I heard someone joke that mask wearing outdoors is like having a wank with a condom on! What the hell is wrong with people not allowing oxygen into their lungs!!!!

186553 ▶▶▶▶ Iansn, replying to Richard O, 2, #935 of 2327 🔗

I said to a couple of strangers in the pub who I got into conversation with last night when we discussed masks, they were all for them, protecting others from themselves, but only as long as they were standing up with them on sitting down drinking was completely different. I said that masks are a very visible way for the government to gauge support for their policies, lots of masks support, no masks – oh dear, they disagreed, probably becasue they neever thought of it like that before. Funnily enough the conversation ceased right after that.

186570 ▶▶▶▶▶ Richard O, replying to Iansn, 2, #936 of 2327 🔗

So these tossers have fallen for the “I wear mine to protect you” propaganda. Presumably because they saw it on a government billboard.

Next time ask them how this magical one-way filtration system actually works.

186546 ▶▶ Tenchy, replying to Victoria, #937 of 2327 🔗

AI facial recognition with masks! That would throw up more false positives and negatives than the PCR test.

186427 Crazy Times, replying to Crazy Times, 10, #938 of 2327 🔗

Don’t know if this has already been posted, but the laws they are implementing at the moment are very, very concerning.

https://publications.parliament.uk/pa/bills/cbill/58-01/0188/200188.pdf

Make provision for, and in connection with, the authorisation of criminal conduct in the course of, or otherwise in connection with, the conduct of covert human intelligence sources.

Which will apply to all of the below:

Any police force, The National Crime Agency, The Serious Fraud Office, Any of the intelligence services, Any of Her Majesty’s forces, Revenue and Customs, Her Majesty’s Revenue and Customs, The Department of Health and Social Care, The Home Office, The Ministry of Justice, The Competition and Markets Authority, The Environment Agency, The Financial Conduct Authority, The Food Standards Agency, The Gambling Commission.

186452 ▶▶ Richard O, replying to Crazy Times, #939 of 2327 🔗

This Bill was being debated a few weeks ago, does this mean it has passed into law?

We are going to have at least half a dozen of the above agencies hunting us down.

186497 ▶▶▶ RickH, replying to Richard O, #940 of 2327 🔗

I think that was the first reading -?

186702 ▶▶▶ leggy, replying to Richard O, #941 of 2327 🔗

It’s being heard again tomorrow – this off FB:

URGENT CALL TO ACTION

Covert Human Intelligence Bill

Being heard THURSDAY 15th OCTOBER

This Bill gives unlimited powers to those working undercover.

This means they can commit any crimes including murder, torture and sexual offences.

Further to this these crimes are allowed for the mere reasons of ‘preventing disorder’ and ‘protecting the economic interests of the UK’ and can be commanded by the likes of the Food Standard Agency and the Gambling Authority.

This is not acceptable so we are urging you to write to your individual MP and the Deputy Speaker of the House to express your feelings on this. This can be done directly via our website where we have drafted a couple of templates for you to use to make the process really simple

https://saveourrights.uk/use-your-voice/

Please note that yesterday the second letter was originally going to the Speaker of the House however the lovely Kate on his behalf is trying to tell everyone we got the wrong person and that the Speaker doesn’t have that jurisdiction. Firstly yes he does but the person they are now directing people too is the Deputy Speaker, so essentially he has just delegated the task. It’s a sneaky tactic and obviously we would not expect anything less.

If you sent the Speakers letter yesterday and just got the delightful response you can go use the Deputy Speakers form today.

186837 ▶▶ annie, replying to Crazy Times, 1, #942 of 2327 🔗

Wickedest piece of legislation since Hitler’s Enabling Act.

186432 l835, replying to l835, 5, #943 of 2327 🔗

Cardiff clown at it again. Travel from English Covid hotspots to wales banned… And how is that going to be enforced, assuming anyone takes notice? Rebuild Offas Dyke?!

186453 ▶▶ p02099003, replying to l835, 2, #944 of 2327 🔗

I’m not sure of the legality of such a move. We are 4 nations but 1 sovereign country.

186460 ▶▶▶ l835, replying to p02099003, #945 of 2327 🔗

My thought exactly. Surely we are UK citizens? English rules are I believe guidance, but Welsh are law. I suspect unchallenged as no one wants to “kill granny”

186675 ▶▶▶▶ p02099003, replying to l835, #946 of 2327 🔗

Our passports are issued as The United Kingdom of Great Britain and Northern Ireland, so the three mainland nations are not even identified separately.

186537 ▶▶ Tenchy, replying to l835, 1, #947 of 2327 🔗

Mr fucking plod on the Welsh side of the border will be checking number plates using ANPR to see where the vehicle’s registered.

187022 ▶▶▶ JohnB, replying to Tenchy, #948 of 2327 🔗

Work. Assissting vulnerable person. Visiting grave of loved one.

C’mon Tenchy, use that imagination.

186437 James007, replying to James007, 15, #949 of 2327 🔗

The professors, whose findings will be released on Wednesday, claim between 3,000 and 107,000 deaths could be stopped by January if Boris Johnson imposes the measure.

What a bizarre claim.

186438 ▶▶ FlynnQuill, replying to James007, 10, #950 of 2327 🔗

I smell bull shit again. Is that like the fifty thousand cases we were going to have by today!!

186440 ▶▶ Chicot, replying to James007, 6, #951 of 2327 🔗

What sort of a stupid prediction is that?! Pick a number, any number…

186447 ▶▶▶ Sarigan, replying to Ceriain, 15, #953 of 2327 🔗

Just imagining if I said to a client ‘Your holiday to Mauritius will cost between £3,000 to £107,000’. Strictly speaking could be true but I would not last long in business.

186459 ▶▶▶▶ leggy, replying to Sarigan, 4, #954 of 2327 🔗

I think I said similar yesterday. If I told my boss I’d generate between £3k and £107k revenue this year, I’d be out of the door.

186443 ▶▶ bucky99, replying to James007, 8, #955 of 2327 🔗

There’s a great quote from one of the people who predicted those numbers, when asked what would happen after Jan… they just say that things will simply go back to where they were. No lives ‘saved’, only deaths postponed.

186454 ▶▶ Janice21, replying to James007, 2, #956 of 2327 🔗

Whats even more bizarre is that people will believe this.

186478 ▶▶▶ FlynnQuill, replying to Janice21, 1, #957 of 2327 🔗

Yip, make up a massive range of potential deaths and hey presto, they’ll be correct somewhere within the range. Christ how can people not see through this shite?

186489 ▶▶▶▶ Janice21, replying to FlynnQuill, #958 of 2327 🔗

Its truly mind boggling that people believe it. Although I do believe there is a shift here with more and more lockdown sceptics. Many people have had enough but feel powerless.

186524 ▶▶▶▶▶ FlynnQuill, replying to Janice21, #959 of 2327 🔗

That may be true. However, I feel we are a gutless nation and even if everybody came around to think like us, what would they do? I know what I’d like to do!

186496 ▶▶▶ RickH, replying to Janice21, 1, #960 of 2327 🔗

Of course. And it’s win-win. If this ripple is the usual seasonal rise in infection (and this is so far the indication), then it will be because of the measures taken. If it rises above the current insignificant level (but well within normal bounds), then it will be proof of the need foe extended/harsher measures.

186457 ▶▶ Richard O, replying to James007, 2, #961 of 2327 🔗

Absolute garbage, straight out of the 500K Ferguson playbook.

Repeating exactly the same propaganda as before shows these idiots are a one-trick pony. They have no imagination or creativity.

186461 ▶▶ Nobody2020, replying to James007, 2, #962 of 2327 🔗

If they extend the timescale out they can keep saving lives indefinitely.

186469 ▶▶ Achilles, replying to James007, 5, #963 of 2327 🔗

Between 3,000 and 107,000. Well why not just say between 0 and 110,000? Just a euphemism for haven’t got the slightest clue. And these are “professors”. Pathetic.

186487 ▶▶ RickH, replying to James007, #964 of 2327 🔗

More Fergie modelling – aka ‘fiction’.

186521 ▶▶ steve_w, replying to James007, 2, #965 of 2327 🔗

if we lockdown, people die of old age rather than covid. they still die. I don’t see the point

186561 ▶▶ Iansn, replying to James007, 1, #966 of 2327 🔗

no margin for error there is there then 🙁

186621 ▶▶ matt, replying to James007, 1, #967 of 2327 🔗

3,000 additional deaths is _2 days’_ worth of additional deaths. It’s not worth mentioning.

186446 Fingerache Philip., replying to Fingerache Philip., 9, #968 of 2327 🔗

The only crumb of comfort in this madness is that if you think it’s bad in England, the Welsh,Scots and the Northern Irish are worse off than we are.

186449 ▶▶ Janice21, replying to Fingerache Philip., 1, #969 of 2327 🔗

Yes there is a very sorrowful ambience here in N I today

186450 ▶▶ Crazy Times, replying to Fingerache Philip., 4, #970 of 2327 🔗

Don’t worry, we won’t be far behind. I give it till Monday afternoon at the very latest.

186632 ▶▶ Mark, replying to Fingerache Philip., 3, #971 of 2327 🔗

The problem is, we get to subsidise their governments’ nonsense.

186456 Sarigan, replying to Sarigan, 4, #972 of 2327 🔗
186511 ▶▶ Eddy, replying to Sarigan, 1, #973 of 2327 🔗

Saves Rothchild paying himself. Cuts out the middle man.

186464 John P, replying to John P, 3, #974 of 2327 🔗

Baldrick has a cunning plan:

“Kier Starmer. Well timed, well delivered, and absolutely right. My guess is a significant majority of voters, regardless of party loyalty, will back him on a 2-3 week circuit breaker.”

What would his boss, Blackadder have said?

“Baldrick, your head is as empty as a eunuch’s underpants. Am I jumping the gun, or are the words ‘I have a cunning plan’ marching with ill-deserved confidence in the direction of this conversation?”

186508 ▶▶ Eddy, replying to John P, 1, #975 of 2327 🔗

He and Boris will work together. Good cop bad cop. It’s all a show for the sheeple.

186535 ▶▶▶ CGL, replying to Eddy, 1, #976 of 2327 🔗

This is worse is bad cop and badder cop

186548 ▶▶▶ Awkward Git, replying to Eddy, 3, #977 of 2327 🔗

More like tweedledumb and tweedledumber.

186465 Ewan Duffy, replying to Ewan Duffy, 3, #978 of 2327 🔗

https://www.bbc.com/news/uk-england-birmingham-54539328

Headline: Used coronavirus tests handed out by mistake in Birmingham

186581 ▶▶ Victoria, replying to Ewan Duffy, 1, #979 of 2327 🔗

Yuck and then stick that contaminated ear bud deep into someone else nose.

186468 Janice21, replying to Janice21, 5, #980 of 2327 🔗

Can anyone tell me if there has been any hard evidence or anyone speaking out about falsified Covid death certificates? I have heard stories of this happening but nothing since.

186472 ▶▶ John P, replying to Janice21, #981 of 2327 🔗

I would think it’s very hard to prove.

186476 ▶▶▶ Janice21, replying to John P, 3, #982 of 2327 🔗

I have seen a few people on social media complaining about it with some family members but doesn’t seem to reach the MSM. Any wonder!

186484 ▶▶▶ RickH, replying to John P, 2, #983 of 2327 🔗

Yes – ironclad ‘proof’ is quite difficult, given the degree of ‘professional judgment’ involved and the lack of counter-evidence in the form of post-mortem examination.

186515 ▶▶ Darryl, replying to Janice21, 4, #984 of 2327 🔗

I know of someones terminally ill partner who had Covid put on the death certificate. Like most people in that position they know it is wrong and the partner would have been upset by this – but unfortunately they don’t want the stress of fighting the NHS bureaucracy machine.

186525 ▶▶ Leemc23, replying to Janice21, 2, #985 of 2327 🔗

I do know that in the US for example, due to the structure of health care there is a financial incentive to have Covid on a death certificate above over causes. I think the Medicare pays out $2000 more for Covid than flu.

In the U.K. it was / is a connivence measure only. With a Covid death one person can sign off without ever having to have a GP attend / autopsy or second opinion etc. It’s the stuff of Dr Shipman’s wet dream.

186623 ▶▶ Smelly Melly, replying to Janice21, 1, #986 of 2327 🔗

Under Islamic law a dead person has to be buried within 24 hours of death. Relatives are given the option of having Covid on the death certificate and no autopsy or wait until the results of the autopsy in 2 weeks time. Guess which one they opt for.

186474 Darryl, replying to Darryl, 10, #988 of 2327 🔗

The UK government is completely abusing it’s power, on top of what they are doing already we now have this very sinister Bill being rushed through, definitely Covid 1984 stuff, details from Big Brother Watch –

Whilst the country is distracted fighting a pandemic, the Government is rushing yet another authoritarian Bill through Parliament – the Covert Human Intelligence Sources (Criminal Conduct) Bill.

The “SpyCops” Bill would allow state spies to commit crimes in the UK and overseas with impunity — without even exempting crimes like murder, torture and sexual offences.

These extreme powers to immunise state crimes from prosecution would be handed to a broad range of agencies — from police and MI5, to the Department of Health and even the Food Standards Agency.

This is being rushed through Parliament at breakneck speed with insufficient scrutiny. Tomorrow evening, on Thursday 15th October, the Bill will complete its passage through the House of Commons.

Just this week, environmental campaigner Kate Wilson was in court fighting for justice. She was manipulated into a romantic relationship for two years by Mark “Stone” — who she later found out was Mark Kennedy, an undercover police spy.
But this Bill would prevent victims of state spies from seeking redress, by protecting those who commit authorised crimes from civil liability forever.

Police spies have abused innocent campaigners in the UK for decades — from environmental activists to trade unions and race equality campaigners. Undercover police even infiltrated the grieving family of the murdered black teenager, Stephen Lawrence, during their quest for justice.

Undercover state agents have been involved in conflict too. Former Prime Minister David Cameron found they were responsible for “shocking levels of state collusion” in the murder of lawyer Pat Finucane in Northern Ireland.

Currently, prosecutors decide whether it’s in the public interest to trial undercover police crimes. But the SpyCops Bill would bypass prosecutors entirely, allowing state agencies the unprecedented power to declare serious breaches of UK law ‘lawful’, as long as agents had an internal authorisation.

186483 ▶▶ John P, replying to Darryl, 8, #989 of 2327 🔗

I contacted my (prominent Labour) MP about this a couple of weeks ago. He replied yesterday:

Dear John

Thank you for contacting me recently about the Covert Human Intelligence Sources (Criminal Conduct) Bill.

On Monday, 5 October 2020, the House of Commons considered the Criminal Conduct Bill for the first time.

This Bill will allow covert human intelligence sources (CHIS) who are embedded within terrorist organisations or organised criminal gangs to carry out specific, authorised criminality, with immunity from prosecution. This would put a system that is already being operated, currently on the basis of an implied power under the Security Service Act 1989, on a statutory footing.

As the Bill progresses, I will be looking to improve its vital safeguards so that the public can have confidence in the process.

Thank you once again for bringing this important issue to my attention. If you would like me to raise any specific issues with the Government on your behalf, please do not hesitate to contact my Office.

186499 ▶▶▶ Darryl, replying to John P, 9, #990 of 2327 🔗

Good work. It is guaranteed to be misused, they are widening the definition of terrorist organisation to include a much wider group of people – basically any one deemed an enemy of the establishment! Some lockdown sceptics have already had their houses raided at dawn – to search for ‘anti vaccine’ material – which is basically just an excuse to intimidate dissenters. We now have a Police state operating for the interests of Global businesses against normal citizens.

186586 ▶▶▶▶ John P, replying to Darryl, 3, #991 of 2327 🔗

I said the same and asked him to oppose it.

186485 ▶▶ Crazy Times, replying to Darryl, 1, #992 of 2327 🔗

I posted about this below. It truly horrifying stuff. One of the absolute basic foundations of society and democracy is that nobody is ever above the rule of law. This is going to totally rewrite that and say that potentially even restaurant inspectors are free from committing criminal acts. It’s absolute total madness.

186502 ▶▶▶ Eddy, replying to Crazy Times, 2, #993 of 2327 🔗

Where were the “opposition” parties on this?

186503 ▶▶▶ Darryl, replying to Crazy Times, 1, #994 of 2327 🔗

Sorry, I didn’t see your early post. It is frightening that something of this importance is being passed without any scrutiny in parliament or the media. Police state stuff.

186514 ▶▶▶▶ Crazy Times, replying to Darryl, #995 of 2327 🔗

No problem. I’m sure I wasn’t the first to post it either. The more attention this gets the better.

186584 ▶▶▶ Richard O, replying to Crazy Times, 4, #996 of 2327 🔗

The rule of law ended in this country on 23rd March. The state, and especially the executive branch, is now out of control with no checks and balances whatsoever.

We are now in the fight of our lives to try and restore it.

186839 ▶▶▶▶ Jonathan Palmer, replying to Richard O, #997 of 2327 🔗

That was the start of the coup.Its just the majority of the population doesn’t realise it

186596 ▶▶▶ JohnB, replying to Crazy Times, #998 of 2327 🔗

They’ll find headless restaurant inspectors behind hedges …

186552 ▶▶ Ceriain, replying to Darryl, 2, #999 of 2327 🔗

UK Column News did a full report on this. Worth checking out on YouTube.

186563 ▶▶ Londo Mollari, replying to Darryl, 2, #1000 of 2327 🔗

Funnily enough, RT has been reporting on this. Strange that we have to rely on that dictatorial and repressive country to find out what’s going on here in Blighty.

186568 ▶▶ zacaway, replying to Darryl, 4, #1001 of 2327 🔗

Zarah Sultana made a great speech about that while all the other MPs were sleeping

This Bill marks the latest step in a frightening descent into authoritarianism by this Government. In the past two weeks, they have proposed the effective decriminalisation of torture by British soldiers overseas, the shipping of asylum seekers more than 4,000 miles away to be imprisoned on Ascension Island, the ban on anti-capitalist teaching materials in schools and now this—licensing undercover agents to commit torture, sexual violence and murder. This descent into authoritarianism should be a concern to us all. It must be resisted.

https://hansard.parliament.uk/Commons/2020-10-05/debates/DF29B1ED-6BB3-414A-A65E-53CD4BAB694A/CovertHumanIntelligenceSources(CriminalConduct)Bill#contribution-05693CE1-CEC2-4245-AA8D-77052FBBB9B0

186591 ▶▶▶ JohnB, replying to zacaway, 2, #1002 of 2327 🔗

Be nice if she raised her voice, or voted, against the covid lockdown bollocks.

186624 ▶▶▶ Mark, replying to zacaway, 1, #1003 of 2327 🔗

Shame these people who claim to oppose authoritarianism are so often determined to conflate properly enforcing immigration laws with those issues. Sometimes stupidity on their part, but more often I think because they are ideologically opposed to border controls.

Most “asylum seekers” are economic migrants. Basically, if they aren’t relieved to get to a safe British camp on Ascension Island while their case is heard then they aren’t really asylum seekers.

Given that selective choice of targets and the fact that this particular Labour MP this morning tweeted that New Zealand are the example we should be following, it’s pretty clear she’s another lying hypocrite on authoritarianism, who loves it when her side are doing it but pretends to oppose it when she thinks it’s politically useful to do so.

186477 nocheesegromit, replying to nocheesegromit, 10, #1004 of 2327 🔗

Is anyone on here behind the Young People Against Lockdown account on Twitter? Good stuff if so!

186500 ▶▶ Catherine Young, replying to nocheesegromit, 3, #1005 of 2327 🔗

I wasn’t aware of that but what a relief! Young folks fighting back, hallelujah! Thanks.

186583 ▶▶ Victoria, replying to nocheesegromit, 1, #1006 of 2327 🔗

No, but please paste the link

186605 ▶▶▶ nocheesegromit, replying to Victoria, 1, #1007 of 2327 🔗

https://twitter.com/YoungPALD they are looking for volunteers – I might set up a Twitter account and get involved.

186712 ▶▶▶▶ Basics, replying to nocheesegromit, 1, #1008 of 2327 🔗

Advice you already know. Twitter is toxic it lures the unwary in. Genuinely treat with caution.

186543 ▶▶ Julian, replying to MutzNutz, #1010 of 2327 🔗

As an attempted takedown of the GBD, this is pants

It raises straw men that are unconnected (climate change denial etc.) and complains not everyone that signed it is real

The only real argument of substance is that herd immunity without a vaccine is impossible because of reinfection – for which there is almost no evidence

TLDR

186676 ▶▶▶ Barney McGrew, replying to Julian, -1, #1011 of 2327 🔗

The only real argument of substance is that herd immunity without a vaccine is impossible because of reinfection – for which there is almost no evidence

I am happy that it is possible to have, or acquire, a ‘resistance’ to the virus that is not the same as full immunity. And that this level of resistance is enough to create a practical, workable ‘community immunity’ where the virus more-or-less disappears. For sure, if a heavily-infected person sneezed in your face, you might become ill. But that wouldn’t invalidate the general suppression of the virus on average.

This is the grown-up, adult view of immunity and infection. It accepts that full immunity is probably not even possible (like the flu), but that it’ll be OK, anyway – just as we have lived with flu and other infectious diseases around us all our lives. It’s a trade-off between absolutely safety and a worthwhile existence.

For the life of me, I can’t understand why supposedly intelligent people don’t get it.

186513 ▶▶ Sarigan, replying to Sarigan, 22, #1013 of 2327 🔗

This one:

186506 TJN, replying to TJN, 7, #1014 of 2327 🔗

Whoever posted the link to the Model Health Show video, ‘Mask Facts’ a day or two ago, thanks. Just finished watching it. One of the best programmes I’ve seen during all this. Most informative, and a beacon of common sense as we pass through a very dark night.

https://themodelhealthshow.com/maskfacts/

186516 ▶▶ Janice21, replying to TJN, 3, #1015 of 2327 🔗

Thanks, will check it out now.
I get some abuse when I put any anti-mask stuff on FB but will keep putting up links like this.

186518 ▶▶▶ CGL, replying to Janice21, 12, #1016 of 2327 🔗

Staggers me that people want to live on the set of the handmaids tale.

186532 ▶▶▶▶ Janice21, replying to CGL, 28, #1017 of 2327 🔗

Same here! I am an introvert with 2 very young children so its not like I socialised or went shopping, eating out etc much anyway and my job is funded until Dec 20201(unlikely after that), my husband pointed out that this whole Corona saga doesn’t really affect us that much directly BUT to me it does in many other ways. I have a horrible feeling about where this is all going and what my children are growing up in. Thankfully at 18 months and 2.5 years old they dont know any different. I want to oppose all of this for their future and everyone elses. I feel so bad for all those losing their jobs and mental health, cancer patients etc being impacted. I think us lockdown sceptics are the ones who truly have a heart and soul (instead of being branded Granny killers).

186540 ▶▶▶▶▶ CGL, replying to Janice21, 25, #1018 of 2327 🔗

Yes – i completely agree – my hatred of the masks in particular is visceral. I cannot explain how it feels to someone who doesn’t feel the same. The sadness is bottomless.

186547 ▶▶▶▶▶▶ Janice21, replying to CGL, 10, #1019 of 2327 🔗

Huge hatred of masks here too.

186559 ▶▶▶▶▶▶▶ TJN, replying to Janice21, 11, #1020 of 2327 🔗

I bet I hate muzzles more than you both put together … I defy anyone to hate muzzles more than I do …

186562 ▶▶▶▶▶▶▶▶ CGL, replying to TJN, 2, #1021 of 2327 🔗

Well you did start this thread – so ok you win! 🙂

186573 ▶▶▶▶▶▶▶▶▶ TJN, replying to CGL, 15, #1022 of 2327 🔗

They absolutely disgust me, make me feel sick. Revolt me, make me feel ill and hate the human race for being so stupid as to wear them.

Back when they first came in on the buses, I was driving past one containing a few muzzle-wearers with my 4-year-old in the car and muttered instinctively under my breath … and she said, ‘Daddy, why did you say “dirty and disgusting”‘.

186622 ▶▶▶▶▶▶▶▶▶▶ CGL, replying to TJN, 6, #1023 of 2327 🔗

My goodness you really do! Yes – my sentiments exactly. I have a bout of tourets when I see people wearing them alone in their cars or walking down the street (my kids are much older and used to their potty mouthed mother now). Those propaganda radio ads have the same effect actually. My language is definitely more colourful these days.

186640 ▶▶▶▶▶▶▶▶▶▶ Achilles, replying to TJN, 9, #1024 of 2327 🔗

Me too. If an advert comes on with someone wearing a mask I turn over. In fact I turn over if I see social distancing. It is an outrage to my soul and will never, ever be normalised.

186665 ▶▶▶▶▶▶▶▶▶▶▶ kenadams, replying to Achilles, 6, #1025 of 2327 🔗

I hate the beer one which shows people in a pub enjoying themselves, and then in text next to it apologises for showing these disturbing images, making it clear that this was shot ‘pre-covid’ and that people must ‘socialise responsibly’. It actually makes my stomach turn.

186667 ▶▶▶▶▶▶▶▶▶▶▶ TJN, replying to Achilles, 7, #1026 of 2327 🔗

I can’t stand even to look at someone in a muzzle. And if I see a picture or video with muzzle wearers I have to skip past it or turn my head away.

But all of that pales when I see images of children wearing the accursed vile things …

187029 ▶▶▶▶▶▶▶▶▶▶▶▶ Cheshirecatslave, replying to TJN, 3, #1027 of 2327 🔗

They make 4 year olds wear them in the USA to pre school. I see that as child abuse.

186674 ▶▶▶▶▶▶▶▶▶▶▶ TJN, replying to Achilles, 6, #1028 of 2327 🔗

an outrage to my soul

Yes, that touches on it. Every sense, conscious and unconscious, screams at me that it’s just wrong, evil even.

186609 ▶▶▶▶▶▶▶▶ Kev, replying to TJN, 4, #1029 of 2327 🔗

Well I do, more than mere words can describe.

I’m just surprised we haven’t seen a massive crime wave, are criminals just as wet as the general populace?

Can you describe the attacker/robber sir? No he was wearing a mask.

I suppose balaclava will be perfectly acceptable as a face covering, stockings?

186649 ▶▶▶▶▶▶▶▶ watashi, replying to TJN, 6, #1030 of 2327 🔗

I think perhaps I do? or maybe my 6 year old does? she had a dream last night of the masked ones against the good ones (no masks). the good ‘winned’. let’s hope her dream comes true.

186976 ▶▶▶▶▶▶▶▶ Two-Six, replying to TJN, 2, #1031 of 2327 🔗

Me. I get a very physical reaction to seeing people in them. Angry, upset, hyper ventilating, shaking with rage and adrenalin.

I nearly got attacked by a big bloke in one at the start of this in March.

I went out to another town on the first day we were allowed to drive again after lockdown. I got talking to the cashier guy, he was a sceptic, it really gave me a boost and I thought that all I had to do was talk to people about this madness, spread the word that its all bollocks and it would be over soon.

As I left the shop another guy was walking in and I said “hey mate what’s with the facemask?” He immediately went ballistic,
“How dare you! I have been wearing this for the last 3 months, my son has cistic fibrosis. How dare you!” etc, He stank of Skunk, I stepped back away from him out of swinging range apologising, getting ready for incoming punches. I managed to get away from him but I felt like such a Charlie.

However being up close to his angry crazy masked face was very upsetting for me. Very traumatic.

Perhaps this is why I have such a problem with them.

186554 ▶▶▶▶▶ TJN, replying to Janice21, 11, #1032 of 2327 🔗

My two are 4 and 2, and we pretty well keep it from them – although with places shut, closed playgroups and everyone wearing muzzles it’s difficult at times.

Like you, I find it horrible to think where this is going. Even if it doesn’t go anywhere I will never view my fellow countrymen in the same light again.

And likewise, the corona garbage hasn’t directly affected our family that much. Doesn’t mean I’m not fuming with anger about it though.

186569 ▶▶▶▶ Fingerache Philip., replying to CGL, 3, #1033 of 2327 🔗

BRILLIANT COMPARISON.

186517 nickbowes, replying to nickbowes, 4, #1034 of 2327 🔗

See the tory shysters are backtracking on decriminalizing the non payment of the the bbc licence fee.

186526 ▶▶ Steve Hayes, replying to nickbowes, 2, #1035 of 2327 🔗

They should be abolishing the television tax.

186530 ▶▶ Tenchy, replying to nickbowes, 2, #1036 of 2327 🔗

Doesn’t surprise me. Who knows what goes on behind the scenes.

186557 ▶▶ zacaway, replying to nickbowes, 4, #1037 of 2327 🔗

Reward for being an excellent propaganda outlet for the gov’t

186582 ▶▶▶ Mark, replying to zacaway, 1, #1038 of 2327 🔗

Probably, but the “Conservative” hierarchy are being dishonest and shortsighted as usual. Of course the BC institutionally hates both conservatives and the “Conservative” Party, and that will never change in our lifetimes, because you’d have to replace the managerial, editorial and journalistic staff wholesale to achieve that.

They might have operated a truce while the government is pushing the authoritarian collectivist agenda they like, but it won’t last two minutes after that situation finishes.

186807 ▶▶ Jonathan Palmer, replying to nickbowes, #1039 of 2327 🔗

Why would they when the BBC have been magnificent for them.

186519 Lucan Grey, replying to Lucan Grey, 8, #1040 of 2327 🔗

So why isn’t there a second wave of death in Sweden then?

Notice how Sweden is rapidly dropping down the list of “deaths per 1M”.

186534 ▶▶ steve_w, replying to Lucan Grey, 6, #1041 of 2327 🔗

they may only count people who died of covid for definite. we count false positive covid test results of people who die of anything

186522 Margaret, replying to Margaret, 37, #1042 of 2327 🔗

I’m afraid that I have frightened to death a shopworker today.

We got talking about masks and I cited the German study which had found 82 bacterial infections and 4 types of mold on a mask which had been worn all day by a child. I also told her what had been said about the uselessness of masks by the CMO and the deputy CMOs. The poor woman was horrified, especially as another customer in the shop was nodding vigorously in agreement with me.

186556 ▶▶ chaos, replying to Margaret, 11, #1043 of 2327 🔗

I told my 6 year old niece that in 4 billion years the sun will die and destroy the earth and everyone and everything on it. She has had trouble sleeping since and I’m not allowed around there for a while.

186874 ▶▶▶ John K, replying to chaos, 1, #1044 of 2327 🔗

Bill Gates and his (very manly looking) wife, Wanksock, Whitless and Unblanced will beat the sun by 3.999999999999 billion years.

186957 ▶▶▶ Two-Six, replying to chaos, 1, #1045 of 2327 🔗

You should of said that the earth will be underwater in seven years time and all the polar bears will die of starvation as they float of on little melting ice bergs and starve to death. That’s what they tell them at school.

186627 ▶▶ Richard O, replying to Margaret, 4, #1046 of 2327 🔗

Excellent work. This is an unexpectedly positive reaction. Nothing to be afraid of at all.

186523 Steve Hayes, replying to Steve Hayes, 7, #1047 of 2327 🔗

In this new normal where we are all required to sacrifice for the public good, why haven’t we nationalised Big Pharma?

186619 ▶▶ Richard O, replying to Steve Hayes, 2, #1048 of 2327 🔗

The new normal means annihilating all public life in order to save it.

186527 Cheezilla, 7, #1049 of 2327 🔗

Have you signed this yet?

“Nullify non-disclosure agreements/gagging orders for NHS staff for covid-19”, on the basis that we’re not being told the truth about what’s really happening in NHS hospitals. It needs 10,000 signatures to prompt a government response, and 100,000 signatures means that there will be a parliamentary debate.

https://petition.parliament.uk/petitions/550598

186528 steve_w, replying to steve_w, 9, #1050 of 2327 🔗

There are 5,000 people in hospital who have tested +ve for covid

How many people are normally in hospital for anything? Is there an available stat on that?

Considering they are testing everyone in hospital isn’t it just false positives from people with broken legs etc?

186566 ▶▶ Mark, replying to steve_w, 5, #1051 of 2327 🔗

Typical bed occupancy for NHS England I think is about 110,000.

During peak covid in April, the NAO reported :

“Between 17 March and 12 April, the number of available beds increased from 12,600 to 53,700, while the proportion of these beds occupied by a COVID-19 patient peaked at 29%. The proportion of critical care beds occupied by COVID-19 patients in England was highest between 5 April and 14 April, at 50% or just over”

186602 ▶▶▶ Sam Vimes, replying to Mark, 3, #1052 of 2327 🔗

Is that what they call ‘overrun’, then?

186720 ▶▶▶▶ jb12, replying to Sam Vimes, #1053 of 2327 🔗

I recently heard it described as ‘catastrophic’.

186770 ▶▶▶▶ Mark, replying to Sam Vimes, #1054 of 2327 🔗

BobT posted a graph of the numbers here yesterday, basically occupancy normally stayed at around 110,000, then plunged in March to around 50,000 as the NHS cleared the decks.

Around 60,000 patients were turfed out or excluded to make space for these less than 20,000 covid patients, which is why while some parts of the NHS were undoubtedly busy, large parts were twiddling their thumbs and making tik-tok videos. Many of those sent home, as we know here, went to care homes carrying covid, contributing to the scandal of mass deaths caused there by the panic response, recently raised by Amnesty International.

186738 ▶▶ leggy, replying to steve_w, #1055 of 2327 🔗

They’ll never tell us that.

186529 Clothcap, replying to Clothcap, 1, #1056 of 2327 🔗

With a very high degree of probability there is no virus.
LS’ coverage of 5G EMF radiation poison is inadequate and often negative.

A) Most fatalities of the elderly in Italy had been vaccinated. What is the % in Britain and America?
B) Lockdowns in America have been blamed for a sharp reduction in infant mortality and autism, credited to a reduction in vaccinations.
C) The body’s response to 5G EMF radiation poisoning produces symptoms that are credited to a virus.
D) COVID hotspots are 5G roll-out zones.
http://radiationdangers.com
E) Radiation in the frequencies used by 5G is killing Amazon trees and insects due to the US’ extensive radar coverage to stymy smuggling.
To kill a bee hive, put a cell phone in it for 30 minutes twice a week. 2 weeks, gone.
F) Jon Rapport has done extensive research and uncovered much evidence to support his contention harmful viruses are a myth. The measles virus was proven a false hypothesis in German court.
http://nomorefakenews.com
G) Images claimed to be a virus are of an exosome. Exosomes have functions in protecting the body and repairing damage. Vaccines that interefere in the process weaken the individual to other insults to the body.
H) Vaccines are not tested enough to merit certification. R. Steele reported:
Rebecca Campbell: US Government Loses Vaccine Lawsuit — Has Lied to the Public for Decades — Vaccines NOT Tested — Autism Will Drop If Parents Use This Case to Legally Challenge Mandated Vaccinations
https://phibetaiota.net/2018/09/rebecca-campbell-us-government-loses-vaccine-lawsuit-has-lied-to-the-public-for-decades-vaccines-not-tested-autism-will-drop-if-parents-use-this-case-to-legally-challenge-mandated-vaccinatio/

WHO has done a U turn on lockdowns, Perhaps some Liverpool lads had a word with them, or perhaps the mountain of pending litigation that I believe includes manslaughter charges persuaded them. How long before masks are admitted to be dangerous especially in combination with 5G causing O2 starvation by changing the molecules and damaging haemoglobin as well as depleting O2 in the air.

What’s it all about?
Pope Francis says New World Order needs to happen now with United Nations in charge
https://clothcap.livejournal.com/302964.html

FKTV: “Globalist Takeover from Within”
https://forbiddenknowledgetv.net/usa-takeover-from-within/

Enough for now.

186638 ▶▶ watashi, replying to Clothcap, 1, #1057 of 2327 🔗

hello Clothca,. Thank you for all the links

186533 chaos, replying to chaos, 17, #1058 of 2327 🔗

Observations from Berks shire.

Fewer people in masks in shop number 1. I never wear a mask. Because I am not a bed wetter. Fewer people outside school number 1 in masks. School number 2 alas most people were masked. And shop number 2 most people were masked. Some masked bint at the checkout squirted some anti-bacterial gel into her HANDS before using the card machine. We need some germs for immunity don’t we she nattered. Actually we have about 2 kg of bacteria in us and on us I said. Most of our serotonin is made by bacteria in our guts. We are in a symbiotic relationship with the hundreds of different types of bacteria that share our body and we wouldn’t be human without them. Whoosh. Over her head. We need to carry on fighting the virus she said. Average age of death in the UK is about 82. Average age of death with or of covid in the UK is 82 said I. Whoosh. Over her head. I’ve been on furlough for 30 weeks she said. I’ve just gone back to work. Whoosh.

I think we are fucked.

186541 ▶▶ Janice21, replying to chaos, 21, #1059 of 2327 🔗

I am aghast that this nation is full of so many ignorant, insufferable dimwits.

186551 ▶▶▶ chaos, replying to Janice21, 18, #1060 of 2327 🔗

Me too. I had never realised before covid just how dumb morst people are. If I had I would have had far more confidence in myself.

186592 ▶▶▶▶ Albie, replying to chaos, 9, #1061 of 2327 🔗

I used to find job interviews daunting. I wish I had known then what I know now about how cowardly and uncritical thinking most people, regardless of their employment status, are. A nation full of hysterical drama queens completely hypnotised by the BBC and the rest.

186599 ▶▶▶▶▶ Fingerache Philip., replying to Albie, 10, #1062 of 2327 🔗

Started with Diana’s death and the stomach churning reaction at the time and it’s gone downhill ever since.

186565 ▶▶▶ Fingerache Philip., replying to Janice21, 4, #1063 of 2327 🔗

I blame daytime television.

186577 ▶▶▶▶ CGL, replying to Fingerache Philip., 5, #1064 of 2327 🔗

Funny I’ve been blaming love island, x factor/BGT and made in Chelsea

186589 ▶▶▶▶▶ Fingerache Philip., replying to CGL, 4, #1065 of 2327 🔗

Same difference.

186695 ▶▶▶▶▶▶ CGL, replying to Fingerache Philip., 3, #1066 of 2327 🔗

Turned their brains to mush

186755 ▶▶▶▶▶▶▶ Fingerache Philip., replying to CGL, 1, #1067 of 2327 🔗

You said it.

186608 ▶▶ DRW, replying to chaos, 2, #1068 of 2327 🔗

Some in my former organisation were so deep in the governmental matrix, if you told them something outside they just went quiet, complete does not compute moment.

186614 ▶▶▶ Dan Clarke, replying to DRW, 1, #1069 of 2327 🔗

Common Purpose Sheep.

186618 ▶▶ JHuntz, replying to chaos, 1, #1070 of 2327 🔗

There you have it bedwetters are the ones that enjoyed furlough.

186840 ▶▶ Christopher, replying to chaos, 3, #1071 of 2327 🔗

Also very shocked at just how F#cking thick most of the nation really ( and I say this as someone who messed up his education and left school with nothing )
Talking to some of the guys I work with is infuriating , after days of presenting them with alternative news sources and facts relating to how this is virus is nothing to worry about although we need to worry about the mass deception being carried out on us all , thinking I am finally getting through to them . The following day over the morning cuppa and bacon butty I will get ” Guess what I saw last night ? turns out you can catch it twice and get long covid ” and then preceding to slather themselves in hand sanitiser .
Arrrgggggghhh !!!! sweet Jesus save me from the sheep , goons , the unthinking , halfwits or whatever you want to call them , these Morons will sink us all .

186539 arfurmo, replying to arfurmo, 1, #1072 of 2327 🔗

Latest figures https://news.sky.com/story/coronavirus-uk-reports-another-137-deaths-and-19-724-cases-12104039 . Usual caveats death with/from and cases aren’t always cases.

186639 ▶▶ Ceriain, replying to arfurmo, 1, #1073 of 2327 🔗

Krankie’s reporting 15.

I reckon the next level of the con is here; they’ve started counting flu deaths as Covid-19. The sudden jump is too unbelievable!

186658 ▶▶▶ David, replying to Ceriain, #1074 of 2327 🔗

She’s promising new rules on face coverings.

186542 chaos, replying to chaos, 10, #1075 of 2327 🔗

More observations from Berkshite:

Miles and miles of roads being resurfaced. Never seen resurfacing on such a scale before. Road after road after road. Mile after mile. Spend spend spend. Spend like no one is watching.

186549 ▶▶ MizakeTheMizan, replying to chaos, 4, #1076 of 2327 🔗

Happening here too, but they are painting cycles on the newly surfaced ‘roads’.

186572 ▶▶ CGL, replying to chaos, 2, #1077 of 2327 🔗

We’re in w.berks – our pavements are being done as we speak. Mind you they were crumbling and prob havent been done since the 1950s when the houses were built. And lots of other roads and the M4 junction being done too.

186576 ▶▶ Nic, replying to chaos, 2, #1078 of 2327 🔗

Same in north yorks

186612 ▶▶ JHuntz, replying to chaos, 1, #1079 of 2327 🔗

yup we have new cycle paths popping up all over the place.

186708 ▶▶ StevieH, replying to chaos, 1, #1080 of 2327 🔗

Amount of roadworks here in Wales is staggering. I suspect Boris bunged them a load of dosh to support mask wearing.

186778 ▶▶ RickH, replying to chaos, 1, #1081 of 2327 🔗

That’s been going on for quite a long time – way before the Covid crap.

LAs were supposedly hard up, but Amey and other offenders were raking it in – digging up roads, felling trees (see ‘Sheffield’) etc.

The expenditure has been observably mountainous – straight out of taxation into the private purse, in tune with the pipeline established over the period of ‘freemarket neoliberalism’ – aka subsidy from taxation (cut out the middleman, and substitute a ever-lasting contract).

186800 ▶▶▶ Jonathan Palmer, replying to RickH, #1082 of 2327 🔗

Also in line with Agenda 21/30.

186555 Edward, replying to Edward, 15, #1083 of 2327 🔗

Lidl this morning. A handful of unmasked customers among the zombies. This store is in an area with a lot of east Europeans, and in my experience the Poles in particular are often quite “devil-may-care”.
I use the self-checkouts, of which there are 6, but as usual 2 of them weren’t working. While the stroppy woman assistant on duty was dealing with another customer beyond the checkouts, the red lights at the top started flashing, until 3 out of the 4 checkouts were “stuck”. I remembered a line from Dad’s Army about a cheeky boy standing outside Jones the butcher’s shop and shouting “Sainsbury’s!” and I said quite loudly “Let’s all go to Aldi!”
Don’t know if she heard me, but the stroppy assistant seems to have mellowed a bit and no longer demands that customers keep their distance from her (she is masked). She came round with her magic key and fixed all the troublesome checkouts, which seem subject to these frequent minor problems.
Despite all the above it’s still a decent place to shop with no door monitor and no questioning of the unmasked.

186574 ▶▶ John P, replying to Edward, 3, #1084 of 2327 🔗

I too shop unmasked in a lidl. No problems so far.

186580 ▶▶ Edward, replying to Edward, 4, #1085 of 2327 🔗

Forgot to mention, I carry a black felt-tip marker around with me and was tempted to use it on a board outside a restaurant, something like “Social distancing but still welcoming”, with a picture of a smiling diner and a masked waitress. A big cross, an unsmiley mouth, or a short slogan across the mask is tempting – I may do it when no one is looking. One of our sceptics here does such things, Annie if I remember rightly.

186594 ▶▶▶ John P, replying to Edward, 1, #1086 of 2327 🔗

I have also, on occasion indulged in such behaviour.

186884 ▶▶▶ annie, replying to Edward, 3, #1087 of 2327 🔗

I rip down Covid notices and stick stickers.
Am thinking of a new sticker to use on shops and cafés with notices shrieking that face nappies are COMPULSORY:

FORTUNATELY, VISITING YOUR POXY ESTABLISHMENT IS NOT COMPULSORY. SO I WON’T. SAY GOODBYE TO MY MONEY.

186578 chris c, replying to chris c, 11, #1089 of 2327 🔗

You folks write so much that I;m having difficulty keeping up, so if this has already been covered I apologise.

Since forever we’ve had an hour free parking in the town car parks, partly subsidised by the local shops. This involves pressing a button on the ticket machine. Longer stays required the insertion of money.

At the start of lockdown the ticket machines were shut down, obviously to stop covid-infested fingers from touching the covid-infested button, and to prevent the council workers from touching the covid-infested money. Probably he was furloughed.

This obviously worked as there were very few cases here*

Back in July or August the machines were switched back on, with notices asking people to use an app called RINGO rather than money.

Last week the machines were upgraded probably at enormous expense. The new machines have an entire keyboard where you have to type in your registration number which is logged on a server. The free time has been reduced to half an hour and the other prices doubled.

Obviously traking and tracing our cars takes priority over catching covids from the keyboard. Plus the keyboard is pretty insensitive so we have to stand in a (socially distanced) queue while everyone fumbles.

At first I couldn’t see the point, after all they can’t tell which shops you went in or if you just walked in the park,or if someone else drove it. Now I suspect this is preparation for the forthcoming second lockdown where everyone over 65 or 60 or even 50 is forced to self isolate. Log your car in and expect a visit from the Police, or the Army.

Is this occurring elsewhere in the country?

*actually I suspect the reason for so few cases here is that many people came down with a very covid-like illness between october and february, peaking in december when I also had it. I felt a bit off, coughed a lot especially at night, and developed pink eye only in one eye which was gone by lunchtime. Some people had it even milder, some had it quite bad but no-one panicked because we didn’t know we were meant to.

I’ve heard the same tale from the west country and other places with low covid “cases”

186593 ▶▶ Dan Clarke, replying to chris c, 5, #1090 of 2327 🔗

More like cashless society. And desperate councils raking as much money as they can. I travel around the country quite a lot and use car parks, ringo isint new and also a lot of car parks with other systems have you put in your reg number, for years. Maybe planning on all this for years. Big Brother.

187499 ▶▶▶ chris c, replying to Dan Clarke, #1091 of 2327 🔗

OK so we;re just behind the times here and only now catching up. The only places I know that previously required your reg number long before covid were some pubs, to stop non-customers using their car park.

The joke is you can (still) park at the Co-Op and another car park for free and walk to the shops.

186721 ▶▶ RickH, replying to chris c, 1, #1092 of 2327 🔗

I felt a bit off, coughed a lot especially at night, and developed pink eye only in one eye which was gone by lunchtime.”

Was today discussing such recent past ailments with a friend.

We used to call them ‘mild viruses’ – even when some of the effects lasted a few weeks. Unpleasant, but hardly a reason to kill normal life.

187500 ▶▶▶ chris c, replying to RickH, #1093 of 2327 🔗

Yes and when some of the people with not-covid who had it much worse than me went to the octor that’s exactly what they were told

186730 ▶▶ Basics, replying to chris c, 1, #1094 of 2327 🔗

Have not see similar switching of parking meters here. Parking has had the covid fiddle applied to the extent that independent business has folded through inaccessibilty. They don’t want you in your car.

186765 ▶▶ leggy, replying to chris c, 1, #1095 of 2327 🔗

I drove to London recently and caught the tube in. I couldn’t pay to park my car with cash anymore at the station (have been doing so for many years) and I couldn’t top up my Oyster with cash any more either (again – have done so for years).

186785 ▶▶ DressageRider, replying to chris c, #1096 of 2327 🔗

We’ve had RINGO where I am for ages. And all the council machines require number plate to be input, sometimes full number sometimes just the 1st 4.
But they still take cash as well.

186587 Dave #KBF, replying to Dave #KBF, 1, #1097 of 2327 🔗

Seems The White House may be onside

From The NY Times

186590 ▶▶ John P, replying to Dave #KBF, 4, #1098 of 2327 🔗

Not for much longer if Trump loses. He’s very much the lesser of two evils.

186597 ▶▶ Dan Clarke, replying to Dave #KBF, 8, #1099 of 2327 🔗

Just got to hope Trump wins, or we are doomed

186600 ▶▶▶ DRW, replying to Dan Clarke, 6, #1100 of 2327 🔗

I think he will. Just look at how confident he wouldn’t last time, right up to the actual election night coverage: https://www.youtube.com/watch?v=G87UXIH8Lzo

186607 ▶▶▶ John P, replying to Dan Clarke, 1, #1101 of 2327 🔗

Steady on, Private Fraser.

186626 ▶▶▶▶ Dan Clarke, replying to John P, #1102 of 2327 🔗

Doomed I say

186711 ▶▶▶ RickH, replying to Dan Clarke, #1103 of 2327 🔗

Sorry – but the fact of Trump is actually just another example of how far any concept of a western ‘ civilization’ has fallen from any contact with reality.

186788 ▶▶▶▶ Biker, replying to RickH, 1, #1104 of 2327 🔗

What amazes me about you is how wrong you are on everything you say. It’s absurd.

186803 ▶▶▶▶ Julian, replying to RickH, 6, #1105 of 2327 🔗

It’s a point of view, but a Trump victory IMO is way better for sceptics than a Biden victory and nothing else matters much

186666 ▶▶ Richard O, replying to Dave #KBF, 2, #1106 of 2327 🔗

We cannot afford to put our faith in any politicians. I agree that Trump seems somewhat more palatable than the Demoncrats, but is definitely not to be trusted.

186783 ▶▶▶ Lisa from Toronto, replying to Richard O, 7, #1107 of 2327 🔗

I despise the man but his instincts have been right on this one from the start. He said the cure would be worse than the disease and he also called for less testing. He finally replaced that cretin Fauci with Dr. Scott Atlas. Of course Trump can turn on a dime, but he may be the lesser of two evils at this point in time.

186601 kh1485, replying to kh1485, 6, #1108 of 2327 🔗

Message to the lovely Jean – AKA Carrie Symonds of 10 Downing St. London!

Thank you so very much for your very, very kind gesture. I really am very touched by your generosity. Apologies that the shop seemed akin to a madhouse when you arrived! Hopefully that won’t put you off visiting again, to share some more lockdown scepticism!

Thanks once again – khx

186606 ▶▶ Dave #KBF, replying to kh1485, 3, #1109 of 2327 🔗

Cryptic but sounds interesting.

186625 ▶▶ chaos, replying to kh1485, 1, #1110 of 2327 🔗

Message to Boris. Thank you for touching my boobs. And my vavoom broom. I am now pregnant. I will call it Hugo or Jemima if it is human.

186629 ▶▶ Ceriain, replying to kh1485, 1, #1111 of 2327 🔗

Does Carrie read these pages, KH? 😉

186633 ▶▶ arfurmo, replying to kh1485, 7, #1112 of 2327 🔗

I’m guessing that the lady’s T&T details said Carrie S and she left a generous tip

186643 ▶▶▶ kh1485, replying to arfurmo, 13, #1113 of 2327 🔗

Jean reads LS but doesn’t comment. She decided to visit my shop after reading what we had been subjected to.

Yes, you’re right about the Carrie S T&T. When I was able, we had a lovely chat about the crapfest that is the reaction to COVID. She did more than leave a generous tip and I just wanted to say thank you to her for her kindness, because it was incredibly touching (at a time when there isn’t an awful lot of kindness around).

186651 ▶▶▶▶ Dave #KBF, replying to kh1485, 5, #1114 of 2327 🔗

That is lovely to hear.

186750 ▶▶▶▶ Ceriain, replying to kh1485, 3, #1115 of 2327 🔗

Nice to hear you do get some good ones. 🙂

186689 ▶▶▶ CGL, replying to arfurmo, #1116 of 2327 🔗

Took my brain a couple of minutes to work it out!

186603 jakehadlee, replying to jakehadlee, 19, #1117 of 2327 🔗

BBC, and lockdowns, getting slaughtered in the comments. All top comments are deeply cynical. Good signs.

https://www.bbc.co.uk/news/health-54538278

186615 ▶▶ DRW, replying to jakehadlee, 4, #1118 of 2327 🔗

Sounds like the 77th and their ilk will soon be deployed.

186644 ▶▶ Achilles, replying to jakehadlee, 11, #1119 of 2327 🔗

How you can even go near the BBC in any form I don’t know but thank you for reporting back from the front lines so we don’t have to.

186709 ▶▶▶ Jonathan Palmer, replying to Achilles, 2, #1120 of 2327 🔗

With the guardian and times they area good source to find out the governments intentions

186671 ▶▶ jhfreedom, replying to jakehadlee, 3, #1121 of 2327 🔗

Fantastic, the BBC has been complicit and they should be put on trial for (almost certainly) causing excess deaths over a 5-year period.

186683 ▶▶ Jakehadlee, replying to jakehadlee, 1, #1122 of 2327 🔗

I go there to educate them (response to Achilles below)

186734 ▶▶ Awkward Git, replying to jakehadlee, 3, #1123 of 2327 🔗

Nearly 1200 comments – not seen a pro-narrative one yet.

186742 ▶▶ Mabel Cow, replying to jakehadlee, 4, #1124 of 2327 🔗

Can you believe the chart that the BBC has dropped in the middle of that bullshit article?

Total fear porn hockey stick, with some totally made up bollocks about the effect of a circuit breaker, and then they put this under the chart:

“An illustration, not a prediction, of what could happen if the current growth rate continues unchanged, with and without a circuit break.”

According to the ONS, there have been 53,335 deaths-with-positive-test up to week ending 2020-10-02, and the BBC are “illustrating” 1.5 times that number of additional deaths in the next three months.

I’m lost for words. Fuck it, I’m changing camps. This is a conspiracy.

186773 ▶▶▶ Jonathan Palmer, replying to Mabel Cow, 1, #1125 of 2327 🔗

It all makes sense when you put on the tin foil hat

186853 ▶▶▶ Two-Six, replying to Mabel Cow, 2, #1126 of 2327 🔗

Welcome, the kettle is boiling on the camp fire. Nice cuppa T?

186907 ▶▶▶▶ Mabel Cow, replying to Two-Six, 1, #1127 of 2327 🔗

Yeah, go on then. Might as well.

186955 ▶▶▶ Cheezilla, replying to Mabel Cow, #1128 of 2327 🔗

Is it signed Patrick Vallance by any chance?

187775 ▶▶▶ Sam Vimes, replying to Mabel Cow, #1129 of 2327 🔗

“Predicted deaths at current transmission rates”. That is to say:

“If the figures we are guessing at right now were correct and were real cases , and if those cases led to actual deaths – which is not a certainty at all, then this is what could happen. But this is unlikely .”

Naah, wouldn’t fit on the graph would it?

186628 Basics, replying to Basics, 6, #1130 of 2327 🔗

Maybe already covered unable to keep up at the moment.

“Poor numerical literacy linked to greater susceptibility to Covid-19 fake news

“Cambridge University study also suggests older people less likely to believe coronavirus misinformation”

https://www.theguardian.com/world/2020/oct/14/poor-numerical-literacy-linked-to-greater-susceptibility-to-covid-19-fake-news

Given what we know msm consider to be factual news, could this be seen as good news that younger people aren’t buying the propaganda? The guardian is ill-equiped to do anything about the problem identified by Cambridge because no one cares what rubbish in mi5 daily. BMG Foundation funded or not.

186654 ▶▶ Lms23, replying to Basics, 2, #1131 of 2327 🔗

Not only, but also:

U.S. article:
https://news.gallup.com/opinion/gallup/321698/covid-responses-men-women.aspx
The COVID-19 Responses of Men vs. Women

“First and foremost, throughout the pandemic, women have consistently been more concerned than men about catching COVID-19.
This attitude manifests itself in personal behaviors: In trends since June, women have been more likely than men to report having worn a mask at some point in the past seven days.

Looking at the last two months of data, it is clear that differences between men and women are related to partisanship, but they also transcend it.

The following table shows that Democratic men and Democratic women tend to be relatively similar in their COVID-19-related attitudes and behaviors. It is also the case that the average Democratic man is more cautious with respect to COVID-19 than the average Republican woman.

But there are still clear gender differences that go beyond party. Strong gender differences are observed among Republicans (and independents, not shown here), such that men tend to be less concerned about and less likely to take measures to prevent COVID-19 transmission than women within their same party.”

(See the article for the relevant tables. They’re not included as images, and the text won’t copy over meaningfully.)

186692 ▶▶▶ Basics, replying to Lms23, 1, #1132 of 2327 🔗

Men r bad m kay

186682 ▶▶ JHuntz, replying to Basics, 6, #1133 of 2327 🔗

The article is typical of the Guardian and their ilk:-

Overall, higher susceptibility to fake news was associated with lower self-reported compliance with public health guidance for Covid-19, as well as people’s willingness to get vaccinated against the virus and recommend the vaccine to vulnerable family and friends.”

Look at the the pathetic guilt treatment should someone not want to be vaccinated or recommend vaccination. I hate this paper with every fibre in my body!!!

186701 ▶▶▶ RickH, replying to JHuntz, 3, #1134 of 2327 🔗

You’d have thought that The Groan would know a lot about ‘fake nooz’, given that it publishes so much.

But Viner – the establishment’s favourite whore – is way past being able to tell truth from fiction. Such concepts are way under her servile pay grade. Her promotion to editor was like putting Shipman in charge of a Care Home.

186710 ▶▶▶▶ JHuntz, replying to RickH, 2, #1135 of 2327 🔗

I actually forgot to mention this. The guardian of all places is now the arbiter of “fake news”.

186690 ▶▶ RickH, replying to Basics, 5, #1136 of 2327 🔗

You have to (well – sort of) laugh at the Groaniad – the bog paper about as far away from numeracy as Pluto is from enlightenment by the Sun.

The modern Groan is so far from truth and proper journalism that even the distinction between the terms’black’ and ‘white’ is far beyond its grasp.

186713 ▶▶▶ JHuntz, replying to RickH, 4, #1137 of 2327 🔗

Well it feeds the delusion of 60 odd genders so there is still a long way to go for this rag.

186810 ▶▶ Cheezilla, replying to Basics, 1, #1138 of 2327 🔗

The blatantly egregious article is a very long-winded way to spread misinformation about people who don’t buy into the propaganda. It’s a fantastic example of doublespeak.

187502 ▶▶ chris c, replying to Basics, #1139 of 2327 🔗

It’s somewhat the opposite here, a lot of cynical old folks. Lots of good crack to be had, someone walked out of the door at the butcher;s instead of going out the back door, then said

“Oh Christ I went the wrong way!”

I said “The virus is going to kill you now, it’s been laying in wait. It knows when you use the wrong door or walk on the wrong side of the street or if you’re still in the pub after ten, it’s incredibly intelligent you know”

Much mirth among the other folks in the street

186631 Dan Clarke, replying to Dan Clarke, 5, #1140 of 2327 🔗

Common Purpose began in 1989. The start of a downward slide in society, taking individualism out and selecting programmed sheep to take over the institutions.

186684 ▶▶ Darryl, replying to Dan Clarke, 2, #1141 of 2327 🔗

Not going to be easy to unravel 31 years of damage – the entire management structure would probably be Common Purpose.

186696 ▶▶ Richard O, replying to Dan Clarke, 1, #1142 of 2327 🔗

The same year that Eastern bloc communism finally fell after laying waste to the Warsaw Pact countries for 45 years.

186795 ▶▶ Cheezilla, replying to Dan Clarke, #1143 of 2327 🔗

By that time, we’d struggled through a recession with 4 million unemployed. Seen industry and communities smashed, public services run into the ground ready for cheap selloffs and the gap between haves and have-nots dramatically widened. We were ripe for the taking.

186647 Sam Vimes, replying to Sam Vimes, 12, #1144 of 2327 🔗

A two-week circuit breaker at the end of October may halve Covid deaths in the UK between now and the end of the year, says a scientific report.

“may”?
“scientific”?

186680 ▶▶ RickH, replying to Sam Vimes, 3, #1145 of 2327 🔗

No – another modeller’s fiction. Not ‘scientific’ – just speculation with using another duff computer program.

186787 ▶▶▶ Cheezilla, replying to RickH, #1146 of 2327 🔗

Who needs a computer program?

187504 ▶▶▶▶ chris c, replying to Cheezilla, #1147 of 2327 🔗

I;m pretty sure I remember Chris Witty, or it may have been one of the other talking heads, saying back in May or June that we were going to have another lockdown in October. It was part of the agenda way back then, no reason for it not to come true.

186685 ▶▶ FlynnQuill, replying to Sam Vimes, 10, #1148 of 2327 🔗

There’s hardly any bloody deaths. Covid amounts to 1.6% of the daily deaths FFS, which averages around 1640. 600 on average are cancer deaths. These insane people suggesting this haven’t got a clue. After the so-called circuit breaker what happens then? Is the virus just going to pack its bags and fuck off? Of course not, just delaying the inevitable. People who didn’t die during the circuit breaker will just die when its lifted. I give up.

186700 ▶▶▶ JHuntz, replying to FlynnQuill, #1149 of 2327 🔗

Oh they’ve done that 2 week leccy breaker i’ll be off now…

186740 ▶▶ OKUK, replying to Sam Vimes, 2, #1150 of 2327 🔗

Or, to put it another way, may not.

186854 ▶▶ guy153, replying to Sam Vimes, #1151 of 2327 🔗

Pretty unlikely but amusing that they set a goal of the end of the year. A two week lockdown would delay some deaths by perhaps 6 to 8 weeks so it’s possible a small number of people would make it to January who otherwise would have died in December.

186655 Allen, 15, #1152 of 2327 🔗

Do not argue defensively with scum. Take the offense. Anyone in support of lockdowns needs to be arrested immediately.

Overall, lockdown deaths account for ~26% of total excess deaths to date – and growing. “Covid mortality” (no such thing) will soon end but lockdown deaths will continue to accrue for years to come.

https://twitter.com/Humble_Analysis/status/1315799672158482434

German study shows 1.3% false positive rate for Coronavirus test. If this is accurate, it indicates that essentially all present cases in Germany are false positive.

https://twitter.com/Humble_Analysis/status/1316254237764939776

186657 Achilles, replying to Achilles, 15, #1153 of 2327 🔗

Let’s face it. Since May every bit of fear, every policy, every restriction has been based entirely on what could happen, not what is happening. We’d have been better off spending all that money on a laser gun to shoot near earth objects out of the sky.

186662 ▶▶ Dan Clarke, replying to Achilles, 2, #1154 of 2327 🔗

Its true, the most used word right now is Could

186769 ▶▶ leggy, replying to Achilles, 4, #1155 of 2327 🔗

Or eradicating poverty, homelessness, hugely increasing health. The mind boggles.

186842 ▶▶ guy153, replying to Achilles, #1156 of 2327 🔗

The difference is that near earth objects are actually a real threat and that laser might have been quite useful one day.

186673 Sam Vimes, 15, #1157 of 2327 🔗

Visited Sports Direct yesterday, needed new walking shoes, as it’s all we’ll have left to do, shortly. Second unmasked visit in recent weeks, and once again, no hassle. Staff muzzled, but friendly. Lad that served me was fine, and had good sceptical chat with lass on till.
That’s the way to do it.

186679 Darryl, replying to Darryl, 7, #1158 of 2327 🔗

Interesting article on Off Guardian – ‘ The Covidian Cult’
https://off-guardian.org/2020/10/13/the-covidian-cult/

I don’t think many on this site would now dispute the cult like status the virus has amongst many in the general public and more frighteningly those with power.

186722 ▶▶ Richard O, replying to Darryl, 13, #1159 of 2327 🔗

What we are up against is not a misunderstanding or a rational argument over scientific facts. It is a fanatical ideological movement. A global totalitarian movement … the first of its kind in human history.

186688 Basics, replying to Basics, 1, #1160 of 2327 🔗

Vaguely trying to understand the number of nhs app downloads. More than 10m is the most frequent figure which came out of Hancock after 6 days from launch.

If it was 12 million would they publish that number? All things considered it feels to me that uptake has stalled.

I see that many of Britains banks prevent staff from using the app at work.
“Lloyds Banking Group , along with rival TSB, are among those advising employees to deactivate the NHS Track & Trace app during office hours, when they are not allowed to keep phones on their person. Some banks ask staff and cashiers to store phones away to prevent leaks of sensitive customer data, although this is not formally required by..”

186694 ▶▶ Will, replying to Basics, 8, #1161 of 2327 🔗

It is bound to stall/ stop. If you are stupid/ naive enough to download the thing you will have done it on the day it was released. If you aren’t stupid/ naive enough to believe it is a good idea you aren’t going to suddenly change your mind.

186699 ▶▶▶ Basics, replying to Will, 5, #1162 of 2327 🔗

Yes. They launched it knowing the adoption curve. They also would have planned for obfuscation from revealing the apps in use. No consistent update about app downloads nor app use converted into successful targeted isolation commandments.

Journalists once woukd have been all over this bread and butter scandal – it’s so obvious I can even pick it apart by adopting a slight squint.

Will they declare at any point with it?

186772 ▶▶▶ Lms23, replying to Will, 1, #1163 of 2327 🔗

Then that figure tells us a lot. The vast majority of the population don’t believe in it.

186838 ▶▶▶ guy153, replying to Will, 2, #1164 of 2327 🔗

Whenever I see a Google ad for it I turn it off and click the box that says “ad was inappropriate”. Not sure exactly what they mean by that but it’s the most disparaging option available.

186856 ▶▶▶▶ CGL, replying to guy153, 3, #1165 of 2327 🔗

I keep doing that on FB every time I see an NHS or government post about anything Covid related. Irrelevant is the perfect word for all of it – or should be.

186919 ▶▶▶▶ mattghg, replying to guy153, 1, #1166 of 2327 🔗

Good idea.

186698 ▶▶ JHuntz, replying to Basics, 4, #1167 of 2327 🔗

Also, there will be many a virtue signaller who has sleepwalked there way into two or three tests and thought better of the app now.

186762 ▶▶▶ Now More Than Ever, replying to JHuntz, 5, #1168 of 2327 🔗

I’m convinced a lot of people who downloaded it initially to see what all the fuss was about have now deleted it.

186758 ▶▶ Now More Than Ever, replying to Basics, 8, #1169 of 2327 🔗

France is binning theirs, due to gremlins and low take-up.

186764 ▶▶▶ Basics, replying to Now More Than Ever, 1, #1170 of 2327 🔗

Good to know and hear thanks.

186771 ▶▶ Lms23, replying to Basics, 3, #1171 of 2327 🔗

I read ages ago that even in one of the South Asian countries, the take-up of their t&t app was only around 15%

186781 ▶▶ Cheezilla, replying to Basics, 3, #1172 of 2327 🔗

I think many people installled it out of curiosity, then promptly uninstalled it.

186836 ▶▶ Two-Six, replying to Basics, 1, #1173 of 2327 🔗

Mrs 2-6’s care company have told employees not to use the app.

186693 assoc, replying to assoc, 2, #1174 of 2327 🔗

I see the French are working on a saliva test – 87.5% accurate. God help us!

186704 ▶▶ zacaway, replying to assoc, 2, #1175 of 2327 🔗

Well, with that accuracy if we test everyone in the UK we should get about 7.5 million false positives. That ought to blow a few holes in Handcock’s spreadsheets.

186768 ▶▶▶ Lms23, replying to zacaway, 1, #1176 of 2327 🔗

I’d assume he’d be relying upon it.

186715 ▶▶ Mabel Cow, replying to assoc, 9, #1177 of 2327 🔗

Using a virus prevalence of 0.23% (as per ONS figures for percentage of positive tests in England over the past six weeks), I calculate that a saliva test with an 87.5% accuracy would result in 98.2% false positives.

186703 Emily Tock, replying to Emily Tock, 15, #1178 of 2327 🔗

FFS Galway City Council has canceled the Eyre Square Christmas Market … Let’s all just hide under our beds for the rest of eternity because The Covid might get us! WHEN will these people understand that SURVIVING is not LIVING?????!!!!! And WHY can they not understand numbers? I’m at the end of my rope.

186723 ▶▶ Voz 0db, replying to Emily Tock, 2, #1179 of 2327 🔗

You need to wait for the SUPER-VACCINE that Bill Gates & Co. is preparing…

The MAIN GOAL?!
comment image

Enjoy “your” LIFE while They allow it!

186727 ▶▶▶ JHuntz, replying to Voz 0db, 1, #1180 of 2327 🔗

P*S*E*C = Get that vaccine in your veins yesterday!

186735 ▶▶▶▶ Voz 0db, replying to JHuntz, #1181 of 2327 🔗

If Billy G could he would had already done that!

186767 ▶▶▶ Lms23, replying to Voz 0db, 4, #1182 of 2327 🔗

And I’d say he’s trying to solve the wrong problem anyway.
There isn’t a problem with CO2 in the atmosphere. It’s essential for plants and all life. It’s all an excuse to control people.

186867 ▶▶▶▶ Voz 0db, replying to Lms23, #1183 of 2327 🔗

CO2 is just the distraction… The SRF & Billionaires just want to reduce the size of the Herd. Since “CO2” bla bla bla is already a slogan that the Herd responds to, They use it, with great efficiency.

186705 Voz 0db, 2, #1184 of 2327 🔗

BEST SOLUTION!

comment image

If a SUCCESSFUL JUMP is executed by the sheeple, the SRF & Billionaires guarantee an 100% Lifetime immunity to all viruses and bacteria and fungus.

186714 ▶▶ Voz 0db, replying to Dan Clarke, 2, #1186 of 2327 🔗

Doesn’t matter at all!

THERE IS NO GOLD STANDARD for the chemical reaction morons STILL DO THIS DAY “think” is a “test”…

The lack of a clear-cut “gold-standard” is a challenge for evaluating covid-19 tests

BMJ 2020;369:m1808 doi: 10.1136/bmj.m1808 (Published 12 May 2020)

So… Just RELAX and enjoy the CIRCUS.

186777 ▶▶▶ Cheezilla, replying to Voz 0db, 1, #1187 of 2327 🔗

And don’t get tested!

186863 ▶▶▶▶ Voz 0db, replying to Cheezilla, #1188 of 2327 🔗

Of course!

186707 Awkward Git, replying to Awkward Git, 18, #1189 of 2327 🔗

Got bored so got onto the Labour Party website, found the complaints page and put in a complaint against Kier Starmer, all MPs who abstained from voting and all local councillors who want more lockdowns.

The charge:

Holding us all in complicit in genocide against the old and sick in acre homes (sent them the Amnesty report link, told them all their MPs and councillors should read it and check if they can morally agree with the actions they are complicit in, contempt of the people and Parliament, bring Parliament into disrepute, possible treason.

When they asked “what makes you think the person is a member of the `Labour Party I put “He frequently appears on TV and in MSM claiming to be the Leader of the Opposition.”

The Conservatives have a shorter form so just asked them to give every MP and councillor the Amnesty report to read.

186719 ▶▶ Voz 0db, replying to Awkward Git, #1190 of 2327 🔗

They don’t care! They are IMMUNE to political responsibility…

186725 ▶▶▶ Awkward Git, replying to Voz 0db, 16, #1191 of 2327 🔗

I know but killed 5 mins and vented some vitriol.

You never know, sometime in the far future when they look back and research what happened they may say “look, this guy awkward really put the boot in, pity more didn’t do that”.

Wife won’t let me out to do violence against these arseholes (she’s the sensible one) so doing what I’m good at – writing letters and complaints and being awkward.

186733 ▶▶▶▶ Voz 0db, replying to Awkward Git, #1192 of 2327 🔗

That’s what They (SRF&Billionaires&jesters) are counting on… Mere internet venting!

186774 ▶▶▶▶▶ Cheezilla, replying to Voz 0db, 1, #1193 of 2327 🔗

What are you doing?

186860 ▶▶▶▶▶▶ Voz 0db, replying to Cheezilla, -1, #1194 of 2327 🔗

Educating ignorants! Not easy!

186746 ▶▶▶▶ CGL, replying to Awkward Git, 3, #1195 of 2327 🔗

And you are so brilliant at it.

187084 ▶▶▶▶ Nick Rose, replying to Awkward Git, #1196 of 2327 🔗

You’re certainly good at that.

186736 ▶▶ Ceriain, replying to Cheezilla, 3, #1198 of 2327 🔗

“Who controls the past controls the future: who controls the present controls the past.”

186754 ▶▶ Lms23, replying to Cheezilla, 4, #1199 of 2327 🔗

“that is truly Trumpian in its blurring of the facts and denial of wrongdoing”

Whoever wrote that clearly hasn’t been paying attention to the antics of the Democrats and legacy media.

186830 ▶▶ PoshPanic, replying to Cheezilla, #1200 of 2327 🔗

Wow, they really are living in dreamland if they can deny that

187082 ▶▶ Nick Rose, replying to Cheezilla, #1201 of 2327 🔗

They’ll be telling us next that freezers are back in stock…

186717 MiriamW-sometimes-AlanG, replying to MiriamW-sometimes-AlanG, 17, #1202 of 2327 🔗

Oh dear. Our excitable neighbour has been round to collect a parcel. It seems someone has got IT in the next street. We are of course now terrified and repentant, we will wear masks even in bed and apologise to everyone we have pissed off by spreading disinformation, denial and scepticism about The Plague. We may have to stop posting on this site and sign up with Arsebook and Twatter to get The Truth.

Actually, she was remarkably relaxed about it considering her elderly parents live close to the hot-spot epi-centre and, like us, thinks it’s probably just someone with a dubious positive test. She also told us that her father-in-law helps out at an undertakers. Apparently there is not much work at the moment (!) and that he has said it’s true that just about anyone and everyone has ‘Covid’ on their death certificate, irrespective of true cause of death. Also she is disgusted that her brother-in-law has downloaded the dodgy app and we beefed her up with some info for him about the data-trading.

p.s. https://www.dutchnews.nl/news/2020/10/the-netherlands-goes-into-partial-lockdown-face-masks-will-be-compulsory/ More incompetence, no doubt 😉 MW

186732 ▶▶ Ceriain, replying to MiriamW-sometimes-AlanG, 3, #1203 of 2327 🔗

Apparently there is not much work at the moment

Damn, you made me wet my keyboard, MW. 😀

187511 ▶▶ chris c, replying to MiriamW-sometimes-AlanG, #1204 of 2327 🔗

Three people have died in my street, NOT from covid, just from old age (but I wonder of they had anything that went undiagnosed or untreated). Happens all the time, lots of old folks around and it’s what they do

186718 Nick Rose, 17, #1205 of 2327 🔗

Anger building in Liverpool

https://twitter.com/REWearmouth/status/1316412328968097793

Pub renames itself ‘The Three Bellends’ in protest against Liverpool lockdown

186728 ianric, replying to ianric, 1, #1206 of 2327 🔗

A major issue is the reliability of PCR tests. A criticism of the PCR tests is that it doesn’t distinguish between Covid 19 and other viruses whilst defenders of PCR argue this is not the case. I would like opinions on this as to whether there is firm evidence to support either view.

186766 ▶▶ BeBopRockSteady, replying to ianric, 3, #1207 of 2327 🔗

Firm evidence? It’s not even up for debate is it?

https://www.medrxiv.org/content/10.1101/2020.08.04.20167932v4

We know it can pick of fragments of viral material, even other coronaviruses. There is no real debate about using PCR, its about the cycle thresholds that are applied, the subsequent definition of an ‘infection’ and its suitability for mass screening of a population to detect the spread of a virus.

It’s got its place, but as this entire omnishambles rests on use of RT-PCR, we are almost looking at criminality given the costs to livelihoods and the failure to disclose vital information regarding how accurate these tests actually are.

186786 ▶▶▶ guy153, replying to BeBopRockSteady, 1, #1208 of 2327 🔗

That paper you cited doesn’t say anything about fragments of viral material from other coronaviruses that I can see.

These are the actual fragments the tests look for:

ATGAGCTTAGTCCTGTTG
CTCCCTTTGTTGTGTTGT
AGATGTCTTGTGCTGCCGGTA
GGTAACTGGTATGATTTCG
CTGGTCAAGGTTAATATAGG
TCATACAAACCACGCCAGG
ACAGGTACGTTAATAGTTAATAGCGT
ATATTGCAGCAGTACGCACACA
ACACTAGCCATCCTTACTGCGCTTCG

One of those is found in both SARS1 and SARS2. The others are all unique to SARS2 out of all known viruses that infect humans.

Yes they are all very short fragments (the complete genome for SARS2 is about 30,000 of those letters). But they don’t come from anywhere else except the SARS2 virus (well actually one of them does exist in the human genome, but you’d be unlikely to find that).

So if you found them there is or was SARS2 in whatever you’re looking at.

186815 ▶▶▶▶ Two-Six, replying to guy153, 1, #1209 of 2327 🔗

I think this one should have been:
ACAGGTACGTTACTAGTTAGTAGCGT

186818 ▶▶▶▶▶ PoshPanic, replying to Two-Six, 3, #1210 of 2327 🔗

GATTACA

186890 ▶▶▶▶▶▶ Fiat, replying to PoshPanic, #1211 of 2327 🔗

Abacab

186899 ▶▶▶▶▶▶▶ Sam Vimes, replying to Fiat, #1212 of 2327 🔗

CAS 1074

186913 ▶▶▶▶▶▶▶▶ Nick Rose, replying to Sam Vimes, 1, #1213 of 2327 🔗

KAR120C

Vague one that, I know…

186936 ▶▶▶▶▶▶▶▶▶ Ceriain, replying to Nick Rose, 1, #1214 of 2327 🔗

You’re not a number, then, Nick? 😉

187052 ▶▶▶▶▶▶▶▶▶▶ Nick Rose, replying to Ceriain, #1215 of 2327 🔗

Glad someone knows it!
👍

187512 ▶▶▶▶▶▶▶▶▶ chris c, replying to Nick Rose, #1216 of 2327 🔗

That takes me back

187724 ▶▶▶▶▶▶▶▶▶ Sam Vimes, replying to Nick Rose, #1217 of 2327 🔗

That’s the beauty of this site. We go from genetics to Genesis, while they are Selling England By The Pound and we end up Prisoners.
All human life is there!

186832 ▶▶▶▶ BeBopRockSteady, replying to guy153, 1, #1218 of 2327 🔗

“cross-reactions with other viruses or genetic material could also be responsible for false-positive results.”

https://www.thelancet.com/journals/lanres/article/PIIS2213-2600(20)30453-7/fulltext#%20

187327 ▶▶▶▶▶ guy153, replying to BeBopRockSteady, #1219 of 2327 🔗

“could”. Then if you follow the reference they give for that claim, it’s this (government!) document:

https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/895843S0519_Impact_of_false_positives_and_
negatives.pdf

Where they say, “False positives were observed unexpectedly in norovirus assays in patients with enterocolitis, due to unusually high levels of human DNA in samples”

Which may be true, but has nothing to do with SARS2 PCR tests.

186776 ▶▶ guy153, replying to ianric, 8, #1220 of 2327 🔗

Other viruses are not a source of false positives. I’ve seen this claimed a few times, investigated further, and the claims never hold water.

One of the very early PCR tests could false positive on SARS1 (but not on any other coronavirus). But so what, SARS1 is worse than SARS2 anyway.

Then there was a document from the CDC saying that being positive for SARS2 did not rule out superinfection with another pathogen that was causing the symptoms. This is of course true but the unfortunate way they worded it made it sound like they were saying the other pathogen could cause a false positive.

Often when labs are evaluated for their PCR test they send them controls which contains other coronaviruses. I’ve never seen a case where any particular lab had a higher false positive rate on the other coronaviruses than on the samples that didn’t contain any virus at all. But sometimes the total number of tests in the study randomly ends up having slightly more false positives on the other-HCoV samples and then this gets cited as evidence.

Sometimes there is some confusion as well with antibody tests, which can certainly false-positive because of other viruses.

It would be very unlikely for PCR to react with other viruses as it faithfully only amplifies the genes it’s looking for. If it didn’t do that the whole process wouldn’t work– and we use PCR for lots of things and have done for many years, not just for tests for viruses.

The PCR test is a very good test if the cycle threshold is kept reasonable, and nobody should use any test who doesn’t understand Bayes Theorem. Unfortunately the government are a long way short of understanding even basic maths.

187004 ▶▶▶ SweetBabyCheeses, replying to guy153, 2, #1221 of 2327 🔗

Absolutely. A quick course in Bayesian Probability Theory could save us all. Half day is plenty if you have A Level maths.

186731 Clothcap, replying to Clothcap, -1, #1222 of 2327 🔗

“There is no such thing as herd immunity.” Nadine Dorries.
Flu symptoms are the body’s defence reponse to intoxication. A heavy night out produces flu symptoms next day.
Body defences include exosomes. Exosomes can convey toxin information between people that are in close contact with each other. Exosomes have a short existence of at most a few hours. Exosomes are inert and don’t reproduce. Those that haven’t been intoxicated by, e.g. 5G radiation poisoning, but exposed to someone having a defence response to it will develop a defence response and suffer less when afflicted.
Babies don’t have a developed defence system so don’t have a defence response (that includes pneumonia). Those whose defences haven’t been compromised. that are not ill, not elderly, not living in dense, toxic pollution (Wuhan, Lombardy) either don’t get ill from e.g. 5G radiation poisoning or suffer very mild defence response symptoms.
I managed all that without typing “immune” once.

The measles virus was eliminated by a German court. A gent thought he’d won a large sum on offer for proof of the existence of the virus. It went to court. He didn’t collect. Anna Von Reitz offered $5 billion dollars for proof that a harmful and infectious virus was causing what is credited to SARS COV2 coronavirus infectious disease 19. It’s there for the taking.

I say all this as a non expert and am happy to be found in error, but I doubt that is possible as I’m nearly always right, because I pay attention to those experts that prove to be neither jobsworths nor in Gates’ pocket, nor seeking political advantage.

The woowoo $WHO$ has done a U on lockdowns can someone tell that prat among prats, halfwit Hancock, and the Fascist military mutt that told us we must not look people in the eye. Labour woke up too late to profit. Lockdowns are dead in the water. Everyone around here is ignoring them and waking up to regime duplicity. I expect there will be court cases over harmful, compulsory masking that avoids transfer of exosomes when having sex. And authoritarian Nazi Jew, Boris’ illegal compulsory or compelled lockdowns.

Is Gates running the regime Nadine? Or is it the UN?

186784 ▶▶ leggy, replying to Clothcap, 1, #1223 of 2327 🔗

Good God, what does she think vaccines traditionally do?

186808 ▶▶ Two-Six, replying to Clothcap, 1, #1224 of 2327 🔗

Nadine is thicker than mince

186741 Sir Patrick Vaccine, replying to Sir Patrick Vaccine, 5, #1225 of 2327 🔗

Great Barrington Declaration co-author:

Dr Jay Bhattacharya, co-author of the Great Barrington Declaration: “The current lockdown strategy seeks herd immunity. That is the end point. The question is how much death and suffering will there be in the meantime?”

By the way there is appalling clip of Hancock dismissing the Great Barrington Declaration

14 Oct 2020
https://www.youtube.com/watch?v=ivVuUqLDqAk

186802 ▶▶ Kev, replying to Sir Patrick Vaccine, 1, #1226 of 2327 🔗

Can’t watch that utter, rhymes with Hunt. And he’s another one (Jeremy) spouting off yesterday about a rethink after two weeks of tiered Hell, and I don’t think he meant a relaxation. Double down, and if that doesn’t work double down again!

187211 ▶▶ matt, replying to Sir Patrick Vaccine, #1227 of 2327 🔗

Does anybody else have the problem on YouTube, especially with talk radio clips, that the ads come every minute or so and then it decides to move onto the next video well before the end?

186744 Old Normal, replying to Old Normal, 2, #1228 of 2327 🔗

Does anyone have the link please to the German mask video which showed the 80+ bacteria etc? I’m struggling to find it now.

Thanks in advance.

186747 ▶▶ Lms23, replying to Old Normal, 1, #1229 of 2327 🔗

I don’t have that, but I do have a segment on masks that Tucker Carlson did on last night’s show:

https://m.youtube.com/watch?v=b55a1vb8csQ
Tucker Carlson segment on masks

186757 ▶▶▶ Old Normal, replying to Lms23, #1230 of 2327 🔗

Thank you!

186923 ▶▶ A. Contrarian, replying to Old Normal, 3, #1231 of 2327 🔗

I have some doubts about this one… we are all covered in bacteria inside and out. We wouldn’t survive without them. I don’t care how many bacteria species/colonies are present on my toilet seat or kitchen surfaces. Just whether or not they’re capable of causing disease.

186748 Nick Rose, replying to Nick Rose, 13, #1232 of 2327 🔗

Protest Saturday, St George’s Hall, Liverpool, 1PM

186761 ▶▶ Cheezilla, replying to Nick Rose, 6, #1233 of 2327 🔗

Also one in Central London on the 24th.
See Save Our Rights UK

186809 ▶▶▶ Nick Rose, replying to Cheezilla, #1234 of 2327 🔗

What’s happening in London on the 17th? Seen no further details :o((

186816 ▶▶▶▶ Nick Rose, replying to Nick Rose, #1235 of 2327 🔗

And where in central London on 24th? Or TBC?

187439 ▶▶▶▶▶ JohnB, replying to Nick Rose, #1236 of 2327 🔗

tbc

186911 ▶▶ Polemon2, replying to Nick Rose, 1, #1237 of 2327 🔗

Bet that will not be on MSM

187047 ▶▶▶ Nick Rose, replying to Polemon2, 1, #1238 of 2327 🔗

I expect not, unless it’s “Covid deniers gather in Liverpool”

186749 JHuntz, replying to JHuntz, 11, #1239 of 2327 🔗

https://www.spiked-online.com/2020/10/13/the-pub-industry-is-on-the-verge-of-collapse/

Interesting article Toby has put up regards the pub industry. Highlights that masks and 10pm curfew have hammered there takings.

As much as I don’t want to see businesses go under us anti-maskers need to vote with our feet. Just don’t play by their rules.

186797 ▶▶ Two-Six, replying to JHuntz, 21, #1240 of 2327 🔗

Why on earth would anybody want to go to a pub pay £5 for a pint and sit down in a PPE face nappy tracked and traced HELL zone with no music and no company and no possibility of talking to anybody.

186811 ▶▶▶ William Hand, replying to Two-Six, 7, #1241 of 2327 🔗

Went to my local on Dartmoor today to have a drink with a friend. Staff wore clear visors. No track and trace or QR codes, tables spaced normally, all occupied. Roaring log fire and a couple pints of Jail Ale. Very pleasant. Relaxed staff and owner. But then this is rural Devon!

186823 ▶▶▶▶ stefarm, replying to William Hand, 2, #1242 of 2327 🔗

Wonderful, sadly lacking in scotistan. All I want to do is find a pub with minimal fuss and have a pint (although we are not allowed)

186935 ▶▶▶▶ Lili, replying to William Hand, #1243 of 2327 🔗

Sadly, my previously sceptic and sensible landlord has succumbed to the mask on mask off nonsense so I will be curtailing my visits.

186946 ▶▶▶▶ Two-Six, replying to William Hand, 2, #1244 of 2327 🔗

The visors put me off, particularly the visors, even more idiotic than face nappies.

186892 ▶▶▶ Sam Vimes, replying to Two-Six, #1245 of 2327 🔗

Agree on the hell zone, but shit show or not, I wouldn’t be paying £5 a pint anywhere.

186752 Basics, 1, #1246 of 2327 🔗

Freedom of movement within Germany has been stopped through indirect means.

https://youtu.be/ZJjdMJ_JUrg

Red Pill Germany YT channel was mentioned today on UKC as having some very interesting videos. This is one.

186763 James, replying to James, 20, #1247 of 2327 🔗

All that it takes for evil to flourish is for the good men and women posting on this site to keep complaining about the nonsensical narrative oozing out of all public officials and their advisors all over the world.

In my humble opinion it is the refusal of such good men and women to step off the cliff that separates those that have a deep seated faith in the establishment to look after them and listen to reason ( One more bit of statistical analysis is bound to make them
see sense, Clementine.) from those who know that they ( public officials and their myriad advisors ) are all either fundamentally stupid or fundamentally insane or fundamentally criminal in their intentions.

No one is going to come and save us from this evil. I am coming to the conclusion that there is virtually no one left in public office or public administration who is not utterly corrupt or utterly befuddled by years of indoctrination in what passes for our education system. There are plenty of sensible people in the world but we have been too busy working, playing and in my case raising children to notice that our entire society is pretty much fucked. It is all our fault. So many of us have been so complacent for so long.

Rant over. I go from hysterical to angry to desperate in ever decreasing circles.

186789 ▶▶ Kev, replying to James, 8, #1248 of 2327 🔗

We probably all feel the same to varying degrees.

People will act when they have nothing left to lose.

The frustration is crushing, we can defy the rules, ignore the fines, or fight them, but the system is stacked against us when we act alone.

I think things will change when furlough ends and we have around 6 million people without jobs, and many with no income. A fine is meaningless when you have no money! Prison will create martyrs, and the tide will turn.

186804 ▶▶▶ James, replying to Kev, #1249 of 2327 🔗

In Argentina they used the Atlantic as their prison. But that would never happen here!

186791 ▶▶ Two-Six, replying to James, 6, #1250 of 2327 🔗

I have never been complacent about how the normies are brainwashed and I have fought against it for my entire life.

187045 ▶▶ matt, replying to James, #1251 of 2327 🔗

To step off what cliff, James? And – preempting your answer – what difference would it make if we all stepped off that cliff?

187424 ▶▶▶ James, replying to matt, #1252 of 2327 🔗

Hi Matt,

Sorry, I missed your comment. The cliff in question is the one which divides the uplands, where we all believe that we are governed by people just like us-basically good, possibly a bit more ambitious and definitely at the moment a lot more incompetent and the lowlands- where we learn that the people who attempt to run our lives are corrupt, possibly psychopathic and definitely do not have goodwill towards their fellow human beings. It is the difference between believing that we can use democratic means including a judicial system to bring this madness to an end and the awful realisation that nothing will
change until we actually stop them from destroying our society. It is the difference between being ( in moral terms) naive children and being responsible adults.

In answer to your second question the difference would be a lot more gym owners in Liverpool defying authority and mass demonstrations across the land led by people who have the sense to understand what is going on and the courage to do something about it.

186775 Fingerache Philip., replying to Fingerache Philip., 44, #1253 of 2327 🔗

TOTAL RESPECT TO THE GYM OWNER WHO REMAINED OPEN IN LIVERPOOL AND ESPECIALLY THE RAVERS AT CHUCKING OUT TIME.

186993 ▶▶ SweetBabyCheeses, replying to Fingerache Philip., 3, #1254 of 2327 🔗

Top lad. He’s almost made his £10K on go fund me already: https://uk.gofundme.com/f/save-liverpool-gyms
Does he have to pay all the incremental fines or just the £10K one? Can they fine him this every day? Not sure how the police can do this as I’m not sure it’s a law?

187086 ▶▶▶ ConstantBees, replying to SweetBabyCheeses, 3, #1255 of 2327 🔗

He mentioned covering legal fees, so he probably intends to fight any fines in court. Chipped in £5 myself. Hope anyone who can afford it supports people like him. We need more lawsuits against the government.

186779 Clothcap, replying to Clothcap, -4, #1256 of 2327 🔗

Forgot to mention, “7 million new cases,” unsurprising when they are testing for human chromosome 8 sequence. The test works by amplification, diferent levels in different stations otherwise the headline would be 100% test positive for COVID – uh, I mean human chromosome 8.
It’s a confidence trick. Wanna buy a bridge?
The Bodj (board of directors Jew) occupation regime, possibly a UN service corporation (EU membership was a corporation takeover) like the 2 US occupation regime corporations, needs to be frog marched to jail.

187051 ▶▶ matt, replying to Clothcap, #1257 of 2327 🔗

Speaking of which, I haven’t seen guy153 in a while.

187338 ▶▶▶ guy153, replying to matt, 2, #1258 of 2327 🔗

Still here 🙂 I did actually see this comment but didn’t bother to reply although I did downvote it.

It’s true that one of the genes in the SARS2 PCR tests also appears in the human genome. But I think it’s unlikely it would cause many false positives because that gene (I don’t know what it’s for) would have to be being actually transcribed into RNA at the time you did the test. Also most of the tests look for more than one SARS2 gene. And the false positive rate isn’t that high.

It’s also true that with a lot of amplification you will be more likely get a false positive, but I don’t think that’s because of the human gene. You can just as easily get a false positive on a papaya with a high cycle threshold.

186780 Mark, replying to Mark, 41, #1259 of 2327 🔗

Health Secretary and Health minister denying basic reality in respect of herd immunity.

The equivalent of putting flat earthers in charge of a space program.

186790 ▶▶ Nick Rose, replying to Mark, 8, #1260 of 2327 🔗

The entire political class is out of touch. All laid bare to our gaze now.

186813 ▶▶▶ Ceriain, replying to Nick Rose, 5, #1261 of 2327 🔗

Joe Biden: “We choose truth over facts!”

186793 ▶▶ Julian, replying to Mark, 15, #1262 of 2327 🔗

We’re witnessing the death of science and the Age of Reason

Who knows if it will come back in any of our lifetimes

It will come back eventually because it delivers the goods

186799 ▶▶ PoshPanic, replying to Mark, 5, #1263 of 2327 🔗

Good analogy. It’s a culture war and science is on the frontline

186794 Lms23, replying to Lms23, 1, #1264 of 2327 🔗

Further to the comments about ten minutes ago regarding the OffGuardian ewarticle about the Cult of Covid (I’m tempted to spell “Cult” slightly differently), here’s Dave Cullen from Ireland, talking about the same thing:

https://m.youtube.com/watch?v=2gkUJk4dvaM
This is a Spiritual Battle

It’s an hour long video, and I haven’t yet watched it all.

Another video on the Global Reset:
https://m.youtube.com/watch?v=tInLlsPdZO0
The Great Reset and The Man Behind the Curtain

https://joebiden.com/build-back-better/#
BUILD BACK BETTER: JOE BIDEN’S JOBS AND ECONOMIC RECOVERY PLAN FOR WORKING FAMILIES

“As the world begins planning for a post-pandemic recovery, the United Nations is calling on Governments to seize the opportunity to “build back better” by creating more sustainable, resilient and inclusive societies.

“The current crisis is an unprecedented wake-up call,” said Secretary-General António Guterres in his International Mother Earth Day message. “We need to turn the recovery into a real opportunity to do things right for the future.”
https://mises.org/wire/build-back-better-why-are-both-biden-and-boris-now-using-phrase

186814 ▶▶ Dan Clarke, replying to Lms23, #1265 of 2327 🔗

The WEF has been using Building Back Better for a long time

186817 ▶▶▶ Jonathan Palmer, replying to Dan Clarke, 2, #1266 of 2327 🔗

They are confident enough to step out behind the curtain now

186905 ▶▶▶▶ Nick Rose, replying to Jonathan Palmer, 1, #1267 of 2327 🔗

Let them. Analysis of what they propose will expose all the weaknesses of their argument.

186872 ▶▶ Fiat, replying to Lms23, 2, #1268 of 2327 🔗

Spocks Beard:

I’m the man behind the curtain
The one who pulls the strings
Got my finger on the button
But my mind’s on other things
I’m the most impressive person
No one’s ever really seen, oh
In the shadow of the spotlight
Always waiting in the wings
I’m ready for my close up
When the fat lady sings
I don’t know if you can hear me
But you’d better hear me out
I manipulate the matrix
I know how it all turns out
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
And I know how it all turns out
My little white lies
Are all getting colored in
My impromptu alibis
Well, they’re wearing mighty thin
Though you don’t walk away with anything
You didn’t carry in
I deliver dispensation
For most any random sin
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
And I know how it all turns out
And when the curtain gets pulled away
Guess there’s always a piper to pay
You caught me out
In my base deception
I was only trying to make
The wrong impression
On the punters, punks and drunkards
That fortune floats my way
And the curtain gets pulled away
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
I know how it all turns out
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
I know how it all turns out
The man, the man, the man, the man, the man
I know how it all turns out
And when the curtain finally comes down
The puppets all slump to the ground
The doves lie silent in their covered cages
And though the mezzanines are still echoing
With the rock of ages
The circus has moved on to another town
And the curtain finally comes down…

186796 Fingerache Philip., replying to Fingerache Philip., 6, #1269 of 2327 🔗

I believe that the plague was more or less finally eradicated by the great fire of London, but I don’t want to give this rabble any ideas.

186828 ▶▶ Laura Suckling, replying to Fingerache Philip., 3, #1270 of 2327 🔗

At this point I’d almost welcome it. At least it would be a fairly swift end rather than death of a thousand lockdowns.

186849 ▶▶▶ Fingerache Philip., replying to Laura Suckling, 3, #1271 of 2327 🔗

Hopefully the new fire will start in the houses of parliament.

186868 ▶▶▶▶ chaos, replying to Fingerache Philip., 2, #1272 of 2327 🔗

Kids are now taught that Guido Fawkes was likely set up by protestants close to the king. It was essentially an inside job. He was a lamb to slaughter. A plot to frame the catholics… a bit like Hitler setting fire to the Reichstag and blaming it on the Ruskies so he could then poke the bear. Or America pretending not to know about the impending attack on Pearl Harbor.

186882 ▶▶▶▶▶ Fingerache Philip., replying to chaos, #1273 of 2327 🔗

Do you mean to say that the Armada wasn’t Spanish?,

186901 ▶▶▶▶▶▶ Nick Rose, replying to Fingerache Philip., #1274 of 2327 🔗

Oh no! The spymaster was probably called “Gates” or “Schwab”.

187070 ▶▶▶▶▶ matt, replying to chaos, #1275 of 2327 🔗

“Kids are now taught…” is not a good way to begin anything

187528 ▶▶▶▶▶▶ chaos, replying to matt, #1276 of 2327 🔗

Pompous tit. History books now suggest…

186859 ▶▶ chaos, replying to Fingerache Philip., 2, #1277 of 2327 🔗
  • The Great Fire only burnt about a quarter of the urban metropolis so it could not have purged the plague from the whole city.
  • Though the outside walls of houses rebuilt after the fire had to be built from brick, there were no major improvements to hygiene and sanitation afterwards.
  • Many of the areas that were worst affected by the plague, such as Whitechapel, Clerkenwell and Southwark, were not destroyed by the fire.
  • The numbers of people dying from plague were already in decline from the winter of 1665 onwards.
  • People continued to die from plague in London after the Great Fire was over.

https://www.museumoflondon.org.uk/discover/three-myths-you-believe-about-great-fire-london

186886 ▶▶▶ Fingerache Philip., replying to chaos, #1278 of 2327 🔗

Thank you.

186864 ▶▶ Nick Rose, replying to Fingerache Philip., 8, #1279 of 2327 🔗

The Great Fire of the Palace of Westminster might end Corona. Especially if all the MPs and Lords are locked inside when it happens.

186819 Barney McGrew, replying to Barney McGrew, 7, #1281 of 2327 🔗

Hancock slagging off the GB Declaration reminds me of Brexit and John Bercow. Bercow wasn’t supposed to take sides, but towards the end he knew that we knew he was partisan, and so he was happy to reveal his biases on Twitter, in interviews and even in the Commons (he even joked about it). The whole Commons knew the situation, so his supposed neutrality was just a pantomime. He was set up as the enabler for one set of MPs and the enemy of another.

I am pretty sure that Hancock is not supposed to take sides on this issue, either. But in his statements, he has done so. He has closed off the possibility of our government pretending to having an open mind on the matter. It is now impossible for them to change track. The government is now the affirmed enemy of one set of MPs (and people) and the friend of another. Everyone knows the situation, now, but a charade of “following the science” will be maintained, anyway.

186826 ▶▶ Julian, replying to Barney McGrew, 10, #1282 of 2327 🔗

There’s no wiggle room for Hancock at least, and probably not for Johnson. They are not going to change tack, so if things are to improve it will need them to be ousted by a Tory backbench revolt. That’s the only plausible scenario. Labour will not help us.

186862 ▶▶ RickH, replying to Barney McGrew, #1283 of 2327 🔗

Give the Breckshit a rest.

186883 ▶▶▶ mjr, replying to RickH, 7, #1284 of 2327 🔗

its a valid comparison . just because you dont like Brexit doesnt mean that it is wrong to mention it in context .

186887 ▶▶▶ Barney McGrew, replying to RickH, -4, #1285 of 2327 🔗

F*** off you c**t.

186820 Dale, replying to Dale, #1286 of 2327 🔗

Is it possible that Brits believe pollsters are tapping their phones ?

186844 ▶▶ chaos, replying to Dale, 2, #1287 of 2327 🔗

Polls are manipulated by many actors.. he who pays the piper and/or sets up enough accounts. Polls like mainstream media herd opinion. Hence why they are wrong about Trump, Brexit.. etc.

186929 ▶▶ Two-Six, replying to Dale, 2, #1288 of 2327 🔗

Actually making a cold call for a “pole” or “Survey” is a standard tatic of just about any investigative agency, eg benefit fraud people, the cops, the job centre private investigators.

They pretend that they are doing market research and ask a few questions about posh cars and holiday arrangements your shopping habits then they ask you about your living arrangements and try to see if, for example you could be co-habiting and claiming benefit illegally.

I guess a lot of the people now might be quite reticent about answering questions put to them by a stranger but the ones that aren’t are going to be almost certainly in the cult of covid and will hapilly answers questions put to them by somebody doing a survey

186822 Fingerache Philip., replying to Fingerache Philip., 2, #1290 of 2327 🔗

End of TV weather forecast:” Getting wetter and windier”
No, I must have got that wrong, it’s got to be about the government.

186824 ▶▶ stefarm, replying to Fingerache Philip., 3, #1291 of 2327 🔗

Letting it rip!!!

186829 Dan Clarke, replying to Dan Clarke, 6, #1292 of 2327 🔗

Another parliamentary debate about Contact Tracing, we hadnt even heard about it this time last year now they are yacking on as if our lives depend on it. The whole of Parliament has lost the plot

186852 ▶▶ Telpin, replying to Dan Clarke, 4, #1293 of 2327 🔗

I’m almost praying for the whole system to be hacked

186833 Crazy Times, replying to Crazy Times, 17, #1294 of 2327 🔗

TBF to Sky, Anneliese Dodds is getting a bit of shit over how this plan of another lockdown will actually play out, the cost and impact. Is the illusion finally starting to break for some of the news presenters as well? It might be wishful thinking, but I’m starting to slightly pick up that more people by the day are feeling a need to question this lunacy.

186847 ▶▶ Telpin, replying to Crazy Times, 3, #1295 of 2327 🔗

I wish it to be true. Mark Dolan is the strongest ally

186851 ▶▶ Nick Rose, replying to Crazy Times, 6, #1296 of 2327 🔗

Hope so. Once the news editors are on side, it’s game over.

186857 ▶▶▶ Crazy Times, replying to Nick Rose, 7, #1297 of 2327 🔗

I’ve been thinking the last week or so, eventually some of them have to start breaking. They have kids and families this is affecting as well. They must be looking at Christmas and thinking what about those great piss ups and dinners we had every year on the company expenses, guess we won’t be having those this year…

186870 ▶▶▶▶ CGL, replying to Crazy Times, 3, #1298 of 2327 🔗

There won’t be any venues left for them to go to anyway.

186898 ▶▶▶▶ Nick Rose, replying to Crazy Times, 3, #1299 of 2327 🔗

Exactly. And when they bother to actually look at the numbers (assuming they haven’t already), they’ll realise. Those who look at the numbers always realise…

186834 Nick Rose, replying to Nick Rose, 22, #1300 of 2327 🔗

Latest tweet:

@BorisJohnson
@MattHancock

You tried lockdown. Didn’t work.
You tried masks. They haven’t worked.
You’re trying curfews and traffic lights. Looks like they’re not working.
Two options left, boys.
Let it rip.
Herd immunity.
Your call.
#KBF #ENDLOCKDOWNNOW

186894 ▶▶ annie, replying to Nick Rose, 10, #1301 of 2327 🔗

There is only one option as far as the Corona Cretins are concerned.
More lockdown.
If it doesn’t work, it’s because naughty human beings are not following the rules. The world must be made safe for zombies by eliminating human beings.

They can try.

186895 ▶▶▶ Nick Rose, replying to annie, 2, #1302 of 2327 🔗

Guaranteed to fail. But then, I don’t need to tell you that :o))

186841 Ned of the Hills, replying to Ned of the Hills, 25, #1303 of 2327 🔗

This morn as I walked in to town along a suburban street which completely empty save for an elderly woman, masked up, walking stick in hand and walking her dog. As I approach she steadies herself, turns sideways and sticks her head in the hedge (well, she presses her forehead on the privet) she almost flinches because another human has come so close to her.

But eh, the dog has to be walked! People are prepared to risk a lot for their pets.

186846 ▶▶ Nick Rose, replying to Ned of the Hills, 3, #1304 of 2327 🔗

It’s a dangerous world out there…

186850 ▶▶ nocheesegromit, replying to Ned of the Hills, 3, #1305 of 2327 🔗

I thought you were going to say the dog was wearing a mask!!!

186855 ▶▶▶ Fingerache Philip., replying to nocheesegromit, 1, #1306 of 2327 🔗

I’m sure it’s not unknown.
Business opportunity for someone.
Sod it, the Chinese have got there first.

187012 ▶▶▶ Will, replying to nocheesegromit, 1, #1307 of 2327 🔗

Don’t give any of these idiots any ideas.

186896 ▶▶ chaos, replying to Ned of the Hills, -8, #1308 of 2327 🔗

Hopefully she’ll be mugged by some fellas.

186903 ▶▶▶ Fingerache Philip., replying to chaos, 1, #1309 of 2327 🔗

The old lady or the dog?

186914 ▶▶▶ Two-Six, replying to chaos, 3, #1310 of 2327 🔗

for goodness sake. What a stupid thing to say.

186934 ▶▶▶▶ chaos, replying to Two-Six, 2, #1311 of 2327 🔗

or eaten by a pitbull.

187222 ▶▶▶ Draper233, replying to chaos, #1312 of 2327 🔗

She won’t mind, providing they’re masked up of course

187221 ▶▶ Cheezilla, replying to Ned of the Hills, #1313 of 2327 🔗

That’s very sad! Poor old brainwashed thing.

186843 Fingerache Philip., 41, #1314 of 2327 🔗

Keep hearing how “everyone is suffering from the effects of Covid”
No, we are suffering from the effects of the government.

186845 Darryl, replying to Darryl, 14, #1315 of 2327 🔗

I have been told that in London mosques, leaders are now heavily pushing the government Covid narrative / advice. I wonder if the same is happening with any other religions? Could the government be offering financial incentives? we know they are paying social media influencers and celebrities so it wouldn’t surprise me. Every part of society sadly seems to be easily influenced with a government bribe.

186920 ▶▶ annie, replying to Darryl, 15, #1316 of 2327 🔗

Our Anglican rector, archdeacon and bishop are all total yammering zombies. But cowardice, stupidity and a total lack of faith in God, Jesus Christ, and the Holy Spirit seem to account quite adequately for their shameful conduct.

187024 ▶▶ BeBopRockSteady, replying to Darryl, 5, #1317 of 2327 🔗

Bill Gates was interviewed recently and was asked how they push a vaccine in sceptical communities. He directly referenced the tactic of speaking to religious leaders and getting them to publically vaccinate their family and declare support. Its standard.

187218 ▶▶▶ Cheezilla, replying to BeBopRockSteady, 2, #1318 of 2327 🔗

It’s disgusting! But organised religion has always been about power and control.
JC pointed that out and the priests had him bumped off!

187225 ▶▶▶▶ Darryl, replying to Cheezilla, 1, #1319 of 2327 🔗

I certainly don’t think they should be telling people what to do and believe in relation to Covid 19. They don’t quite get it, the ‘Great Reset’ is replacing religion with the State and Identity politics.

187219 ▶▶▶ Darryl, replying to BeBopRockSteady, #1320 of 2327 🔗

Not sure the religious leaders know what is in the vaccines, could be against their religions.

Vaccines and porcine gelatine – GOV.UK https://external-content.duckduckgo.com/ip3/www.gov.uk.ico https://www.gov.uk/government/publications/vaccines-and-porcine-gelatine
The issue of some vaccines that contain ingredients derived from pigs (in this case gelatine – known as ‘porcine’ gelatine) has concerned some faith groups. This leaflet provides information about…

186858 Dan Clarke, replying to Dan Clarke, 1, #1321 of 2327 🔗

So, contact tracing still seems counter productive to getting the country back to normal. Don’t think the people in parliament banging on about it understand that.

186885 ▶▶ Nic, replying to Dan Clarke, 9, #1322 of 2327 🔗

It will never work millions in this country dont officially exist

186982 ▶▶▶ SweetBabyCheeses, replying to Nic, 3, #1323 of 2327 🔗

I am also optimistic that part of the reason it’s so poor is because a lot of people are sabotaging it by deliberately giving fake details.

187005 ▶▶▶▶ Will, replying to SweetBabyCheeses, 2, #1324 of 2327 🔗

Perish the thought Donald Duck…

187026 ▶▶▶▶ Nick Rose, replying to SweetBabyCheeses, 1, #1325 of 2327 🔗

Really?
Signed RJ Bingham

186995 ▶▶ Schrodinger, replying to Dan Clarke, 1, #1326 of 2327 🔗

Yardley Yeadon points out how pointless it is

https://threadreaderapp.com/thread/1316349182211481600.html

187001 ▶▶ Will, replying to wendyk, #1328 of 2327 🔗

Starmer looks like a greasy spicy.

187151 ▶▶▶ Will, replying to Will, #1329 of 2327 🔗

Spiv

186869 Alice, replying to Alice, 12, #1330 of 2327 🔗

COURT 2
COURT 28- OVERSPILL
Before MR JUSTICE SWIFT
Thursday 15 October, 2020
At  half past 10
APPLICATION(s)
CO/3546/2020The Queen on the application of Dolan v Secretary Of State For Health And Social Care

Anyone going there to show support?

186871 ▶▶ captainbeefheart, replying to Alice, 7, #1331 of 2327 🔗

Is that a made up Judges name?

Swift justice is what is needed, but I doubt that’s what we’ll get!

186876 ▶▶▶▶ captainbeefheart, replying to Alice, #1333 of 2327 🔗

Thanks! 🙂

186878 ▶▶▶ CGL, replying to captainbeefheart, 1, #1334 of 2327 🔗

He was born to the role!

186880 ▶▶▶▶ captainbeefheart, replying to CGL, #1335 of 2327 🔗

Probably goes to the same grand lodge as the defendant

187206 ▶▶▶ Nobody2020, replying to captainbeefheart, #1336 of 2327 🔗

It’ll only be Swift, Justice on his library card

186879 ▶▶ anon, replying to Alice, 2, #1337 of 2327 🔗

MR JUSTICE SWIFT

for real?

there must be a 33 in there

186900 ▶▶▶ Fingerache Philip., replying to anon, 3, #1338 of 2327 🔗

There used to be a Cardinal Sin.

186924 ▶▶▶▶ Tim Bidie, replying to Fingerache Philip., 1, #1339 of 2327 🔗

When I used to ring up my Bank Manager, he would answer, loudly, with his surname:

‘Money!’

His first name was ‘Nick’

186897 ▶▶ Richard O, replying to Alice, 3, #1340 of 2327 🔗

It won’t take him long to deliver his only statement: “Case dismissed”.

186904 ▶▶▶ Alice, replying to Richard O, #1341 of 2327 🔗

So do you think it would be pointless to turn up outside the court to show support for Simon?

186909 ▶▶▶▶ Richard O, replying to Alice, 2, #1342 of 2327 🔗

On the contrary, I am merely pointing out that the machinations of the legal system are not going to help us. Just as has already happened with the political system.

186921 ▶▶▶▶▶ Alice, replying to Richard O, 4, #1343 of 2327 🔗

I can see that it doesn’t really matter in the grand scheme of things if one person (or several people) turn up outside the court – it’s not likely to change things. On the other hand, my conscience tells me that I should be there.

186931 ▶▶▶▶▶▶ Richard O, replying to Alice, 2, #1344 of 2327 🔗

Definitely follow your conscience. It’s your best weapon.

187000 ▶▶▶▶▶▶ Will, replying to Alice, 1, #1345 of 2327 🔗

Good for you!!!

186910 ▶▶▶▶ Charlie Blue, replying to Alice, 1, #1346 of 2327 🔗

Perhaps it’s even more important to show support if you can in that case?

186873 Gladiatrix, replying to Gladiatrix, 28, #1347 of 2327 🔗

I have emailed Sunetra Gupta suggesting that she report Hancock to the Speaker for misleading the House.

186891 ▶▶ Jenny, replying to Gladiatrix, 7, #1348 of 2327 🔗

Good idea. I cannot believe he is getting away with some of the blatant lies he is coming out with.

186902 Sam Vimes, replying to Sam Vimes, 29, #1349 of 2327 🔗

Just a reminder that 450 cancer sufferers died today. Plus 5 people in road crashes. And about 1100 others. And it will be the same tomorrow…

186912 ▶▶ annie, replying to Sam Vimes, 14, #1350 of 2327 🔗

We care.
Zombies don’t.

186932 ▶▶ chaos, replying to Sam Vimes, 8, #1351 of 2327 🔗

Main cause of death in men under 30 is suicide and car accident.

186979 ▶▶ SweetBabyCheeses, replying to Sam Vimes, 10, #1352 of 2327 🔗

That’s just in the UK. Worldwide every day more than 800 children under five die from diarrhoea linked to a lack of clean water and poor sanitation. If we actually wanted to save lives then think what half a trillion would’ve done for them.

186906 l835, replying to l835, 5, #1353 of 2327 🔗

Drakeford said on PM that using the “English System” no areas in Wales would be Tier 2 or 3. So why are we still locked down… ?

187010 ▶▶ Nick Rose, replying to l835, 3, #1354 of 2327 🔗

Because he’s still a turtle’s head.

187194 ▶▶▶ annie, replying to Nick Rose, #1355 of 2327 🔗

Quackerduck.

187016 ▶▶ Cheezilla, replying to l835, #1356 of 2327 🔗

Because there isn’t a minus 2 tier

186908 Basics, replying to Basics, 6, #1357 of 2327 🔗
187233 ▶▶ bucky99, replying to Basics, #1358 of 2327 🔗

Surely Witless & Unbalanced deserve at least one between them?!

187516 ▶▶▶ chris c, replying to bucky99, #1359 of 2327 🔗

The Pair Of Bollocks

186915 Hopeful, replying to Hopeful, 15, #1360 of 2327 🔗

Watched UK Column today. The covid passports (Certificate of Vaccination ID) are here. No vaccination passport means no overseas travel. How long before it means can’t go outside your region? How long before it means can’t go outside period? I’ve been writing to my MP these past months and regardless of the specifics I write to him about, I get the same bland nonsense in response. He is such a wet. I won’t stop writing to him ‘cos he’s not getting off that easy. In my next letter I’m going to ask him what he’s doing to help the families of the 7 young men from around here who’ve recently killed themselves. I don’t know of one person who has died with/from covid let alone 7. This is what happens when politicians get mixed up with greedy bastards who want to own the world, everything and everyone. Think I might don some sandwich boards, parade round the town and see if I can wake some people up.

186917 ▶▶ Richard O, replying to Hopeful, 4, #1361 of 2327 🔗

No jab, no life.

187006 ▶▶▶ Nick Rose, replying to Richard O, #1362 of 2327 🔗

On the bright side, they can’t keep people out of the pubs, so the nonsense won’t last long if, indeed, it ever begins.

186945 ▶▶ Crazy Times, replying to Hopeful, #1363 of 2327 🔗

Rolling out in the NHS as well – https://beta.staffpassports.nhs.uk/

187003 ▶▶▶ Cheezilla, replying to Crazy Times, #1364 of 2327 🔗

We’ve put a small file called a cookie on your device to make our site work.

Partonising gits!

186956 ▶▶ Basics, replying to Hopeful, 2, #1365 of 2327 🔗

Scotsman headline tonight
‘Nicola Sturgeon: Scots need to think ‘very carefully’ about travel anywhere’

186973 ▶▶ Suzyv, replying to Hopeful, 4, #1366 of 2327 🔗

But there is no definite vaccine yet. What if there never is? Then what? Even if there is one it wont take long before some adverse reactions start. Sit back watch and wait. Then it will have to be pulled. So how can a certificate of vaccination work if there is no vaccine? Many countries are extremely dependent on tourist $s. Are they going to ban tourism forever losing out on those $s? I didnt watch the uk column today so maybe I’m missing something.

187011 ▶▶▶ Cheezilla, replying to Suzyv, #1367 of 2327 🔗

I don’t think the perpetrators are interested in tourism. There will be no hospitality left for tourists if they go anywhere anyway.

186981 ▶▶ Proudtobeapeasant, replying to Hopeful, #1368 of 2327 🔗

Have tried to find this but am not sure what it is you’re referring to. Could you give a link please?

186918 Cheshirecatslave, replying to Cheshirecatslave, 4, #1370 of 2327 🔗

A while ago someone asked was there any post mortem evidence about covid. I came across this article.
https://www.medscape.com/viewarticle/936155
It has a scary headline but one expert concludes “ “But if you isolate the emotional aspect of COVID-19 from the fact, it’s an infectious disease like other infectious diseases.”

187114 ▶▶ DJ Dod, replying to Cheshirecatslave, 2, #1372 of 2327 🔗

There has been post-mortem data from Germany in the public domain since April – Professor Klaus Pueschel, pathologist at the University Medical Centre in Hamburg went public with his conclusion that no-one he had examined had died of Covid-19 alone, i.e. all of the victims had co-morbidities.

186922 JHuntz, replying to JHuntz, 5, #1373 of 2327 🔗

https://www.youtube.com/watch?v=GeykREAlYSg&ab_channel=SkyNewsAustralia

How come this mob in Sky News Australia are actually providing journalism? Will Australia be the last bastion of freedom at the end of all this sh$t?

186947 ▶▶ Julian, replying to JHuntz, 3, #1374 of 2327 🔗

Fox in the US have been pretty good too. Both still owned by Rupert Murdoch, unlike Sky UK.

186964 ▶▶▶ Dave #KBF, replying to Julian, 1, #1375 of 2327 🔗

Who owns Sky UK now?

186977 ▶▶▶▶ Crazy Times, replying to Dave #KBF, 2, #1376 of 2327 🔗

Comcast

186952 ▶▶ Alice, replying to JHuntz, 1, #1377 of 2327 🔗

Just watched it – excellent, thank you!

186975 ▶▶ leggy, replying to JHuntz, 3, #1378 of 2327 🔗

Sky News (Australia!) has been an oasis of sanity in desert of media hysteria for some time now. Here’s another huge dose of common sense from today.

https://youtu.be/sMisSTjUiR8

186988 ▶▶ ianric, replying to JHuntz, 3, #1379 of 2327 🔗

The media in the UK has been pumping out fear porn on behalf of the government whilst Sky News Australia have pulled no punches in attacking their governments. Why can’t we have this in the UK.

186925 Nick Rose, replying to Nick Rose, 19, #1380 of 2327 🔗

https://twitter.com/LockdownNo/status/1316445542172495873

How are hospitals getting away with designating a tiny number of beds “covid beds” (say ten our of hundreds) then claiming to be full when the covid beds are occupied but the rest of the place is empty?

Why is this lie being allowed to go unchallenged?

186938 ▶▶ Dave #KBF, replying to Nick Rose, 9, #1381 of 2327 🔗

Mayor of Liverpool today said all icu beds at two Liverpool hospitals are full. Quietly said 8 beds

186942 ▶▶▶ Nick Rose, replying to Dave #KBF, 4, #1382 of 2327 🔗

I gave him a scolding on Twitter earlier…

186997 ▶▶▶▶ Cheezilla, replying to Nick Rose, #1383 of 2327 🔗

Pity you coudn’t give him something a lot more physical!

186927 Ceriain, replying to Ceriain, 4, #1384 of 2327 🔗

Telegraph live feed 16:41

A total of 647 patients with confirmed Covid-19 were admitted to
hospitals in England on Monday, compared with 472 a week earlier.

This is simply not true! (see my long post today for more details)

186937 ▶▶ leggy, replying to Ceriain, 4, #1385 of 2327 🔗

How many were admitted with something else and then had a positive test?

186943 ▶▶▶ Ceriain, replying to leggy, 2, #1386 of 2327 🔗

More than several, leggy. 🙁

186971 ▶▶▶ stefarm, replying to leggy, 1, #1387 of 2327 🔗

100%

186930 wendyk, replying to wendyk, 2, #1388 of 2327 🔗

https://www.thinkscotland.org/todays-thinking/articles.html?read_full=14292&article=www.thinkscotland.org

Another excellent article by Linda Holt- someone to follow for sceptics suffering from Dominatrix Fatigue.

Sturgeon has questions to answer and the faux sympathy dished out for the faithful is losing its pr polish.

Holt’s account reveals the Machiavellian machinations employed to maintain the cult’s narrative.

186970 ▶▶ stefarm, replying to wendyk, 1, #1389 of 2327 🔗

The woman is a fucking loon

187191 ▶▶ annie, replying to wendyk, 1, #1390 of 2327 🔗

Scots that can think???
Gosh.

187209 ▶▶▶ John P, replying to annie, 1, #1391 of 2327 🔗

What’s this Scottophobia madam? We are some of us known for our thinking capabilities.

Admittedly, Ms Sturgeon has taken complete leave of her senses, but we have a great many fine examples. See here!

https://en.wikipedia.org/wiki/Scottish_inventions_and_discoveries

186940 ▶▶ Ceriain, replying to wendyk, #1393 of 2327 🔗

O/T. Woman driving that mini, in the picture shown, is going to have nasty accident turning right like that.

186991 ▶▶▶ Cheezilla, replying to Ceriain, #1394 of 2327 🔗

It’s a man – in a tie.

187242 ▶▶▶▶ Ceriain, replying to Cheezilla, 1, #1395 of 2327 🔗

Good spot! I should have made the pic bigger.

Apologies to lady drivers everywhere. 😉

187020 ▶▶▶ OKUK, replying to Ceriain, #1396 of 2327 🔗

Yes especially while looking at a pub sign.

187015 ▶▶ Lisa from Toronto, replying to chaos, 4, #1398 of 2327 🔗

Not a conspiracy theory — it’s all out in the open. These bastards are proud of it and the masses will eat it up.

186953 Ceriain, replying to Ceriain, 9, #1399 of 2327 🔗

DT – breaking news

French President Emmanuel Macron said on Wednesday that nightly curfews will be imposed in Paris and other major cities to try to curb the spread of the Covid-19 epidemic as a state of emergency is

reimposed.

The curfews will take effect from Saturday, and will run daily from 9:00pm until 6:00am the following morning, Macron said in an interview broadcast on national television.

It begins! We’re next. 🙁

186960 ▶▶ Richard O, replying to Ceriain, 6, #1400 of 2327 🔗

Curfew, yet another term to condition the population into accepting their servitude.

Once imposed, it will never be lifted. Not even after the vaccine.

186974 ▶▶▶ Cheezilla, replying to Richard O, 4, #1401 of 2327 🔗

It’s already been hinted that people who leave level 3 zones for work will soon have to return home by a certain time each evening.

That will be interesting for long-distance drivers, kitchen fitters, electricians etc etc.

But everyone’s working from home now, so it shouldn’t be a problem!

186983 ▶▶▶▶ Richard O, replying to Cheezilla, 4, #1402 of 2327 🔗

If this goes all the way we will require explicit state authorisation to leave our place of abode for any reason whatsoever.

186987 ▶▶▶▶▶ calchas, replying to Richard O, 3, #1403 of 2327 🔗

To be honest – the way this is going I don’t think I’ll want to leave anyway.

186992 ▶▶▶▶▶▶ Richard O, replying to calchas, #1404 of 2327 🔗

Me neither. And I haven’t, except to go outside for a cigarette, for 3 months straight.

187105 ▶▶▶▶▶▶▶ Two-Six, replying to Richard O, #1405 of 2327 🔗

You REALLY should get out more.

186990 ▶▶▶▶▶ Cheezilla, replying to Richard O, #1406 of 2327 🔗

Isn’t that the plan?

186996 ▶▶▶▶▶▶ Richard O, replying to Cheezilla, 1, #1407 of 2327 🔗

I believe it is.

187089 ▶▶▶▶▶▶▶ Alethea, replying to Richard O, 4, #1408 of 2327 🔗

I keep going out. I go to all the places I care about and like to visit. I spend most of my weekend going out into the world to enjoy it. Christ, it is hard going. I am constantly challenged about not wearing a mask. And I find the absence of other people with faces extremely wearing and upsetting. I will never give up, but representing normality and sanity is a major labour.

187092 ▶▶▶▶▶▶▶▶ Richard O, replying to Alethea, 2, #1409 of 2327 🔗

You have a far greater tolerance level for the degraded humans currently dominating our culture than I ever will.

187111 ▶▶▶▶▶▶▶▶▶ Alethea, replying to Richard O, 3, #1410 of 2327 🔗

Thanks for responding, Richard O. I am very on my own in the current version of the world.

187186 ▶▶▶▶▶▶▶▶▶▶ Richard O, replying to Alethea, 2, #1411 of 2327 🔗

Everyone on here is with you. This is one of the greatest accomplishments of the regulations. The destruction of freedom of association.

187181 ▶▶▶▶▶▶▶▶▶ annie, replying to Richard O, #1412 of 2327 🔗

Humans?

187183 ▶▶▶▶▶▶▶▶▶▶ Richard O, replying to annie, #1413 of 2327 🔗

NPCs that look like humans.

187150 ▶▶▶▶▶▶▶▶ DRW, replying to Alethea, 1, #1414 of 2327 🔗

Good for you, I’ve mainly gone recluse these days.

187201 ▶▶▶▶▶▶▶▶ Cheezilla, replying to Alethea, #1415 of 2327 🔗

Kudos for your efforts!

187073 ▶▶▶ JohnB, replying to Richard O, #1416 of 2327 🔗

Once imposed, it will never be lifted.

Unless we insist.

187018 ▶▶ OKUK, replying to Ceriain, 2, #1417 of 2327 🔗

Macron – Globalist par excellence, chief of the Lockdown Lunatics, the man who forced Johnson to abandon the herd immunity strategy by threatening to close the Channel .

186954 mattghg, replying to mattghg, 9, #1418 of 2327 🔗

Latest message from Oxfordshire County Council on the A40 traffic announcement board:

“DO YOUR PART

DOWNLOAD THE NHS COVID 19 APP”

To quote Dr. Evil: “How about no?!”

186958 ▶▶ Basics, replying to mattghg, 5, #1419 of 2327 🔗

Hasn’t every person passing under that been doing their part for the past6 months – do your part is getting old. It is also offensive to some who have lost throughout this scam.

186961 ▶▶▶ Dave #KBF, replying to Basics, 3, #1420 of 2327 🔗

They do not seem to be using “ we are all in this together ” anymore.

186989 ▶▶▶▶ Cheezilla, replying to Dave #KBF, #1421 of 2327 🔗

Not even in an ironic way?

186962 ▶▶ Richard O, replying to mattghg, 3, #1422 of 2327 🔗

DO YOUR PART (TO ENSLAVE YOURSELVES).

186965 ▶▶ Proudtobeapeasant, replying to mattghg, 7, #1423 of 2327 🔗

Some months ago I was going to upgrade (ha ha….) my 11 year old Nokia phone to my husband’s retired smartphone. However he couldn’t get it sorted out for me to use, and since the virus came along I have decided it’s much better that it stays in whatever drawer I put it in. I think a smartphone is the last thing I want nowadays….

187067 ▶▶ OKUK, replying to mattghg, #1424 of 2327 🔗

Zip it!

187373 ▶▶▶ mattghg, replying to OKUK, #1425 of 2327 🔗

Eh?

186963 Dave #KBF, replying to Dave #KBF, #1426 of 2327 🔗

Looks like Greater Manchester & Lancashire are being put into level 3 tomorrow.

186986 ▶▶ Cheezilla, replying to Dave #KBF, 1, #1427 of 2327 🔗

Poor sods!
I’d better check.
They often put us the wrong side of the Pennines!

186998 ▶▶ CapLlam, replying to Dave #KBF, 6, #1428 of 2327 🔗

we haven’t even had tier two restrictions for a day and they are changing it already!

I’m in a seaside town in Lancashire which is next to a city with a uni. Most of the “cases”are from the uni and the city but our town hasn’t got many “cases” at all and we are getting lumped in with them.

Well time to be a rebel and ignore the new rules again

187050 ▶▶▶ SweetBabyCheeses, replying to CapLlam, 3, #1429 of 2327 🔗

I think it’s more important to be outraged at all lockdowns, not just the ones on your doorstep.

187083 ▶▶▶▶ Cheezilla, replying to SweetBabyCheeses, 1, #1430 of 2327 🔗

Agreed – but some mockdowns are more outrageous than others!

187087 ▶▶▶▶▶ Tom Blackburn, replying to Cheezilla, #1431 of 2327 🔗

It’s the cockle pickers you need to watch out for.

187175 ▶▶▶▶▶ CapLlam, replying to Cheezilla, #1432 of 2327 🔗

Love calling it a mockdown! It’s all about control with the government and the local councils.

187169 ▶▶▶▶ CapLlam, replying to SweetBabyCheeses, #1433 of 2327 🔗

I am outraged at putting any lockdown in place, it’s a virus not the plague!

Thankfully most my friends are sceptics as well

186984 leggy, replying to leggy, 1, #1434 of 2327 🔗

What does the panel make of this in the Mail today? Comments are overwhelmingly pro-sceptic, but I guess those of that persuasion would be drawn to comment on the article.

https://www.dailymail.co.uk/news/article-8837153/One-four-Britons-believe-Covid-19-developed-Chinese-lab.html

187042 ▶▶ SweetBabyCheeses, replying to leggy, #1435 of 2327 🔗

It does sound like a classic conspiracy theory but China is a massive place and what are the chances that the market at the centre of the initial outbreak is just 23km from the lab that experiments with corona viruses?
Plus I heard that the lab just stole the blueprints for a virology lab from France(?) to build theirs but didn’t bother with the proper foundations/drainage/filtration that you need.

187066 ▶▶▶ OKUK, replying to SweetBabyCheeses, #1436 of 2327 🔗

They’ve also been implicated in smuggling of pathogen samples from the West to China (PLA operatives posing as scientists to gain access). A fact that even BBC Reality Check cannot vapourise.

187080 ▶▶ Cheezilla, replying to leggy, #1437 of 2327 🔗

I understood it started in a US lab and was sent to be worked on in the Wuhan lab by Fauci.

187144 ▶▶ JME, replying to leggy, 1, #1438 of 2327 🔗

If it hasn’t happened already, China now knows how to take over the world- just release a new virus every year & scare everyone s**tless!

187198 ▶▶▶ Cheezilla, replying to JME, #1439 of 2327 🔗

Uncle Bill already has that in hand:

https://www.youtube.com/watch?v=q-aY-h59Gx8

187268 ▶▶▶▶ JME, replying to Cheezilla, #1440 of 2327 🔗

Yup! Looks like you’re right!

186985 Hannahbanana, replying to Hannahbanana, 7, #1441 of 2327 🔗

A crowdfunder to help bring a case against the closure of gyms is very close to its target – if anyone can help or wants to read more here’s the link and a snippet.

https://gf.me/u/y4qdig

UKActive published this study – https://www.ukactive.com/news/fitness-and-leisure-sector-reports-covid-rate-of-0-34-per-100000-visits-since-reopening-in-england/

• 22,000,000 (22 million) gym visits resulted in a mere 78 Covid cases

• Uk gyms showing just 0.35 cases per 100,000 visits

Then we have the latest (unpublished study) since the increase in positive tests https://www.bbc.co.uk/news/uk-england-derbyshire-54464470

• Gyms are still only showing 1.7% percent of cases, but they want to close us and keep restaurants open which have a higher rate of 9.6% cases, which is still CRAZY LOW so these should also stay open.

Mental health – the gym helps so many people with their mental health daily.

• Male suicide is now at an all time high – https://www.bmj.com/content/370/bmj.m3431

187019 ▶▶ nocheesegromit, replying to Hannahbanana, 1, #1442 of 2327 🔗

Just donated a fiver – the least I can do for these people.

187021 ▶▶ ConstantBees, replying to Hannahbanana, 1, #1443 of 2327 🔗

Thanks for sharing this. Just chipped in a fiver. The initial goal is £10,000 and they’re almost there in one day.

187077 ▶▶▶ Cheezilla, replying to ConstantBees, 1, #1444 of 2327 🔗

£11,000+ now

187093 ▶▶▶▶ JohnB, replying to Cheezilla, 1, #1445 of 2327 🔗

£1K from a Charlie Mardon.

187062 ▶▶ JohnB, replying to Hannahbanana, 1, #1446 of 2327 🔗

Donated – managed to add MabelCow’s latest picture to my comment. 🙂

187071 ▶▶ Cheezilla, replying to Hannahbanana, #1447 of 2327 🔗

The figures are for last year. After this year, they will be off the charts!

186994 GiftWrappedKittyCat, replying to GiftWrappedKittyCat, 7, #1448 of 2327 🔗

I’ve just seen that an independent shop I used to visit a lot back when life was normal have installed a fogging machine which emits a fine antibacterial mist to disinfect all surfaces in the shop. Surely to god that can’t be healthy for the staff who have to work there all day?? Don’t think I’ll be back now or order anything online as I don’t want it covered in gunk. Has anyone else come across such a machine?

187014 ▶▶ Edward, replying to GiftWrappedKittyCat, 8, #1449 of 2327 🔗

Sounds like something that needs a very thorough risk assessment, which I expect it hasn’t had.

187027 ▶▶ SweetBabyCheeses, replying to GiftWrappedKittyCat, 2, #1450 of 2327 🔗

There’s one at my previous gym (which I left due to bonkers rules). It does make the floor and surfaces slippery and they’re ruining all their kit that’s going rusty and rubber and plastic is perishing. Spent the first couple of mins of my workout wiping it off everything.

187037 ▶▶▶ GiftWrappedKittyCat, replying to SweetBabyCheeses, 3, #1451 of 2327 🔗

That’s got all the makings of a law suit when someone slips and breaks their neck.
The shop I’m referring to sells dressmaking and soft furnishing fabrics so I definitely don’t want anything from there now as it will be ruined by the stuff they’re spraying. Honestly, I think some of them actually want to go out of business.

187063 ▶▶▶▶ Cheezilla, replying to GiftWrappedKittyCat, 1, #1452 of 2327 🔗

It will either make the fabric go mouldy or, if it inhibits mould growth, will make the shop staff ill.

187033 ▶▶ leggy, replying to GiftWrappedKittyCat, 1, #1453 of 2327 🔗

The school Mrs leggy works at have one – her and the other staff read the warnings on the packaging of the chemicals they were supposed to spray around. Nothing good. They decided not to use it, but they have a special “ofsted” inspection coming and no doubt they’ll be pulled up on it.

187057 ▶▶▶ Cheezilla, replying to leggy, 1, #1454 of 2327 🔗

They should make it mobile and have it pointed at the ofsted inspector all the time.

187069 ▶▶▶ GiftWrappedKittyCat, replying to leggy, 2, #1455 of 2327 🔗

I’m glad the school staff saw sense and I really hope Ofsted don’t pull them up on it. If it is enforced then I hope a parent sues the arse off them when a child has a severe allergic reaction. Given that schools these days can’t even administer Calpol without a risk assessment it shows how bonkers things are that they expect children and staff to breath in toxic chemicals all day.

187097 ▶▶▶ Steve, replying to leggy, 6, #1456 of 2327 🔗

Tell them it didn’t pass the risk assessment and so couldn’t be safely used.

187079 ▶▶ Tom Blackburn, replying to GiftWrappedKittyCat, #1457 of 2327 🔗

We went to Greece last month and the easyJet flights both ways had them. Wasn’t a problem. Looked a bit funky.

187143 ▶▶ annie, replying to GiftWrappedKittyCat, 2, #1458 of 2327 🔗

A colleague at work used to have on on his desk. Only water vapour as far as ai know.
Antibacterial spray is really going to whack that virus, ain’t it?

187267 ▶▶ GiftWrappedKittyCat, replying to GiftWrappedKittyCat, #1459 of 2327 🔗

I’ve left a comment on the shop’s Instagram page asking about the risk to staff and customers from breathing in chemicals and also about residue spoiling the fabric. I’ll let you know if I get a reasonable response or shot down in flames for challenging their ‘Covid secure’ bollocks.

186999 Mabel Cow, replying to Mabel Cow, 29, #1460 of 2327 🔗

Here’s a more playful version of my discriminatory-challenges document. Put in on a t-shirt and do away with the hassle of saying, “I’m exempt”.

187002 ▶▶ BeBopRockSteady, replying to Mabel Cow, 2, #1461 of 2327 🔗

The best yet

187195 ▶▶▶ PatrickF, replying to BeBopRockSteady, #1462 of 2327 🔗

Say “mask” again. I dare you. I double dare you!

187008 ▶▶ OKUK, replying to Mabel Cow, 1, #1463 of 2327 🔗

Wow! That sends a message!!

187009 ▶▶ Lisa from Toronto, replying to Mabel Cow, 1, #1464 of 2327 🔗

Love it!

187031 ▶▶ JohnB, replying to Mabel Cow, 1, #1465 of 2327 🔗

Brilliant !

187036 ▶▶ nocheesegromit, replying to Mabel Cow, 1, #1466 of 2327 🔗

Brilliant!

187048 ▶▶ Cheezilla, replying to Mabel Cow, 1, #1467 of 2327 🔗

I love it!

187061 ▶▶ Ned of the Hills, replying to Mabel Cow, #1468 of 2327 🔗

Very funny!

187078 ▶▶ Alethea, replying to Mabel Cow, 2, #1469 of 2327 🔗

Oh God, I wish you would come to the supermarket with me.

187932 ▶▶▶ Mabel Cow, replying to Alethea, #1470 of 2327 🔗

…and I wish Jules Winnfield would accompany me. 🙂

187007 Stuart, replying to Stuart, 5, #1471 of 2327 🔗

I really look forward to the Bill Gates “second generation super vaccine”. Lockdown until then of course so let’s hope it works on skeletal remains.

187030 ▶▶ Crazy Times, replying to Stuart, 2, #1472 of 2327 🔗

The second isn’t going to be up to much either, and I hear the 3rd generation is only going be at most 50% effective, though it will have much better tolerability and safety characteristics. The fourth generation though, should, all going well, be much more effective (55%+).

187044 ▶▶▶ Cheezilla, replying to Crazy Times, #1473 of 2327 🔗

That should be hilarious but it isn’t funny under the circumstances.

187023 PastImperfect, replying to PastImperfect, 4, #1474 of 2327 🔗

Ahem … Quite by accident I just came across the following:

In an impassioned speech before the United Nations General Assembly on 24 September 2019, UK Prime Minister Boris Johnson stated that digital authoritarianism is not the stuff of dystopian fantasy but of an emerging reality. He described the Internet of Things, “smart” cities and AI as a giant, dark thundercloud lowering ever more oppressively over the human race , a gathering force reshaping the future of humanity over which the human race has no control and from which, in future, there may be nowhere to hide.

He asked if algorithms could be trusted with our lives and hopes and whether machines should be allowed to doom us to a cold and heartless future in an Orwellian world designed for censorship, repression and control. He recalled the Universal Declaration of Human Rights and endorsed its ideals of upholding freedom of opinion and expression, the privacy of home and correspondence, and the right to seek and impart information and ideas

More at https://www.globalresearch.ca/telcos-losing-battle-impose-5g/5691065

187032 ▶▶ Richard O, replying to PastImperfect, 7, #1475 of 2327 🔗

I often wonder, given how every aspect of the human experience that is uplifting and creates community has been mercilessly and relentlessly targeted for annihilation, whether AI is already in charge.

187041 ▶▶▶ OKUK, replying to Richard O, #1476 of 2327 🔗

Now there’s an interesting idea!

187060 ▶▶▶▶ Richard O, replying to OKUK, 1, #1477 of 2327 🔗

There is a new drama series on Fox call neXt which explores this exact scenario. We would all like to think that this is still confined to the realm of science fiction, but the sheer scope of the war against humanity itself is so breathtaking that I cannot help but speculate otherwise.

187076 ▶▶▶▶▶ OKUK, replying to Richard O, #1478 of 2327 🔗

Has AI been fiddling with Ferguson’s spreadsheet?

187081 ▶▶▶▶▶▶ Richard O, replying to OKUK, 2, #1479 of 2327 🔗

Definitely not, only a stupid human being would use Excel for data modelling.

187119 ▶▶▶▶▶ Jonathan Palmer, replying to Richard O, 2, #1480 of 2327 🔗

When me and a friend would muse on the future in happier times we always came to the conclusion it would be like terminator minus the time travel

187054 ▶▶ MiriamW-sometimes-AlanG, replying to PastImperfect, 2, #1481 of 2327 🔗

When I was a child a popular expressions was ‘S/he’s faced all round like the Royal Liver Clock’ (I’m from near Liverpool). Would this be appropriate for the Rt Hon Never-Going-Back-to-Normal? MW

187055 ▶▶ Dan Clarke, replying to PastImperfect, 1, #1482 of 2327 🔗

Now that he is part of the elite and will be immune from it, he approves.

187140 ▶▶ annie, replying to PastImperfect, #1483 of 2327 🔗

That is just unbelievable.

187162 ▶▶▶ Cheezilla, replying to annie, 2, #1484 of 2327 🔗

No it’s typical.
Do you remember when Toby described DePiffle’s first Oxford debate? He seemed to think it showed his talent.
I thought it demonstrated his complete lack of conviction and scruples. The fact that he spoke for both sides of the argument showed that he didn’t give a toss about either viewpoint and was effectively mocking the debating society.
Shallow, arrogant, barefaced liar!

187265 ▶▶▶▶ annie, replying to Cheezilla, #1485 of 2327 🔗

Barefaced ed? How does he manage that?

187025 Moomin, replying to Moomin, 4, #1486 of 2327 🔗

We need to support these guys, I think this could be the start of the tide really turning, real people, telling real truth and standing up to the lies:

https://m.facebook.com/EmpoweredFitGym/

187039 ▶▶ nocheesegromit, replying to Moomin, #1487 of 2327 🔗

See Hannahbanana’s post below.

187040 ▶▶ Cheezilla, replying to Moomin, 3, #1488 of 2327 🔗

We have big movement.
More news coverage today.
MP’s are backing us.
Meeting with a big corp who wants to back us vocally and legally.
Meeting with the Mayor.
We will do this
We stand with BodyTech and all the others (70+ now)

Interview on the Beeb at 9.30. I hope they’re given a fair opportunity to put their arguments properly.

They were given a good chance to put their case here:

https://www.bbc.co.uk/news/business-54535679?fbclid=IwAR11NMwpRuqC-xdMqr7zsYZhZPpmVswYrfnw_SFHrqGfw0h0DbFYDOCqwQk

187028 Nic, replying to Nic, 3, #1489 of 2327 🔗

We do.twice as much testing as any other European country crazy .just a useless stat today both holland and belgium posted over 7 k infections
They both have populations well under 20 million which would mean taking that in to consideration they would have a rate to day of about 50 k today com.pared to us.
Wasnt boris impressed with Belgium’s stratergy he even go the 10 pm p curfew off them.

187038 ▶▶ OKUK, replying to Nic, 2, #1490 of 2327 🔗

Belgium – second only to Peru in the world Covid death league.

187239 ▶▶ Banjones, replying to Nic, #1491 of 2327 🔗

I thought they got their ideas from Demented Dan in Victoria, Australia – curfew and all.

187034 DThom, replying to DThom, 8, #1492 of 2327 🔗

Was in M & S today. Could not believe the latest. Apparently you can now book online to be given a slot to shop in the store – enables you to bypass the q! Unbelievable
At least they don’t challenge masks.

187115 ▶▶ Cheezilla, replying to DThom, 1, #1493 of 2327 🔗

I suppose it’ll be better than standing outside in the cold and rain, which I suspect is soon to be reinflicted on us.

187136 ▶▶▶ JohnB, replying to Cheezilla, 1, #1494 of 2327 🔗

Interesting – our local Waitrose has a covered approach, the local Tesco and Aldi do not.

187152 ▶▶▶▶ Cheezilla, replying to JohnB, #1495 of 2327 🔗

Most supermarkets don’t have cover except for the trolleys!
They were originally designed to welcome loads of customers straight in, without impeding their inward progress.

187232 ▶▶▶▶ dorset dumpling, replying to JohnB, #1496 of 2327 🔗

Likewise here and add Sainsbury’s to Tesco and Aldi.

187035 OKUK, replying to OKUK, 42, #1497 of 2327 🔗

Once again can I put in a plug for Talk Radio. I’m nothing to do with the station but I am finding it vital for maintaining sanity during this second descent into mass hysteria and acts of self harm on a national scale. Every time I tune I hear sceptical arguments being given a fair run and presenters asking the right questions about the Lockdown Lunacy. If you haven’t come across it yet, give it a try. It’s like living in a parallel universe – a sane one.

187046 ▶▶ CGL, replying to OKUK, 13, #1498 of 2327 🔗

Yes we like all the presenters – not always bothered about Ian wotsisname in the afternoon but Julia Hartley-Brewer, Mike Graham and Dan Wootten are great. Only proper issue is they are ok with muzzles.

187072 ▶▶▶ petgor, replying to CGL, 1, #1499 of 2327 🔗

Ian Collins is different but he is in line with other TR presenters.

187099 ▶▶▶▶ CGL, replying to petgor, 1, #1500 of 2327 🔗

Yes – i thought he was better today, but sometimes just sounds a bit wishy washy or confused

187123 ▶▶▶▶▶ Cheezilla, replying to CGL, 1, #1501 of 2327 🔗

Maybe he’s still getting there.

187094 ▶▶▶ OKUK, replying to CGL, 4, #1502 of 2327 🔗

I think most of them admit to supporting the first lockdown which lends credibility to their strong opposition to these fresh acts of national self harm.

Can it be long before Ofcom move in to close them down?

187103 ▶▶▶▶ CGL, replying to OKUK, 2, #1503 of 2327 🔗

Have to say I was on board initially – to flatten the curve made some sort of sense then (sorry if that offends anyone here!) – although even on day 1 I did say theres something funny going on. I think I was in shock really though at that point.

187129 ▶▶▶▶▶ OKUK, replying to CGL, 3, #1504 of 2327 🔗

Yes I was similar, but only on the basis that the government had incompetently failed to plan for a pandemic, and so we had to try and slow the spread initially. That justification no longer applies.

187156 ▶▶▶ Banjones, replying to CGL, 2, #1505 of 2327 🔗

Mike’s interview with Neil Oliver was worth a listen/watch.

187213 ▶▶▶ Dave #KBF, replying to CGL, #1506 of 2327 🔗

James Whale in the evening is a disappointment, this evening I turned over to LBC, Iain Dale was even more disappointing.

187287 ▶▶▶▶ Mr Dee, replying to Dave #KBF, #1507 of 2327 🔗

Shame, I used to love listening to James Whale back in the late 90s.

187245 ▶▶▶ John P, replying to CGL, 1, #1508 of 2327 🔗

I think in fairness to them they are going along with the rules on masks without great enthusiasm. Mark Dolan cut one up on air, but on their “Plank of the Week” review a week ago admitted to wearing them even when he did not strictly have to.

187053 ▶▶ petgor, replying to OKUK, 8, #1509 of 2327 🔗

You are right. But it is annoying that TR’s news headlines always pump out the governments line. But th